Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print January 8, 2003.
Biol Reprod 2003, 10.1095/biolreprod.102.009191
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/1/22    most recent
biolreprod.102.009191v2
biolreprod.102.009191v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.
Agricola
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.
BIOLOGY OF REPRODUCTION 69, 22–29 (2003)
DOI: 10.1095/biolreprod.102.009191
© 2003 by the Society for the Study of Reproduction, Inc.


Ovary

Insulin-Like Growth Factor Binding Protein 4 Expression Parallels Luteinizing Hormone Receptor Expression and Follicular Luteinization in the Primate Ovary

Jian Zhou1,2, Jie Wang2, Dina Penny2, Philippe Monget2,3, Jose A. Arraztoa2, Larry J. Fogelson2, and Carolyn A. Bondy2

Developmental Endocrinology Branch,2 NICHD, NIH, Bethesda, Maryland 20892 INRA,3 PRMD, URA CNRS 1291, 37380 Nouzilly, France


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It has been suggested that locally produced insulin-like growth factor binding protein 4 (IGFBP4) inhibits ovarian follicular growth and ovulation by interfering with IGF action. According to this hypothesis, IGFBP4-expressing follicles should demonstrate atresia, whereas healthy dominant follicles should be devoid of IGFBP4. Alternatively, according to this view, there could be constitutive expression of the inhibitory IGFBP4 but selective expression of an IGFBP4 protease in dominant follicles, allowing the follicle to mature and ovulate because of degradation of the binding protein. To examine these views concerning the role of IGFBP4 in primate follicular selection, we analyzed cellular patterns of IGFs 1 and 2, IGFBP4, and the IGFBP4 protease (pregnancy-associated plasma protein A [PAPP-A]) mRNA expression in ovaries from late follicular phase rhesus monkeys using in situ hybridization. The IGF1 mRNA was not detected, but the IGF2 mRNA was abundant in theca interna and externa of all antral follicles and was present in the granulosa of large preovulatory and ovulatory follicles. The IGFBP4 mRNA was selectively expressed by LH receptor (LHR) mRNA-positive theca interna cells of healthy antral follicles (defined by aromatase and gonadotropin receptor expression) and by LHR-expressing granulosa cells found only in large preovulatory and ovulatory follicles (defined by size and aromatase expression). The PAPP-A mRNA was abundant in granulosa cells of most follicles without obvious relation to IGFBP4 expression. Ovarian IGFBP4 mRNA levels were markedly increased after treatment with the LH analog, hCG, whereas IGF2 and PAPP-A mRNAs were not significantly altered. In summary, IGFBP4 expression appears to be associated with follicular selection, not with atresia, in the monkey ovary. The IGFBP4 is consistently expressed in healthy theca interna and in luteinized granulosa cells, likely under LH regulation. The IGFBP4 protease, PAPP-A, is widely expressed without apparent selectivity for IGFBP4-expressing follicles or for dominant follicles. These observations suggest that IGFBP4 or an IGFBP4 proteolytic product may be involved with LH-induced steroidogenesis and/or luteinization rather than with inhibition of follicular growth.

follicular development, granulosa cells, human chorionic gonadotropin, insulin-like growth factor receptor, ovulation


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The human insulin-like growth factor (IGF) system includes two ligands, IGF1 and IGF2; a membrane-spanning, tyrosine kinase receptor that transduces both ligands known as the IGF1 receptor (reviewed in [1]); and a family of high-affinity IGF binding proteins (IGFBPs 1–6). Both IGF1 and the IGF1 receptor are highly expressed in murine granulosa cells [24], where IGF1 expression is significantly correlated with ovarian follicular growth and FSH receptor (FSHR) expression [5, 6]. In vitro studies show that IGF1 enhances FSH-stimulated steroid biosynthesis and proliferation (reviewed in [7]). The IGF1 gene-deletion mouse is infertile, with ovarian follicles arrested at a preantral stage of development [8]. The IGF1 null mice are resistant to exogenous gonadotropins and demonstrate reduced follicular FSHR and glucose transporter expression [6, 9] as well as reduced granulosa proliferation [10]. Whereas IGF1 clearly plays an important autocrine role in murine ovarian follicular development, it is barely detected in the human ovary, whereas IGF2 is abundant [1114]. It is unknown if the role of IGF2 in the human ovary replicates that of IGF1 in the murine ovary. In vitro studies show that IGF2 promotes human granulosa cell steroidogenesis and proliferation in an FSH-dependent manner [15], suggesting that IGF2 may indeed serve an IGF1-like role in human follicular development. However, limited data regarding IGF2 expression patterns in the human ovary reveal fundamental differences compared with the cellular patterns of IGF1 expression in the rodent [13, 14], suggesting that IGF2 may function somewhat differently in human follicular development.

The IGFBPs bind IGFs in the bloodstream and extracellular fluids and thereby increase IGF half-life; IGFBPs may stabilize or neutralize IGFs in extracellular spaces and may also have IGF-independent actions (reviewed in [16]). Because of their ability to neutralize or inhibit the effects of IGF, it has been suggested that IGFBPs may induce ovarian follicular atresia. The IGFBPs are abundant in ovarian follicles [1719, additional references in 20]), where their function remains a matter of active investigation. In vitro studies show that addition of intact IGFBP4 to the culture medium inhibits gonadotropin-induced steroid synthesis by theca and granulosa cells [21, 22]. In human and large domestic animal follicular fluid, the presence of IGFBP4 proteolytic fragments has been correlated with follicular selection (studies reviewed in [20]). Recently, the expression of an IGFBP4 protease, pregnancy-associated plasma protein A (PAPP-A), has been reported in healthy human follicles and corpora lutea [2325]. These observations have led to the suggestion that selective proteolysis of IGFBP4 may promote the emergence of a dominant follicle. Detailed studies of cellular patterns and hormonal and/or cyclic regulation of IGF, IGFBP4, and PAPP-A expression in the human ovary have been limited for obvious reasons. To further elucidate the potential roles/interactions of these factors in human follicular development, we turned to the rhesus monkey, which has an ovarian cycle very similar to that of the human. Preliminary studies showed similar patterns of IGF system expression in the human and rhesus ovary [26], and so in the present study, we examined cellular patterns of IGF, IGFBP4, and PAPP-A gene expression during follicular development and hCG treatment in the rhesus macaque monkey.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Female rhesus monkeys (Macacca mulatta; age, 6–13 yr) from the National Institutes of Health (NIH) Poolesville colony were used in accordance with a protocol approved by the NICHD Animal Care and Use Committee. Ovariectomies were performed on regularly cycling (with at least three sequential cycles of 26–30 days in duration), late follicular phase monkeys under ketamine anesthesia via a midventral laparotomy. The animals were in Cycle Day 14 at ovariectomy. Two animals were treated with hCG (1000 IU i.m.) daily beginning on Cycle Day 7 before ovariectomy. Ovaries were snap-frozen on dry ice and stored at -70°C. Serial sections (thickness, 10 µm) were cut at -15°C and thaw-mounted onto poly-L-lysine-coated slides for in situ hybridization and immunohistochemistry.

Clones Used for Riboprobe Synthesis

The rat IGF2 and human IGFBP4 clones used for cRNA probe synthesis have been previously described [13]. The human LH receptor (LHR) cDNA was a 1250-base pair (bp) segment subcloned into pCRscript. The human FSHR cDNA was a gift from Ares Advanced Technology (Randolph, MA). This 2118-bp fragment was subcloned into pSV.Sport. The sense and antisense constructs were linearized with EcoRI and KpnI, respectively. The human aromatase 273-bp fragment was generated by polymerase chain reaction (PCR). Oligonucleotides were synthesized and used as primers. The sequence of the 20-mer 3'-oligonucleotide was 5' TTGTTGTTAAATATGATGCC 3', and the sequence of the 20-mer 5'-oligonucleotide was 5' ATACCAGGTCCTGGCTACTG 3'. The 572-bp human PAPP-A cDNA was generated from human placenta cDNA by PCR, cloned into pGEM-T Easy vector, and generously provided by Eli Adashi (University of Utah, Salt Lake City, UT) [25].

In Situ Hybridization

The 35S-labeled RNA probes were synthesized to a specific activity of approximately 2 x 108 dpm/µg in a protocol that has been previously described [13]. The specificity of the in situ hybridization results was evaluated by hybridization of parallel sections with sense probes, which produced a nearly undetectable radioactive signal. The quantification of hybridization signal was carried out in a blinded fashion. Hybridization signal was captured using NIH image v1.57 software (Bethesda, MD). Ten measurements were obtained and meaned for each cell type in each animal after subtraction of background signal. The values were compared using ANOVA. Significant differences among means were determined using ANOVA followed by the Fischer least significant difference test. Correlation between IGFBP4 and LHR expression was assessed by chi-square analysis (Statview 5.0, SAS Institute, Cary, NC).

Immunohistochemistry

Immunohistochemistry for cell proliferation Ki67 was performed by the avidin-biotin-immunoperoxidase technique. The mouse anti-human Ki67 sera (Boehringer Mannheim, Indianapolis, IN) detects a nonhistone protein associated with the nuclear matrix expressed in all proliferating cells in the G1, S, G2, and M phases of the cell cycle. Fresh-frozen tissue sections were fixed and incubated overnight at 4°C with a 1:50 dilution of mouse anti-human Ki67 antibody or with 1% PBS as control. Thereafter, tissue sections were treated with biotinylated sheep anti-mouse immunoglobulin G (1:40) for 30 min at room temperature followed by a 45-min incubation with the avidin-biotin-peroxidase complex (Vectastain ABC Elite Peroxidase Kit; Vector Laboratories, Burlingame, CA). The antigen-antibody complex was visualized by incubation with freshly prepared 3,3'-diaminobenzidine (DAB substrate kit; Vector Laboratories) and the tissue counterstained with methyl green.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Normal Midcycle Ovaries

A single dominant follicle was apparent in one ovary from each of the three normal, untreated, midcycle monkeys. The dominant follicle was identified on the basis of size (maximum diameter, >2 mm) and aromatase expression by the membrana granulosa (Fig. 1). The dominant follicle seen in Figure 1A is relatively small compared with the other two samples, one of which was in the process of ovulation at the time of collection (Fig. 1I). The animal from which the ovary shown in Figure 1A was obtained tended to have long cycles (28–30 days), so this follicle probably represents a slightly earlier stage of maturation. One or more degenerating corpora lutea from previous cycles were found in each ovary (Fig. 1, A and E). A relatively large and healthy-appearing corpus luteum was found in the nondominant ovary from each animal, indicative of a recent ovulation. Approximately 20 small to medium-sized (diameter, 500–1500 µm) antral follicles were found in each ovary. Sequential sections, taken approximately every 300 µm throughout the whole of each ovary, were analyzed for expression of the proliferation-specific Ki67 antigen, LH, FSHR, and aromatase mRNAs to characterize each follicle in terms of growth and selection potential for comparison with IGF system component expression.



View larger version (158K):
[in this window]
[in a new window]
 
FIG. 1. IGF2 and IGFBP4 gene expression in normal midcycle (Day 14) rhesus monkey ovaries. On the extreme left of each row are hematoxylin and eosin (H&E)-stained ovarian sections. The subsequent panels show film autoradiographs of sequential sections hybridized to cRNA probes for IGF2, IGFBP4, and aromatase (ARO) or, in L, the IGFBP4 protease, PAPP-A (PAPP). A single dominant follicle (DF), defined by maximum cross-sectional diameter > 2 mm and aromatase expression, is apparent in each ovary. The emerging DF in AD has the highest aromatase expression, but other, smaller follicles still have discernible aromatase and IGFBP4 expression (C and D). In the more advanced DF seen in EH, aromatase and IGFBP4 expression are restricted to the DF, whereas IGF2 mRNA is still evident in numerous smaller follicles. The DF in I is in the process of ovulating, and IGF2, IGFBP4, and PAPP-A mRNAs are abundant in the exfoliating membrana granulose (JL). This ovary is cut through the ovarian pedicle, and the profusion of engorged blood vessels (BV) is quite impressive. CL, Corpus luteum; GC, granulosa cell. Bar = 0.8 mm

The IGF1 mRNA is not detected in any follicles of the midcycle monkey ovary (not shown). The IGF1 receptor mRNA is abundant in granulosa cells and less abundant but present in theca cells of all follicles in the monkey ovary, similar to patterns seen in other species [4, 13, 14, 26]. The IGF2 mRNA is abundant in the thecal compartments of all antral follicles (Fig. 1, B, F, and J). It is localized in the theca interna and in stromal elements of the theca externa but not in the granulosa of nondominant antral follicles (Fig. 2). The IGFBP4 mRNA is also expressed in the theca of developing follicles (Figs. 1 and 2). The pattern, however, is not the same as that of IGF2. First, IGFBP4 expression is more selective, localized in the theca only in healthy, growing follicles, whereas IGF2 is detected in both thecal layers of virtually all antral follicles.



View larger version (146K):
[in this window]
[in a new window]
 
FIG. 2. IGF2 and IGFBP4 mRNAs are localized in the theca of developing antral follicles. This figure shows paired bright- (A, C, E, G) and dark-field (B, D, F, H) photomicrographs, with the hybrid signal appearing as white grains in the dark-field illumination. The sections represent different levels through the same ovarian follicle. The IGFBP4 mRNA is selectively localized in the theca interna (TI), whereas the IGF2 mRNA is present in both TI and theca externa (TE), and in stromal blood vessels. The LHR mRNA is localized exclusively in the TI, similar to IGFBP4. The FSHR mRNA in contrast is confined to granulosa cells (GC). Bar = 200 µm

The health status of antral follicles was determined by the presence or absence of aromatase and FSHR expression. Of approximately 130 antral follicles examined in the six ovaries, 45 were aromatase- and FSHR-positive; 42 of these also demonstrated thecal IGFBP4 expression. The IGFBP4 mRNA is detected only in the steroidogenic theca interna of small to medium-sized antral follicles, whereas IGF2 is expressed in both thecal compartments (Fig. 2). Comparing IGFBP4 and LHR localization shows that these two mRNAs are colocalized in the theca interna of the same subset of antral follicles, with less than 2% of follicles being either LHR-positive and IGFBP4-negative or the converse (the correlation between IGFBP4 and LHR expression in antral follicles is significant by chi-square analysis, P < 0.0001).

The IGF2 and IGFBP4 mRNAs are not detected in granulosa cells in most follicles (Figs. 2 and 3). Interestingly, it appears that IGFBP4 expression first appears in granulosa cells in parallel with the appearance of LHR expression, seen first in mural cells (Fig. 3, C and D). Abundant IGF2 and IGFBP4 mRNA levels are found in periovulatory granulosa (Figs. 1 and 4). Figure 4 shows IGF2 and IGFBP4 gene expression in granulosa cells of a healthy preovulatory follicle demonstrating proliferation and aromatase, FSHR, and LHR expression, showing that these are healthy, mature granulosa cells. It is worth noting that aromatase, IGFBP4, and the gonadotropin receptors demonstrate a very homogeneous pattern of expression in the membrana granulosa. The IGF2 mRNA, in contrast, is rather patchy in distribution, suggesting that it could actually be expressed by invading stromal elements rather than by granulosa cells (Figs. 1J and 4E).



View larger version (136K):
[in this window]
[in a new window]
 
FIG. 3. IGF2, IGFBP4, and LHR mRNA expression beginning in granulosa cells. The IGFBP4 (D) expression closely tracks LHR (C) expression, appearing in the mural before the antral granulosa cells (arrowheads). The IGF2 (B) is not detected in the granulosa at this stage. (A) GC, granulosa cell; HE, hematoxylin and eosin; TI, theca interna. Bar = 100 µm



View larger version (86K):
[in this window]
[in a new window]
 
FIG. 4. IGF2 and IGFBP4 gene expression in the granulosa cells of a mature dominant follicle. These micrographs show high-magnification views of the wall of the large dominant follicle seen in Fig. 1E. B) Immunohistochemical detection of the cell proliferation antigen Ki67 in granulosa cells of this follicle. BF) Green-filtered, dark-field illuminations of aromatase (ARO; B), FSHR (C), LHR (D), IGF2 (E), and IGFBP4 (F) mRNAs in which the hybrid signal appears as green grains. Aromatase and FSHR mRNAs are confined to granulosa cells (GC), whereas LHR, IGF2, and IGFBP4 are expressed in both GC and theca interna (TI) of this ovulatory follicle. Bar = 25 µm

The PAPP-A mRNA is detected in granulosa cells of follicles of all sizes, whereas IGFBP4 expression is confined to the theca of nondominant follicles (Fig. 5). No anatomical correlation was apparent between PAPP-A and LHR expression.



View larger version (104K):
[in this window]
[in a new window]
 
FIG. 5. IGFBP4 and PAPP-A gene expression in midcycle primate ovary. The dark-field micrographs are from sections through the same group of follicles at slightly different levels; for example, the small middle follicle seen tangentially in B is out of the plane of section for C. The IGFBP4 mRNA (B) is localized in the theca interna (TI) of these two antral follicles, whereas PAPP-A (PAPP; C) is localized in the granulosa cells (GC). HE, Hematoxylin and eosin. Bar = 100 µm

Ovaries from hCG-Treated Monkeys

As we have shown above, IGFBP4 expression and LHR expression appear to be highly correlated in the monkey ovary. The IGFBP4 mRNA is selectively expressed in LHR mRNA-positive theca interna cells of smaller follicles and in both theca and granulosa cells of periovulatory follicles. Within the individual follicle, IGFBP4 expression also closely tracks LHR expression, such as by appearing in the mural before the antral granulosa cells (Fig. 3). The observed coincidence between IGFBP4 LHR gene expressions suggested that LH might regulate IGFBP4 expression. To test this hypothesis, two regularly cycling monkeys were treated with hCG for 7 days before ovariectomy at Cycle Day 14. The goal of this treatment was to evaluate the effects of pharmacological doses of the LH analog on IGFBP4 expression in vivo at a cycle stage matched to that of our normal control animals. Morphological evaluation showed that one of the hCG-treated monkeys had two large, dominant follicles, one in each ovary, whereas the other had a single dominant follicle. The number of small to medium-sized antral follicles was similar to that of the controls, whereas each ovary demonstrated several relatively hypertrophied corpora lutea. The IGFBP4 levels were markedly increased after hCG treatment in developing follicles (both theca and granulosa) and corpora lutea (Fig. 6 and Table 1). The hybridization signal showed a greater than 2-fold increase in IGFBP4 mRNA (P = 0.005). The PAPP-A mRNA also appeared to be increased by hCG treatment (Fig. 6), but the effect was not statistically significant (P = 0.26). The IGF2 gene expression, in contrast to IGFBP4, was detected in the theca of many follicles where LHR was not present, primarily in the theca externa (where LHR expression is never found), and thus did not correlate with LHR expression. The IGF2 mRNA was detected in microvessels but not in corpora lutea granulosa or theca lutein cells, and it was not altered by hCG treatment (data not shown).



View larger version (132K):
[in this window]
[in a new window]
 
FIG. 6. Treatment with hCG increases IGFBP4 gene expression. Representative film autoradiographs comparing LHR, IGFBP4, and PAPP-A (PAPP) mRNA localization in sequential sections from an untreated midcycle monkey ovary (AC) and from an hCG-treated midcycle monkey ovary (DF). Both are nondominant ovaries with relatively fresh corpus lutea from the previous cycle. The IGFBP4 and PAPP-A mRNAs are selectively localized in LHR-expressing follicles, but little IGFBP4 or PAPP-A mRNA is detected in the corpus luteum (CL) of the untreated monkey ovary (as also seen in Fig. 1C). After hCG treatment, however, IGFBP4 and PAPP-A expression are abundant in the CL and increased in the antral follicles (E and F). A couple of small scars of old CL can be seen at the lower pole of the ovary, which are also demonstrating heightened IGFBP4 and PAPP-A expression. Bar = 1 mm


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of hcG treatment on ovary mRNA levels.a

Interestingly, little LHR expression was found in the residual corpora lutea of the normal midcycle ovary, but after several days of hCG treatment, corpora lutea LHR expression was markedly increased (Fig. 6 and Table 1). The LHR expression in antral follicles, however, showed a small but significant decrease after hCG treatment.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study offers novel observations regarding cellular expression patterns for the putative atretogenic factor, IGFBP4, and an IGFBP4 protease, PAPP-A, in growing and mature follicles from normal midcycle and hCG-treated monkeys. An important finding of the present study is that IGFBP4 gene expression is selective for LHR-expressing theca and granulosa cells of healthy follicles and is stimulated by the LH-analog hCG. The observation that IGFBP4 gene expression is selective for healthy follicles is supported by demonstration of FSHR and aromatase expression by IGFBP4-expressing follicles. These observations, together with the finding of intense IGFBP4 expression in (hCG-treated) corpora luteal cells, suggest a role for IGFBP4 in LH-induced steroidogenesis or luteinization rather than in inhibiting follicular development.

In terms of cycle duration and all known aspects of follicular development and function, the rhesus monkey is thought to provide an excellent model for human ovarian function. The ovaries examined in the present study were obtained from young, healthy, regularly cycling monkeys at closely timed midcycle stages. Their reproductive health is reflected by the presence of robust dominant follicles in all monkeys in addition to large cohorts of healthy antral follicles and the presence of recent corpora lutea. A unique feature of this study is the application of a battery of assays (Ki67, aromatase, and LHR and FSHR expression) to characterize the developmental state and gonadotropin responsiveness of each follicle. The IGFBP4 also appears to be expressed by healthy theca interna and corpora lutea in human ovaries [13, 14]. More detailed, cycle-stage specific information regarding the porcine ovary shows that IGFBP4 mRNA is concentrated in the theca of growing follicles, in the granulosa cells of mature dominant follicles, and in the corpora lutea of luteal phase ovaries, also tracking LHR expression [27]. The IGFBP4 is also concentrated in the theca of healthy, growing follicles in the bovine ovary and is increased by LH/hCG treatment [28]. The LH/hCG treatment also increases IGFBP4 expression in the murine ovary [29, 30]. Thus, LH/hCG treatment stimulates ovarian IGFBP4 expression in rodents, large animals, and primates, and IGFBP4 expression closely parallels LHR expression in healthy developing follicles and corpora lutea in large animals, including nonhuman primates and, likely, the human. The expression of LHR and IGFBP4 by the same cells suggests that this may be a direct effect by LH on IGFBP4 mRNA levels, or it could be an indirect effect of increased differentiation of LHR-expressing cells.

A refinement of the view that IGFBP4 promotes follicular atresia involves the idea that selective proteolysis of IGFBP4 occurs in ovulatory follicles. This hypothesis is based on the observation of abundant IGFBP4 fragments in the follicular fluid from human dominant follicles and IGFBP4 proteolytic activity in fluid from large animal dominant follicles (reviewed in [20]). The enzyme implicated in IGFBP4 proteolysis in follicular fluid has recently been identified as PAPP-A [23, 24]. The PAPP-A is present in the circulation of pregnant women bound to another protein known as the proform of the major eosinophil basic protein (proMBP), which inhibits its proteolytic activity. The source and function of this protein complex in the circulation is unclear. The PAPP-A in ovarian follicular fluid is produced by granulosa cells and may be associated with proMBP [23, 24], and its proteolytic activity is stimulated by IGFs 1 and 2 [30]. The PAPP-A-mediated IGFBP4 cleavage yields two major products of approximately 10 and 17 kDa, which have not been evaluated in terms of potential IGF-independent effects on follicular function.

The view that IGFBP4 proteolysis is required for follicular selection implies that the binding protein is constitutively expressed and inhibits IGF2 and, hence, the development of all follicles except the select few that express PAPP-A, which allows follicular development to proceed by degrading IGFBP4. The present study shows, however, that IGFBP4 is selectively expressed in healthy follicles, whereas PAPP-A seems to be more widely expressed. Moreover, as shown in the present study and previously [23, 24, 30], IGFBP4 expression is enhanced by gonadotropins, whereas this is not apparent for PAPP-A. A recent study on human surgical specimens [23] suggests, however, that PAPP-A is selectively expressed in healthy antral follicles and corpora lutea. This divergence could be explained by a species difference in ovarian PAPP-A expression in human and nonhuman primates, or it could reflect the fact that all the monkeys were in midcycle but that the gynecological surgery patients may have been in different cycle stages or even not cycling at all. An alternative explanation for the increased abundance of IGFBP4 fragments in dominant follicle fluid may be that the substrate, IGFBP4, is more abundant in LH-selected follicles. Moreover, if PAPP-A proteolytic activity is enhanced by IGF2 [30], then the greater proteolytic activity in dominant follicles may reflect the abundance of IGF2 in these follicles.

In the intense focus on inhibitors, and on inhibitors of inhibitors (with a potential tertiary inhibitor, proMBP, on the horizon), one could lose sight of the supposed primary effectors of follicular development, IGFs. If IGFs are, in fact, important effectors of follicular selection, then selective regulation of IGF expression seems to be a more direct, economical mechanism than invoking multiple layers of inhibitory factors. And in fact, granulosa cell IGF1 or IGF2 expression appears to be selective for healthy follicles in most species, although perhaps not in ruminant species.

It seems unlikely that the highly selective expression of IGFBP4 in healthy follicles and corpora lutea and its regulation by LH are consistent with a role in follicular demise. Why would IGFBP4 gene expression be concentrated in healthy developing follicles and corpora lutea if its role is to inhibit follicle selection? Moreover, it seems unlikely that LH would stimulate the production of a factor that inhibits LH-induced steroidogenesis or follicular selection. An alternative interpretation for these observations and for the finding that PAPP-A and IGFBP4 proteolytic products are abundant in dominant follicles is that PAPP-A is involved in posttranslational processing of IGFBP4 and that an IGFBP4-derived peptide promotes LH-induced steroidogenesis and/or luteinization. Exogenous intact IGFBP4, which binds and inhibits IGF action, inhibits steroidogenesis in vitro, but a proteolytic product generated in vivo may, as a matter of speculation, have IGF-independent effects that enhance LH activity. Further studies are required to investigate potential effects of IGFBP4 peptides on follicular development and ovarian steroidogenesis.


    ACKNOWLEDGMENTS
 
We thank Ricardo Dreyfuss for expert photomicrography and Eli Adashi for providing the PAPP-A clone.


    FOOTNOTES
 
1 Correspondence: Jian Zhou, Bg. 10, Rm. 10N262, NIH, Bethesda, MD 20892. FAX: 301 402 2922; zhouj{at}mail.nih.gov Back

Received: 11 July 2002.

First decision: 5 August 2002.

Accepted: 3 January 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Le Roith D, Bondy C, Yakar S, Liu JL, Butler A. The somatomedin hypothesis: 2001. Endocr Rev 2001 22:53-74[Abstract/Free Full Text]
  2. Hernandez ER, Roberts CT, LeRoith CT, Adashi EY. Rat ovarian IGF-I gene expression is granulosa cell-selective. Endocrinology 1989 125:572-574[Abstract/Free Full Text]
  3. Oliver JE, Aitman JR, Powell JF, Wilson CA, Clayton RN. IGF-I gene expression in the rat ovary is confined to the granulosa cells of developing follicles. Endocrinology 1989 124:2671-2679[Abstract/Free Full Text]
  4. Zhou J, Chin E, Bondy CA. Cellular pattern of IGF-I and IGF-I receptor gene expression in the developing and mature follicle. Endocrinology 1991 129:3281-3288[Abstract/Free Full Text]
  5. Zhou J, ReFeuzo J, Bondy CA. Granulosa cell DNA synthesis is strictly correlated with the presence of IGF-I and absence of AP-1 expression in vivo. Mol Endocrinol 1995 9:924-932[Abstract/Free Full Text]
  6. Zhou J, Kumar TR, Matzuk MM, Bondy CA. Insulin-like growth factor I regulates gonadotropin responsiveness in the murine ovary. Mol Endocrinol 1997 11:1924-1997[Abstract/Free Full Text]
  7. Adashi EY. The IGF family and folliculogenesis. J Reprod Immunol 1998 39:13-9[CrossRef][Medline]
  8. Baker J, Hardy MP, Zhou J, Bondy CA, Lupu F, Bellve A, Efstratiadis A. Effects of an IGF-I null mutation on mouse reproduction. Mol Endocrinol 1996 10:903-918[Abstract/Free Full Text]
  9. Zhou J, Bievre M, Bondy CA. Reduced GLUT1 expression in Igf1-/- null oocytes and follicles. Growth Horm IGF Res 2000 10:111-117[CrossRef][Medline]
  10. Kadakia R, Arraztoa JA, Bondy CA, Zhou J. Estrogen-induced proliferation is impaired in the Igf1 null ovary. Growth Horm IGF Res 2001 11:220-224[CrossRef][Medline]
  11. Geisthovel F, Moretti-Rojas I, Asch RH, Rojas FJ. Expression of IGF-II but not IGF-I mRNA in human preovulatory granulosa cells. Hum Reprod 1989 4:899-902[Abstract/Free Full Text]
  12. Hernandez ER, Hurwitz A, Vera A, Pellicer A, Adashi EY, LeRoith D, Roberts CT. Expression of the genes encoding the IGFs and their receptors in the human ovary. J Clin Endocrinol Metab 1992 74:419-425[Abstract]
  13. Zhou J, Bondy CA. Anatomy of the human ovarian IGF system. Biol Reprod 1993 48:467-482[Abstract]
  14. el-Roeiy A, Chen X, Roberts VJ, Shimasakai S, Ling N, LeRoith D, Roberts CT Jr, Yen SS. Expression of the genes encoding the insulin-like growth factors (IGF-I and -II), the IGF and insulin receptors, and IGF-binding proteins-1–6 and the localization of their gene products in normal and polycystic ovary syndrome ovaries. J Clin Endocrinol Metab 1994 78:1488-1496[Abstract]
  15. Yuan W, Giudice LC. Insulin-like growth factor-II mediates the steroidogenic and growth promoting actions of follicle stimulating hormone on human ovarian pre-antral follicles cultured in vitro. J Clin Endocrinol Metab 1999 84:1479-1482[Abstract/Free Full Text]
  16. Baxter RC. Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. Am J Physiol 2000 278:E967-E976
  17. Adashi EY, Resnick CE, Hernandez ER, Hurwitz A, Rosenfeld RG. Ovarian granulosa cell-derived IGF binding proteins: constitutive release of low molecular weight, high affinity IGF selective species. Mol Cell Endocrinol 1990 74:175-185[CrossRef][Medline]
  18. Cataldo NA, Giudice LG. IGFBP profiles in human ovarian follicular fluid correlate with follicular functional status. J Clin Endocrinol Metab 1992 74:821-829[Abstract]
  19. Hartshorne GM, Bell SC, Waites GT. Binding proteins for insulin-like growth factors in the human ovary: identification, follicular fluid levels and immuno-histochemical localization of the 29–32 kd type I binding protein, IGFBP1. Hum Reprod 1990 5:649-655[Abstract/Free Full Text]
  20. Poretsky L, Cataldo NA, Rosenwaks Z, Giudice LC. The insulin-related ovarian regulatory system in health and disease. Endocr Rev 1999 20:535-582[Abstract/Free Full Text]
  21. Putowski L, Rohan RM, Choi DS, Scherzer WJ, Ricciarelli E, Mordacq J, Mayo KE, Adashi EY. Rat ovarian insulin-like growth factor binding protein-4: a hormone-dependent granulosa cell-derived antigonadotropin. J Soc Gynecol Investig 1997 4:3144-151[CrossRef][Medline]
  22. Mason HD, Cwyfan-Hughes S, Holly JM, Franks S. Potent inhibition of human ovarian steroidogenesis by IGFBP-4. J Clin Endocrinol Metab 1998 83:284-287[Abstract/Free Full Text]
  23. Conover CA, Faessen GF, Ilg KE, Chandrasekher YA, Christiansen M, Overgaard MT, Oxvig C, Giudice LC. PAPP-A is the IGFBP-4 protease secreted by human ovarian granulosa cells and is a marker of dominant follicle selection and the corpus luteum. Endocrinology 2001 142:2155-2158[Abstract/Free Full Text]
  24. Conover CA, Oxvig C, Overgaard MT, Christiansen M, Giudice LC. Evidence that the iIGFBP-4 protease in human ovarian follicular fluid is PAPP-A. J Clin Endocrinol Metab 1999 84:4742-4745[Abstract/Free Full Text]
  25. Hourvitz A, Widger AE, Filho FLT, Chang RJ, Adashi EY, Erickson GF. PAPP-A gene expression in human ovaries is restricted to healthy follicles and corpora lutea. J Clin Endocrinol Metab 2000 85:4916-4920[Abstract/Free Full Text]
  26. Bondy CA, Zhou J. Functional correlates of ovarian IGF system expression. Front Endocrinol 1996 19:59-70
  27. Zhou J, Adesanya OO, Vatzias G, Hammond JM, Bondy CA. Selective expression of IGF system during porcine ovary follicular selection. Endocrinology 1996 137:4893-4901[Abstract]
  28. Armstrong DG, Baxter G, Gutierrez CG, Hogg CO, Glazyrin AL, Campbell BK, Bramley TA, Webb R. IGFBP-2 and -4 mRNA expression in bovine ovarian follicles: effect of gonadotropins and developmental status. Endocrinol 1998 139:2146-2155[Abstract/Free Full Text]
  29. Wandji SA, Wood TL, Crawford J, Levison SW, Hammond JM. Expression of mouse ovarian insulin growth factor system components during follicular development and atresia. Endocrinol 1998 139:5205-5214[Abstract/Free Full Text]
  30. Mazerbourg S, Overgaard MT, Oxvig C, Christiansen M, Conover CA, Laurendeau I, Vidaud M, Tosser-Klopp G, Zapf J, Monget P. PAPP-A in ovine, bovine, porcine, and equine ovarian follicles: involvement in IGFBP4 proteolytic degradation and mRNA expression during follicular development. Endocrinol 2001 142:5243-5253[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
M. Matsui, B. Sonntag, S. S. Hwang, T. Byerly, A. Hourvitz, E. Y. Adashi, S. Shimasaki, and G. F. Erickson
Pregnancy-Associated Plasma Protein-A Production in Rat Granulosa Cells: Stimulation by Follicle-Stimulating Hormone and Inhibition by the Oocyte-Derived Bone Morphogenetic Protein-15
Endocrinology, August 1, 2004; 145(8): 3686 - 3695.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. J. Spicer
Proteolytic Degradation of Insulin-Like Growth Factor Binding Proteins by Ovarian Follicles: A Control Mechanism for Selection of Dominant Follicles
Biol Reprod, May 1, 2004; 70(5): 1223 - 1230.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/1/22    most recent
biolreprod.102.009191v2
biolreprod.102.009191v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.
Agricola
Right arrow Articles by Zhou, J.
Right arrow Articles by Bondy, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS