Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print April 2, 2003.
Biol Reprod 2003, 10.1095/biolreprod.102.011791
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/1/310    most recent
biolreprod.102.011791v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.
Agricola
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.
BIOLOGY OF REPRODUCTION 69, 310–321 (2003)
DOI: 10.1095/biolreprod.102.011791
© 2003 by the Society for the Study of Reproduction, Inc.


Testis

{gamma}-Tubulin Overexpression in Sertoli Cells In Vivo: I. Localization to Sites of Spermatid Head Attachment and Alterations in Sertoli Cell Microtubule Distribution1

Shawna L. Fleming3, Peter R. Shank4, and Kim Boekelheide2,3

Departments of Pathology and Laboratory Medicine3 Molelcular Microbiology and Immunology,4 Brown University, Providence, Rhode Island 02912


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sertoli cells play a number of roles in supporting spermatogenesis, including structural organization, physical and paracrine support of germ cells, and secretion of factors necessary for germ cell development. Studies with microtubule disrupting compounds indicate that intact microtubule networks are crucial for normal spermatogenesis. However, treatment with toxicants and pharmacologic agents that target microtubules lack cell-type selectivity and may therefore elicit direct effects on germ cells, which also require microtubule-mediated activities for division and morphological transformation. To evaluate the importance of Sertoli cell microtubule-based activities for spermatogenesis, an adenoviral vector that overexpresses the microtubule nucleating protein, {gamma}-tubulin, was used to selectively disrupt microtubule networks in Sertoli cells in vivo. {gamma}-Tubulin overexpression was observed to cause redistribution of Sertoli cell microtubule networks, and overexpression of a {gamma}-tubulin-enhanced green fluorescent protein fusion protein was observed to localize to the site of elongate spermatid head attachment to the seminiferous epithelium.

Sertoli cells, spermatogenesis, testis, toxicology


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mechanism of microtubule organization in Sertoli cells has not been established in vivo, although considerable effort has been expended in describing the polarity and dynamics of microtubule distribution throughout the cycle of the seminiferous epithelium [15]. Many of the functions attributed to Sertoli cells have microtubule-dependent components. Polarized secretion of metabolites and binding proteins toward the lumen of the seminiferous tubule, selective targeting of paracrine factors and adhesion molecules to associated germ cell subsets [610], structural support [3, 11, 12], and positioning of spermatids within the seminiferous epithelium [1, 1317], are all activities known to have microtubule dependence.

The role of Sertoli cell microtubules in supporting spermatogenesis has been largely deduced from outcomes of pharmacologic manipulations and toxicant exposures. Drugs, such as colchicine, Taxol, and nocodazole, which interfere with microtubule physiology, compromise the epithelial structural integrity and impair aspects of spermatogenesis, including spermatid positioning, residual body elimination, and seminiferous tubule fluid secretion [3, 11, 12, 18, 19]. Toxicants with demonstrated effects on microtubules, such as 2,5-hexanedione, also impair spermatogenesis, although the time course and trajectory of the injury process are more complicated [2026]. Because tubulin is a ubiquitous protein, toxicant and pharmacologic manipulations of microtubules performed in vivo suffer from a lack of cell type selectivity. It is likely that such treatments impair microtubule physiology of germ cells as well as somatic cells, which confounds mechanistic interpretation of target cell vulnerability. To evaluate germ cell dependence on aspects of Sertoli cell microtubule physiology, it is necessary to selectively deliver microtubule-disrupting agents to Sertoli cells without directly inducing alterations in germ cell microtubule functions.

When delivered to the lumen of the seminiferous epithelium, adenoviral vectors are capable of targeting transgene expression to Sertoli cells in vivo [2729]. Using this method, it is possible to alter expression of specific proteins within the context of an intact, adult testis.

Overexpression of {gamma}-tubulin in dividing cells leads to microtubule disruption and mitotic arrest [30, 31]. Overexpressed {gamma}-tubulin nucleates microtubules ectopically in the cytoplasm and impairs microtubule organization in the cell, similar to the effect of Taxol treatment [31]. In dividing cells, {gamma}-tubulin overexpression leads to mitotic arrest and cell death [30, 31]. However, the effects of {gamma}-tubulin overexpression have not been described in polarized cultures or in postmitotic, polarized epithelial cells in vivo.

As described in these companion articles, adenoviral vectors that overexpress {gamma}-tubulin were delivered to Sertoli cells in vivo to test the hypothesis that selective disruption of Sertoli cell microtubules would impair spermatogenesis. Toward that end, adenoviral vectors were designed to overexpress either enhanced green fluorescent protein (EGFP) and {gamma}-tubulin co-ordinately, under the control of a tetracycline-responsive promoter, or a fusion of EGFP to the C-terminus of {gamma}-tubulin. The first part of these companion articles documents the cell biologic outcomes of {gamma}-tubulin overexpression on the microtubule structure of the infected tissues and the behavior of the overexpressed protein in influencing the cytoskeleton. The second article describes the outcomes of those effects on the associated germ cells and describes the histopathology that resulted from the microtubule disruption.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
General

Young adult male Fischer rats, weighing 150–175 g were obtained from Charles River Laboratories (Wilmington, MA) and housed in hanging wire cages at a constant temperature (70° ± 2C), with 35%–70% humidity and a 12-h alternating light-dark schedule. All rats were acclimatized for at least 3 days prior to experimental manipulation and treated according to the NIH Guide for the Care and Use of Laboratory Animals.

All chemicals were purchased from Sigma Chemical Co. (St. Louis, MO) unless otherwise specified. Cell culture reagents, agarose, ethidium bromide, and polymerase chain reaction (PCR) primers were obtained from Invitrogen (Carlsbad, CA). SDS-PAGE reagents were obtained from BioRad (Hercules, CA) or Roche (acrylamide, Indianapolis, IN). Anti-{alpha}-tubulin monoclonal antibody (5A6) was a gift of Dr. David Brown (University of Ottawa, Ottawa, ON, Canada). The control viral vector, AdGFP, which expresses EGFP under the control of a cytomegalovirus (CMV) promoter, was purchased from QbioGene (Montreal, Canada). AdtTA was a gift of Drs. Thomas C. Harding and James Uney (University of Bristol, Bristol, UK).

Microscopy was performed using an Eclipse E800 microscope (Nikon Instruments, Melville, NY) equipped for epifluorescence. Digital photomicroscopy was performed using a SpotRT camera (Diagnostic Instruments, Sterling Heights, MI). Postacquisition image processing, where required, was performed using Photoshop (Adobe, San Jose, CA).

Cell Culture

TM4 cells were obtained from ATCC (Manassas, VA) and maintained as recommended by the supplier. Cells were cultured in Dulbeccco modified Eagle medium (DMEM) containing 2.5% fetal calf serum, 5% heat-inactivated horse serum, and 50 µg/ml gentamicin sulfate, and cultures were maintained at 37°C, 5% CO2.

HEK293A cells were obtained from QBioGene and maintained as recommended by the supplier. Cells were cultured in DMEM containing 10% fetal calf serum and 50 µg/ml gentamicin sulfate and maintained at 37°C, 5% CO2.

Production of Viral Vectors

Construction of replication-deficient viral vectors made use of a recently developed bacterial recombinational strategy [32]. Briefly, insertion of the transgene into the adenoviral backbone is mediated by homologous recombination between a shuttle plasmid, bearing transgenes and associated regulatory sequences, and the adenoviral genome plasmid, pAdEasy ({Delta}E1, {Delta}E3), a gift of Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD).

Tetracycline-responsive elements have been used widely in an effort to evaluate expression from plasmids or viral vectors in a controlled fashion [3341]. In the present study, the regulatable protein expression units were used to minimize effects of {gamma}-tubulin overexpression on viral packaging cells [36].

The tetracycline-responsive element is derived from the transcriptional regulatory element of Escherichia coli (TetO). Expression from the TetO utilizes a modified bacterial tet-repressor protein, tTA, which acts as a transactivator to stimulate expression from the promoter. In the absence of tetracycline, tTA drives expression of the transgene; however, binding of tetracycline to tTA inhibits promoter activity. HEK293A cells, which lack tTA, support reduced expression from the TetO at a level that is compatible with viral production [36]. High-level expression from tetracycline-responsive elements requires coexpression of a tetracycline-responsive element transactivator protein, tTA.

Production of AdBiEGFP{gamma}T Construct

The {gamma}-tubulin transgene, EGFP, and regulatory sequences were inserted into pShuttle (a gift of Dr. Bert Vogelstein, Johns Hopkins University, Baltimore MD), in a two-part subcloning procedure. The bidirectional tet-responsive promoter containing the EGFP marker and polyadenylation sequences was first subcloned into pShuttle by excising from the pBiEGFP plasmid (Clontech, Palo Alto, CA) using AatII and SapI (New England Biolabs, Beverly, MA), and fragments were blunt-end ligated into pShuttle. The full-length {gamma}-tubulin transgene was then PCR amplified from the pH3–16 plasmid [42] (a gift of Dr. Berl Oakley, Ohio State University, Columbus, OH), which contained the full-length {gamma}-tubulin insert. Primers, were designed with 5' terminal MluI sites to facilitate insertion into the shuttle plasmid construct, as follows: forward: 5'pGCGCAAGCACGCGTCGGCCACCATGCCGAGGGAAATCATCACCCTA3' and reverse: 5'pGCGCGCACGCGTGCTCACTGCTCCTGGGTGCCCC3'. The product was digested with MluI and ligated into the corresponding site in the pShuttle/BiEGFP plasmid (Fig. 1A).



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. Schematic presentation of {gamma}-tubulin-overexpressing adenoviral vectors. A) Structure of AdBiEGFP{gamma}T vector. This vector expresses {gamma}-tubulin and EGFP as separate transcripts, under the control of a single, bidirectional tetracycline-responsive element (TRE). The protein that drives expression from this regulatable promoter is the "tet-off" transactivator, tTA, which is delivered as a separate vector in coinfections between AdBiEGFP{gamma}T and AdtTA. Expression of tTA by AdtTA is driven by a CMV promoter [35, 37]. B) Structure of AdTet{gamma}TEGFP. This vector expresses {gamma}-tubulin fused at its C-terminus to EGFP ({gamma}TEGFP fusion protein) under the control of a unidirectional tetracycline-responsive element. As described above, expression from the promoter requires the concurrent expression of the tTA protein

Recombination between pAdEasy and the shuttle vector, containing the transgene of interest, was performed as described [32]. Plasmids obtained from minipreps were screened by size comparison with nonrecombinant pAdEasy plasmid in a 0.8% agarose gel, using ethidium bromide staining for visualization. Recombinants were digested with Mlu1 and restriction patterns were compared with nonrecombinant MluI-digested pAdEasy to verify insertion of the transgene.

Construction of the EGFP-{gamma}-Tubulin Fusion Vector, AdTet{gamma}TEGFP

To visualize {gamma}-tubulin localization in Sertoli cells in vivo, a C-terminal fusion of EGFP to {gamma}-tubulin was constructed. Production of the shuttle plasmid vector containing the tetracycline-regulatable EGFP-{gamma}-tubulin fusion protein ({gamma}TEGFP) was performed using a three-part subcloning process. Briefly, the full-length {gamma}-tubulin sequence [42] was subcloned into the pEGFP-N1 fusion vector (Clontech) by PCR amplification from the pH3–16 plasmid, using the following primer pair: forward: 5'GCGCGCAAGCTTCGCAACGCCGGTGCCTGAGGAGCGATGCC3'; reverse: 5'CGCGCGGTACCTTTGACTGCTCCTGGGTCGCCCCAGGAGATGTAGTCT3'. A mutation was introduced into the reverse primer to suppress the stop codon, and HindIII and KpnI restriction sites were introduced into the forward and reverse primers, respectively. The {gamma}-tubulin fusion product was excised from pEGFP-N1 using NotI and NheI and ligated into corresponding restriction sites in pTRE2 (Clontech) (Fig. 1B). The transgene, along with the tet-responsive element and SV40 polyadenylation sequence derived from pTRE2, were excised with XmnI and AseI. Blunt ends were generated using T4 DNA polymerase (New England Biolabs), and the fragment was ligated into the EcoRV site of the pShuttle plasmid. Plasmid DNA was screened for insertion of transgene coding sequence by size comparison with pAdEASY in a 0.8% TAE gel.

Transfection of HEK293A Cells for Viral Packaging and Propagation

HEK293A cells were transfected with Pac1-linearized recombinants for the purposes of viral production. DNA was digested with PacI enzyme (New England Biolabs), and 10 µg were electroporated into 3.6 x 106 cells in a 0.8-ml volume of DMEM, using a 0.4-cm gap cuvette, 0.260 kV, 0.65 kV/cm field strength, and 970 µF capacitance setting. Following electroporation, 0.7 ml of each cell suspension was plated in a 100-mm dish, and 0.1 ml was plated in one 35-mm well of a 6-well plate. Cells were supplemented with complete growth medium and incubated at 37°C 5% CO2 until plaque formation was observed.

Culture dishes were left undisturbed for the duration of the packaging period, and all observations were performed using the aliquots plated on 6-well plates. After 5 days, the 6-well plates were examined for the presence of plaques. No plaques were visible on the bottom of the wells; however, by epifluorescence, numerous patches of GFP-positive cells were observed. Plates were returned to the incubator for another 7 days, after which virus-containing cells were harvested from the 100-mm dishes by scraping. The contents of each 100-mm dish were placed into a 14-ml conical tube (Falcon, BD Biosciences, Bedford, MA) and subjected to three cycles of freeze thawing in a dry ice-methanol bath, with vigorous vortexing between freezing cycles.

Viral stocks were propagated by diluting 5 ml of the crude lysate with 5 ml PBS++ (PBS + 0.5 mM MgCl2 and 0.68 mM CaCl2) and overlaying 150-mm plates containing 80% confluent HEK293A cells. The inoculum was adsorbed for 1 h at 37°C, and then cells were supplemented with 20 ml complete growth medium. Cells were harvested by scraping when >80% were cytopathic, which typically occurred between 72 and 96 h post infection. The contents were placed into 50-ml conical tubes and frozen at -80°C until used for bulk propagation. Viral stock was purified and concentrated by CsCl centrifugation, and stocks were dialyzed against a solution containing 10 mM tris pH 8.0, 2 mM MgCl2, 5% sucrose. Dialyzed viral stock was then sterilized by passage through a 0.2-µm syringe filter and frozen at -80°C until used. Titer determination was made using standard methods [43].

Measuring {gamma}-Tubulin Fold-Induction in Cultures of TM4 Cells at 24 and 48 h Post Infection

Cultures of TM4 cells were plated at a density of 2.5 x 105 cells/well in 6-well plates and supplemented with 2 ml of complete TM4 growth medium. Cells were allowed to adhere overnight and then infected at multiplicities of infection (MOIs) of 10 and 100. After 24 or 48 hours post infection, the proportion of cells expressing the transgene was determined by epifluorescence, cells were lysed and {gamma}-tubulin levels assessed by Western blotting. Briefly, cells were washed once with PBS++ and overlaid with 0.5 ml PBS++ containing diluted viral stock or PBS++ alone (control). The following treatments were performed: PBS++ alone, AdtTA alone, and AdtTA + AdBiEGFP{gamma}T. All treatments were performed at MOIs of 10 and 100, and experiments were performed in triplicate. Cultures were returned to the incubator for 1 h and supplemented with 2 ml complete medium and returned to the incubator for either 24 or 48 h.

Lysates were prepared by overlaying monolayers with 1 ml lysis buffer (25 mM tris, pH 6.8, 0.5% SDS) containing protease inhibitors (complete EDTA-free protease inhibitor cocktail, Roche). Lysis was performed for 1 min at room temperature, and then lysates were collected, frozen in liquid nitrogen, and stored at -80°C.

Western Blotting and Densitometric Analysis

Protein concentration was measured using a modification of the Lowry method (DC protein assay, BioRad). Lysates were passed three times through a 26-gauge needle to reduce viscosity, and 20 µg of protein was mixed with 2 x sample buffer (4% SDS, 20% glycerol, 0.005% bromophenol blue, 10% ß-mercaptoethanol) and boiled for 5 min prior to loading. The proteins were separated by SDS-PAGE through a 6% stacking gel and 12% separating gel, as described [44]. Following electrophoresis, proteins were electrophoretically transferred to a polyvinylidine membrane (Immobilon P, Millipore, Bedford, MA) and processed for Western blotting.

Membranes were blocked in TBST (100 mM Tris-HCl pH 7.5, 0.9% NaCl, 0.1% Tween-20) containing 5% nonfat dry milk for 30 min at room temperature, with gentle agitation, and subsequently incubated with primary antibody diluted 1:2500 in blocking solution for 1 h, as described above. Washes were performed for 15 min, with several changes of TBST. Secondary antibody, horseradish peroxidase-conjugated goat-anti-mouse IgG (Amersham, Piscataway, NJ) was diluted 1:2500 in blocking solution and applied to membranes. Incubations and washes were performed as described. {gamma}-Tubulin immunoreactivity was evaluated using the ECL detection kit (Amersham).

Densitometry was performed using NIH Image (Scion Corp., Frederick, MD); optical density (OD) measurements taken from scanned autoradiographic film were calculated and mean values normalized to those obtained with PBS treatment. This was performed by dividing the mean OD values of the {gamma}-tubulin bands obtained in each of the overexpression regimens by the mean OD value obtained from cells treated with PBS++ alone. For infections with AdBiEGFP{gamma}T/AdtTA or AdTet{gamma}TEGFP/AdtTA, average OD values, which represent the sum of endogenous and overexpressed {gamma}-tubulin or overexpressed {gamma}-tubulin fusion protein, respectively, were adjusted to reflect the proportion of EGFP-positive cells observed at the time of cell lysis. Approximately 100 cells per infection regimen were counted and the proportion of GFP-positive cells determined by epifluorescence. All infections and counts were performed in triplicate. The fraction of GFP-positive cells was then used to estimate the fold-induction by dividing the mean OD ratio (mean OD obtained from infected cells/mean OD of PBS-treated cells) by the fraction infected.

Delivery of Adenoviral Vectors to the Seminiferous Epithelium in Vivo

Adenoviral vectors were delivered to the lumen of the seminiferous epithelium via retrograde perfusion of the rete testis [45]. Briefly, animals were anesthetized with 50 mg/kg sodium pentobarbital or a combination of 75 mg/kg ketamine and 13 mg/kg xylazine, and the testis was exposed via abdominal incision. A 30-gauge needle attached to a 1-ml syringe (BD Biosciences) into which a piece of 0.23-cm diameter Tygon tubing had been inserted (Norton Performance Plastics, Akron, OH) was carefully inserted, and the distribution of the perfusate was monitored by observing the flow pattern of the tracking dye. In successful injections, dye was observed to enter the ductuli efferentes and individual seminiferous tubules; otherwise it was noted to distribute in a diffuse pattern between seminiferous tubules, indicative of delivery to the interstitial spaces.

Between 50 and 100 µl of adenoviral stock, containing 1% blue food dye, was introduced into the testis at a rate of 25–50 µl/min, with the aid of an Eppendorf Femtojet microinjection pump (Eppendorf, Hamburg, Germany), set at 50 hPa. Equal volumes of AdtTA plus one of the following were injected into adult testes as described: AdGFP (expressing EGFP alone), AdBiEGFP{gamma}T (expressing EGFP and {gamma}-tubulin as separate transcripts), or AdTet{gamma}TEGFP (expressing the {gamma}-tubulin-EGFP fusion protein). The titers of AdGFP, AdBiEGFP{gamma}T, and AdTet{gamma}TEGFP were adjusted to 5 x 109 plaque-forming units (PFu)/ml, and that of AdtTA was 5 x 1010 PFU/ml, yielding a transactivator:target vector ratio of 10:1. Total titer delivered was between 1.4 x 109 and 2.75 x 109 PFU pertestis, comparable with titers reported previously [27, 28]. Control infections with AdGFP included AdtTA to normalize delivered titer and control for potential effects of AdtTA. Following perfusion, testes were returned to the scrotum, the abdominal incision was closed, and the animal was allowed to recover for 48 h post infection.

Histological Evaluation

GFP expression was weakly detectable by epifluorescent transillumination of unfixed tissue within 24 h post infection and maximal by 36–48 h post infection (data not shown). Because of the difficulty encountered in preserving GFP expression through histological procedures at the early time points when expression levels were low, evaluation was performed 48 h post infection when sufficient GFP preservation was possible to facilitate discrimination between infected and uninfected seminiferous tubules. Moreover, preliminary examination of the time course of injury following infection with {gamma}-tubulin overexpressing vectors indicated that the 36- to 48-h time point was optimal for obtaining mechanistic data about the injury process. By 48 h, appreciable histological alterations were observed; however, by 96 h, the histological architecture was severely disrupted in seminiferous tubules infected with AdBiEGFP{gamma}T/AdtTA or AdTet{gamma}TEGFP/AdtTA, and in many cases it was impossible to ascertain the stage of spermatogenesis of an infected cross-section. This gross disruption was not observed with control infections, however. For these reasons, the 48-h time point was selected for evaluation of histopathological changes and microtubule disruption.

Testes were fixed by puncturing the tunica albuginea with a 22-gauge needle and submerging in 10% neutral buffered formalin [46] for 24 h, after which they were transferred to PBS pH 7.4, containing 6.8% sucrose. Cross-sections (1 mm thick) were embedded in glycol methacrylate histological embedding resin (Technovit 8100, Heraeus Kulzer GmBH, Wehrheim, Germany), as described by the manufacturer. Serial sections (2 µm) were used for paired fluorescence and histological analysis. Sections prepared for light microscopic analysis were stained with periodic acid-Schiff/hematoxylin (PAS/H) and serial sections prepared for epifluorescent analysis were mounted in antifade (0.1% p-phenylenediamine, 10% PBS, 90% glycerol) to prevent quenching of the GFP signal.

Sections that were processed for tubulin immunofluorescence were first incubated in cold acetone (-20°C) for 5 min and washed for 10 min in several changes of PBS. Nonspecific binding was blocked by preincubation with PBS+ (PBS containing 0 .1% BSA and 5% normal goat serum) for 30 min at room temperature. Sections were incubated for 1 h with primary antibody (5A6) and diluted 1:2500 in PBS+. Slides were washed three times on a rocking platform at room temperature for 5 min each. Secondary antibody, Alexa594-conjugated goat-anti-mouse IgG (Molecular Probes, Eugene OR), was diluted 1:1000 and applied as described.

Histological evaluation was also performed in cryosectioned tissue. Tissues were fixed as described above, and 1-mm slices were incubated at 4°C for 48 h in PBS containing 50% sucrose. Tissues were then embedded in OCT (Miles, Inc., Indianapolis, IN) and frozen in liquid nitrogen. Sections (8 µm) were cut, mounted in antifade, and examined for the presence of GFP by epifluorescence.

To determine which stages are most susceptible to infection, 2 µm serially sectioned, glycol methacrylate-embedded tissues were examined by epifluorescence and light microscopy. GFP-positive seminiferous tubules were identified by epifluorescence, and the seminiferous tubule was staged by light-microscopic examination of the PAS/H-stained serial section. Three testes (n = 3 animals) per treatment were examined.

To determine whether infection altered timing of spermatogenesis, histological cross-sections from testes that were infected for 48 h were examined by bright-field microscopy, and seminiferous tubule cross-sections were assigned to one of four stage categories: I-III, IV-VI, VII-VIII, and IX-XIV. All seminiferous tubule cross-sections in each testis were scored, three testes (n = 3 animals) per treatment group were examined, and evaluations were performed on randomly coded slides.

Statistical Evaluation

Statistical analyses were performed using StatView software (Abacus Concepts, Berkeley, CA). Stage specificity of expression for the different infection regimens, and the comparison of stage distributions in testes infected with different viral constructs was analyzed by one-way ANOVA, followed by multiple pair-wise comparisons using the Fisher protected least significant difference test. For all analyses, the criterion for significance was P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Transgene Expression in Cultured Cells

Two adenoviral vectors that expressed {gamma}-tubulin were constructed: one that expressed {gamma}-tubulin and an EGFP reporter co-ordinately (AdBiEGFP{gamma}T) under the control of a bidirectional, tetracycline-responsive element and another that expressed EGFP fused at the C-terminus of {gamma}-tubulin (AdTet{gamma}TEGFP) under the control of a tetracycline-responsive element (Fig. 1). Infection of TM4 cells with AdTet{gamma}TEGFP/AdtTA (expressing the EGFP-{gamma}-tubulin fusion protein) or AdBiEGFP{gamma}T/AdtTA (expressing both EGFP and {gamma}-tubulin separately) yielded high-level expression in cultured TM4 cells (Fig. 2). The distribution of {gamma}-tubulin in these cells was predominately diffusely cytoplasmic; however, clusters of {gamma}-tubulin reactivity were noted in some cells (Fig. 2, C and D), consistent with the observation that {gamma}-tubulin can self-assemble into polymeric structures [31].



View larger version (94K):
[in this window]
[in a new window]
 
FIG. 2. {gamma}-Tubulin overexpression in cultured TM4 cells: A) In uninfected cells, {gamma}-tubulin localizes to the centrosomes (arrows) and is distributed throughout the cytoplasm. B) TM4 cell infected with AdBiEGFP{gamma}T+AdtTA. Infected cells stained with anti-{gamma}-tubulin antibody exhibit strong cytoplasmic {gamma}-tubulin staining (long arrow) relative to adjacent uninfected cells (short arrows). Shown is the red channel only, demonstrating {gamma}-tubulin signal. C) TM4 cells infected with AdBiEGFP{gamma}T+AdtTA. In cells overexpressing {gamma}-tubulin from the bidirectional, tetracycline-responsive vector, AdBiEGFP{gamma}T+AdtTA, overexpressed {gamma}-tubulin is observed to distribute cytoplasmically and in aggregates throughout the cytoplasm. Arrow denotes foci of overexpressed {gamma}-tubulin (red clusters). Both {gamma}-tubulin staining and EGFP signal are shown. D) TM4 cell infected with AdTet{gamma}TEGFP+AdtTA, an adenoviral vector that overexpresses a C-terminal fusion of EGFP to {gamma}-tubulin. Fusion proteins are observed to distribute cytoplasmically and form large foci in the cytoplasm (arrow).

To determine the level of {gamma}-tubulin induction in cells at different time points post infection, TM4 cells, infected with a range of MOIs, were lysed and Western blots for {gamma}-tubulin were performed. At 24 h post infection with AdtTA + AdBiEGFP{gamma}T, {gamma}-tubulin content was elevated 7- to 10-fold above baseline levels in cells infected at MOIs of 10 and 100. Experiments were performed in triplicate, and representative blots from 24- and 48-h time points are illustrated (Fig. 3, A and B). Densitometric analysis of blots revealed that viral infection did not itself affect the {gamma}-tubulin level of infected cells because cells infected with AdtTA alone did not exhibit alterations in {gamma}-tubulin levels. Coinfection with AdtTA and AdBiEGFP{gamma}T, however, greatly increased {gamma}-tubulin levels measured in cultures infected at MOIs of 10 and 100 (Fig. 3C).



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 3. {gamma}-Tubulin fold-induction in TM4 cells at 24 and 48 h post infection: {gamma}-tubulin overexpression observed in lysates of TM4 cells. A) Western blot of {gamma}-tubulin from lysates of cells infected at MOIs of 10 or 100 PFU/cell for 24 h with AdtTA, AdtTA/AdBiEGFP{gamma}T, or AdtTA/AdTet{gamma}TEGFP. B) Western blot of {gamma}-tubulin from lysates of cells infected at MOIs of 10 or 100 PFU/cell for 48 h with AdtTA, AdtTA/AdBiEGFP{gamma}T, or AdtTA/AdTet{gamma}TEGFP. Relative to treatment with PBS or infection with AdtTA, coinfection with AdtTA and AdBiEGFP{gamma}T or AdTet{gamma}TEGFP leads to increased, although variable {gamma}-tubulin expression. C) Densitometric analysis of blots (A and B) (n = 3 blots per treatment). Means and SEMs are plotted.

To evaluate the ability of {gamma}TEGFP to function similarly to endogenous {gamma}-tubulin, cultures of mitotic Sertoli cells (TM4 cells) were infected and tubulin patterns assessed. Similar to uninfected cells, cells infected with AdTet{gamma}TEGFP exhibited normal spindle formation, compared with uninfected TM4 cells (Fig. 4A). In addition, {gamma}TEGFP showed centrosomal incorporation, suggesting that {gamma}-tubulin does indeed substitute for endogenous {gamma}-tubulin in dividing cells (Fig. 4B). Many infected cells, however, did become multinucleate (Fig. 4C), suggesting that {gamma}-tubulin overexpression induces mitotic arrest, consistent with earlier reports [30, 31].



View larger version (133K):
[in this window]
[in a new window]
 
FIG. 4. {gamma}-Tubulin overexpression in dividing cells. A) Tubulin immunofluorescence pattern obtained from uninfected cultures of TM4 cells. Arrow denotes the structure of a mitotic spindle in an uninfected cell. B) {gamma}TEGFP incorporates into the centrosomes and results in formation of normal mitotic spindles. Yellow spots at the spindle poles (arrow) indicate the position of {gamma}TEGFP at the centrosomes. Additional, unincorporated transgene distributes diffusely in the cytoplasm. C) A binucleate cell expressing {gamma}TEGFP. {gamma}TEGFP expression is observed to impair completion of mitosis [30, 31].

Control Infection with AdGFP/AdtTA: Effects on Histological Architecture and Tubulin Distribution

In fixed, glycol methacrylate-embedded tissue, cross-sections of seminiferous tubules yielded a pattern of GFP localization typical of Sertoli cell infection. Bright, GFP-positive nuclei were observed near the base of seminiferous tubules, and GFP was noted to radiate toward the lumen, consistent with the known distribution of Sertoli cell cytoplasm (Fig. 5B'). Moreover, dark regions were observed in the length of the Sertoli cell cytoplasm in a pattern consistent with the expected positions of embedded germ cells (Fig. 5B').



View larger version (107K):
[in this window]
[in a new window]
 
FIG. 5. AdGFP expression is limited to Sertoli cells and does not affect the distribution of tubulin in Sertoli cells. Two seminiferous tubules at similar stages of spermatogenesis from the same testis (serial to those used for epifluorescence analysis) are examined by epifluorescence and light microscopy for GFP expression, tubulin distribution, and histological alterations. A and A') PAS/H-stained sections. A is uninfected; A' is infected with AdGFP. Despite strong GFP expression, A and A' have similar complements of germ cells, although some detached cells can be observed in the lumen of A'. B and B') Infected seminiferous tubules express GFP at a high level (B'). Arrow in B' indicates infected cell depicted in high magnification image in D'. C and C') Immunostaining for tubulin (red). The pattern of tubulin immunoreactivity is similar between infected (C') and uninfected (C) tissues. D and D') Immunostaining for tubulin (red). High-magnification images of the tubulin distribution in uninfected (D) and infected (D') Sertoli cells, demonstrating that the pattern of tubulin immunolocalization in infected Sertoli cells remains similar to uninfected cells. Tubulin is generally distributed along the long axis of the cell (arrows) but extends into regions adjacent to spermatid attachment (*)

Infection with control (AdGFP/AdtTA) was not observed to alter the distribution of tubulin in infected cells. Similarly staged uninfected and control-infected tubules are shown in Figures 5, A and A'. During this stage of spermatogenesis, tubulin distribution in infected Sertoli cells occurred along the trunk and radiated into cytoplasmic extensions surrounding germ cells, similar to uninfected cells (Fig. 5, C, C', D, and D') [2, 5].

Infection with AdBiEGFP{gamma}T: Effects on Histological Organization and Tubulin Distribution

In contrast to control infections, overexpression of {gamma}-tubulin dramatically altered the organization of the Sertoli cell microtubule cytoskeleton. Figure 6, A and A', illustrates two seminiferous tubules at similar stages of spermatogenesis from the same testis. One tubule was uninfected (A) and the other was infected with AdBiEGFP{gamma}T (A'). Strong transgene expression was observed with this vector (Fig. 6, B vs. B'). By immunofluorescence, it appeared that {gamma}-tubulin expression altered the distribution of tubulin in infected cells. Figure 6, C and C' illustrates the effect of infection with AdtTA and AdBiEGFP{gamma}T on the histology and tubulin distribution in two seminiferous tubules at similar stages of spermatogenesis in the same testis. Expression of {gamma}-tubulin shifted the position of microtubules toward the luminal surface. Whereas most tubulin staining in the uninfected seminiferous tubule localized basally and along the trunk of the cell in the uninfected seminiferous tubule, the staining in the infected seminiferous tubule was localized throughout the seminiferous epithelium and was particularly abundant in the luminal region of the seminiferous epithelium (Fig. 6, C vs. C' and D').



View larger version (94K):
[in this window]
[in a new window]
 
FIG. 6. AdBiEGFP{gamma}T/AdtTA infection in Sertoli cells is disruptive and alters the distribution of tubulin in infected seminiferous tubules. Two seminiferous tubules at similar stages of spermatogenesis from the same testis are examined by epifluorescence and light microscopy for GFP expression, tubulin distribution, and histological alterations. A and A') PAS/H-stained sections (serial to those used to perform epifluorescence analysis) demonstrating histological profiles of tissue. Seminiferous tubules infected with AdBiEGFP{gamma}T/AdtTA (A') exhibit a disordered histological pattern, compared with uninfected seminiferous tubules (A). Step 19 spermatids (thin arrows) and residual bodies (arrowheads) are observed throughout the epithelium, coinciding with elongating step 9 spermatids (thick arrows). * denotes patches of missing germ cells. B and B') Infection with AdBiEGFP{gamma}T/AdtTA results in strong GFP expression throughout the seminiferous tubule. C and C') The pattern of tubulin staining is altered in infected seminiferous tubules (C'), compared with uninfected (C) seminiferous tubules. At this stage of spermatogenesis, tubulin is observed basally and in thin projections along the trunk of the cell in uninfected seminiferous tubules (C). Tubulin staining in infected cells, however, is shifted toward the lumen (arrowheads, C'; arrowheads in C' correspond with the arrowheads in B', that identify the GFP positivity). D') Tubulin staining is more fragmentary and observed to surround germ cell crypts in infected tissue. There are numerous heads remaining in the seminiferous epithelium in infected seminiferous tubules (arrowheads). * denotes positions of infected Sertoli cells

Infection with AdTet{gamma}TEGFP: Effects on Histological Architecture and Tubulin Distribution

To visualize coassociation of overexpressed {gamma}-tubulin with the tubulin immunostaining pattern, seminiferous tubules were infected with an adenovirus that expressed {gamma}-tubulin fused to EGFP. Infection with AdTet{gamma}TEGFP elicited similar histological and cytoskeletal alterations to that of AdBiEGFP{gamma}T. Figure 7, A and A' illustrates two seminiferous tubules at similar stages of spermatogenesis from the same testis, one that was uninfected (Fig. 7A) and one that was infected with AdBiEGFP{gamma}T (Fig. 7A'). Although similar, the nuclear architecture of the elongating spermatids suggests that the infected seminiferous tubule was at a slightly later stage of spermiogenesis. Tubulin immunolocalization at this stage was grossly disorganized, compared with uninfected seminiferous tubules. The majority of tubulin immunostaining occurred along the trunk of the Sertoli cell and at the luminal surface, coincident with the points of step 19 spermatid attachment (Fig. 7C). In the infected seminiferous tubule, tubulin distribution in the trunk of the Sertoli cell was diminished and was intensely redistributed along the length of step 19 spermatid heads (Fig. 7, C' and D'). This pattern coincided with the localization of the {gamma}TEGFP in infected Sertoli cells (Fig. 7B').



View larger version (102K):
[in this window]
[in a new window]
 
FIG. 7. AdTet{gamma}TEGFP/AdtTA infection in Sertoli cells disrupts histology and alters the distribution of tubulin in infected seminiferous tubules. Two seminiferous tubules at similar stages of spermatogenesis from the same testis are examined by light microscopy and epifluorescence for histological alterations, GFP distribution, and tubulin immunoreactivity. A and A') PAS/H-stained sections (serial to those used for epifluorescence) demonstrating histological profiles of tissue. Compared with uninfected seminiferous tubules (A), seminiferous tubules infected with AdTet{gamma}TEGFP/AdtTA (A') exhibit severe histological disruption, similar to that caused by infection with AdBiEGFP{gamma}T (Fig. 6A'). Spermatids (arrows) and residual bodies (arrowheads) are retained throughout the seminiferous epithelium, despite presence of elongating step 9 spermatids (thick arrows). Patches of missing germ cells are evident (*). B and B') An uninfected seminiferous tubule is illustrated (B). Infected seminiferous tubules are observed to express {gamma}TEGFP at high levels (B'). The distribution of transgene is both diffusely cytoplasmic and focal (arrows). C and C') The pattern of tubulin immunoreactivity is altered, compared with uninfected seminiferous tubules (C' vs. C, respectively). Tubulin staining (red) is more irregular and accumulates at sites of transgene localization (arrows in B' and C') . In infected seminiferous tubules, tubulin is distributed in thin, linear patterns throughout the cells and in areas of {gamma}TEGFP expression. D') High-magnification view of altered tubulin immunoreactivity in infected seminiferous tubules illustrated in C'. Tubulin is strongly associated with late spermatids (arrows)

In AdTet{gamma}TEGFP/AdtTA-infected tissue, {gamma}TEGFP localization occurred throughout the cell in both diffusely cytoplasmic and focal patterns. Foci of {gamma}TEGFP localized to areas surrounding spermatid heads in stages that contain highly condensed elongates. Figure 8 illustrates the pattern observed in {gamma}TEGFP localization within the seminiferous epithelium. These areas often also contained abnormally shaped spermatids (Fig. 8), which were also associated with foci of {gamma}TEGFP.



View larger version (136K):
[in this window]
[in a new window]
 
FIG. 8. Localization of {gamma}TEGFP fusion protein with retained and malformed spermatids. Cryosectioned tissue, demonstrating localization of {gamma}TEGFP foci with heads of retained spermatids (arrows) and malformed spermatids (*)

Stage Specificity of Expression in Vivo

The stage specificity of infection observed in this study was different from that previously reported [27, 28]. The stage distribution of infected seminiferous tubules was broad and variable, but the majority of infected seminiferous tubules was observed to be between stages VII and XIV. Figure 9 describes the stage distribution of GFP-positive tubule cross-sections for the three infection regimens. There were no significant differences among the three treatments in the stages most prone to infection. At 48 h, more than 80% of infected seminiferous tubules were between stages VII and XIV, suggesting that they became infected between stages V and XII. Moreover, there were differences in the level of {gamma}-tubulin expression observed in seminiferous tubules of different stages. The highest levels of {gamma}-tubulin expression (as evidenced by levels of EGFP expression) were noted in stages IX–XIV, and the lowest levels were observed between stages I–III (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 9. Stage distribution of infection in testes exposed to AdGFP, AdTet{gamma}TEGFP, or AdBiEGFP{gamma}T. All seminiferous tubule stages were found to be infected at 48 h post infection; however, the majority of infected seminiferous tubules were observed to be between stages VII and XIV

To determine whether there was a block to spermatogenic progression brought about by {gamma}-tubulin overexpression, manifested as deficits and/or overrepresentation in sequential stages, seminiferous tubules in cross-sections of testes taken from the three different treatment groups were staged. These values were then compared with those from uninfected testes. No differences in the distribution of stages were observed between uninfected and any of the infected tissues (Figure 10).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 10. Distribution of stages in uninfected testes or testes infected with AdGFP, AdTet{gamma}TEGFP, or AdBiEGFP{gamma}T. Infection does not change the distribution of spermatogenic stages in testes, indicating that the rate of spermatogenic differentiation is not impaired by viral infection or by overexpression of {gamma}-tubulin


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
{gamma}-Tubulin is the protein primarily responsible for nucleating microtubules in eukaryotic cells. In dividing cells, {gamma}-tubulin is distributed in the cytoplasm and pericentrosomal matrix [4749]. Soluble {gamma}-tubulin-containing complexes aggregate into ring structures that accumulate at the centrosomes as the cell enters mitosis and nucleate microtubules that form mitotic spindles [5052].

The factors that determine the spatial distribution of microtubules in polarized cells have not been well established. Unlike most cultured cell models, polarized epithelial cells have microtubule-organizing centers oriented at the apex of the cell, away from the basally positioned nucleus. Moreover, the microtubule-organizing center is more loosely distributed and not associated with any particular organelle [1, 7, 8, 5358].

The involvement of the centrosome in nucleating microtubules at the apical surface varies among the different models studied [4, 55]. In Sertoli cells, however, microtubule regrowth does not occur from the basally positioned centrosome. Following nocodazole treatment, bundles of microtubules re-emerge from the apical surface and are distributed longitudinally in the cell, with their plus-ends pointed toward the nucleus; however, no microtubules are observed to arise from the perinuclear centrosome [4]. Considerable effort has been made toward determining the organization of the microtubule cytoskeleton in Sertoli cells in vivo; however, the composition and precise location of nucleating complexes have not been established. Although the role of {gamma}-tubulin in patterning microtubule distribution in Sertoli cells has not been defined, its role in many other polarized cell types in vitro and in vivo has been established. For that reason, it was of interest to determine the effect of {gamma}-tubulin overexpression on the organization of the microtubule cytoskeleton of Sertoli cells in vivo and determine the effects of microtubule disruption in Sertoli cells on spermatogenesis.

The viral constructs utilized in this study expressed the EGFP reporter gene either co-ordinately with {gamma}-tubulin, or as a fusion to the C-terminus of {gamma}-tubulin. Expression from tetracycline-responsive, bidirectional promoters has been demonstrated to result in efficient expression of both transgenes in vitro [39, 59]. Indeed, high-level expression of both {gamma}-tubulin and EGFP were observed in cultured TM4 cells. Moreover, coadministration of adenoviral vectors that express tTA (a "tet-off" transactivator protein required for expression from tet-responsive elements), with vectors that express the transgene of interest, has been demonstrated to result in efficient expression of transgenes in vivo [35, 37, 41].

Expression of EGFP fused to the C-terminus of {gamma}-tubulin has been previously used to study various functions of the centrosome in dividing cells [60, 61] and has been observed to behave similarly to endogenous {gamma}-tubulin. Other {gamma}-tubulin fusion proteins, including C-terminal fusion of c-myc with {gamma}-tubulin, have also been observed to result in efficient incorporation into centrosomes, consistent with the role of {gamma}-tubulin in dividing cells and suggesting that the fusion construct behave analogously to endogenous {gamma}-tubulin [31, 62].

In this study, the human {gamma}-tubulin cDNA sequence was used to perturb the rat Sertoli cell cytoskeleton. Human {gamma}-tubulin has been demonstrated to function normally in a wide array of cell types, ranging from hamster to yeast [31, 63]. The {gamma}-tubulin fusion product used in this study was observed to behave in a manner consistent with previous reports, suggesting that the overexpressed {gamma}-tubulin functions similarly to endogenous {gamma}-tubulin in Sertoli cells in vivo [60]. Indeed, that the {gamma}TEGFP fusion protein incorporates normally into spindles of mouse TM4 cells supports the notion that the protein functions as anticipated.

The levels of {gamma}-tubulin observed in cultures of TM4 cells are relatively modest, compared with those observed in previous studies aimed at understanding the effects of {gamma}-tubulin overexpression. Overexpression in yeast was observed to be lethal at 160-fold of endogenous levels and well-tolerated at levels of 50-fold above endogenous, and the mechanism of injury was observed to be via mitotic arrest [30]. Presumably this pathway of injury would not occur in Sertoli cells, which are postmitotic in adult animals.

These measurements, although important indices of promoter activity, are unlikely to be predictive of expression levels in individual cells in vivo. Perfusion of the rete testis leads to high-level exposure of Sertoli cells in the immediate vicinity of the incoming fluid, but titers would be expected to decline as fluid flows downstream of the initial site of exposure and viral particles are taken up by cells. Thus, the level of exposure likely occurs along a gradient distributed spatially over the length of the perfused seminiferous tubule segment. Moreover, because expression is a function of the number of copies of viral DNA present in infected cells, intracellular expression levels are expected to exhibit great variability between seminiferous tubule cross-sections in a single testis.

The localization of {gamma}TEGFP to spermatid heads suggests that spermatid heads may serve as points of {gamma}-tubulin aggregation in the seminiferous epithelium in general. No data about the distribution of {gamma}-tubulin, or its likely role in nucleating microtubules in Sertoli cells have been presented in the literature to date. The low abundance of endogenous {gamma}-tubulin in most cells and the complexity of the seminiferous epithelial architecture make such evaluations extremely difficult. Numerous attempts were made during the course of these experiments to localize endogenous {gamma}-tubulin in vivo, using different reagents and conditions, and no unambiguous pattern was obtained.

Although it is unwise to model the behavior of endogenous proteins solely on information gleaned from models of overexpressed proteins, such data may provide clues to the role of proteins for which information about their endogenous roles is scant. That {gamma}-tubulin may have a role in the establishment of the cytoskeletal connection between the ectoplasmic specialization and the Sertoli cell microtubule network merits further investigation.


    ACKNOWLEDGMENTS
 
The authors wish to thank the laboratory of Dr. Bert Vogelstein, Johns Hopkins University, for the gift of the pShuttle and pAdEasy plasmids and the BJ5183 strain of E. coli; Dr. Berl Oakley, Ohio State University, for the gift of the pH3–16 plasmid containing the {gamma}-tubulin transgene; Dr. David Brown, University of Ottawa, for the gift of the monoclonal antitubulin antibody, 5A6; Drs. Thomas Harding and James Uney, University of Bristol, Bristol, UK, for the gift of the AdtTA viral stock; and Dr. Daniel Johnson for his expert advice in the development of the viral delivery system. Thanks are also due to Susan Hall for her assistance with histology and in devising the injection apparatus.


    FOOTNOTES
 
1 This work was funded in part by RO1ES08956 from the National Institutes of Environmental Health Sciences. Back

2 Correspondence. Kim Boekelheide, Department of Pathology and Laboratory Medicine, Brown University, Providence, Rhode Island 02912. FAX: 401 863 9008; Kim_Boekelheide{at}Brown.edu Back

Received: 26 September 2002.

First decision: 13 November 2002.

Accepted: 3 March 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Redenbach DM, Vogl AW. Microtubule polarity in Sertoli cells: a model for microtubule-based spermatid transport. Eur J Cell Biol 1991 54:277-290[Medline]
  2. Vogl AW. Changes in the distribution of microtubules in rat Sertoli cells during spermatogenesis. Anat Rec 1988 222:34-41[CrossRef][Medline]
  3. Vogl AW, Linck RW, Dym M. Colchicine-induced changes in the cytoskeleton of the golden-mantled ground squirrel (Spermophilus lateralis) Sertoli cells. Am J Anat 1983 168:99-108[CrossRef][Medline]
  4. Vogl AW, Weis M, Pfeiffer DC. The perinuclear centriole-containing centrosome is not the major microtubule organizing center in Sertoli cells. Eur J Cell Biol 1995 66:165-179[Medline]
  5. Wenz JR, Hess RA. Characterization of stage-specific tyrosinated alpha-tubulin immunoperoxidase staining patterns in Sertoli cells of rat seminiferous tubules by light microscopic image analysis. Tissue Cell 1998 30:492-501[CrossRef][Medline]
  6. Achler C, Filmer D, Merte C, Drenckhahn D. Role of microtubules in polarized delivery of apical membrane proteins to the brush border of the intestinal epithelium. J Cell Biol 1989 109:179-189[Abstract/Free Full Text]
  7. De Almeida JB, Stow JL. Disruption of microtubules alters polarity of basement membrane proteoglycan secretion in epithelial cells. Am J Physiol 1991 261:C691-C700
  8. Grindstaff KK, Bacallao RL, Nelson WJ. Apiconuclear organization of microtubules does not specify protein delivery from the trans-Golgi network to different membrane domains in polarized epithelial cells. Mol Biol Cell 1998 9:685-699[Abstract/Free Full Text]
  9. Rindler MJ, Ivanov IE, Sabatini DD. Microtubule-acting drugs lead to the nonpolarized delivery of the influenza hemagglutinin to the cell surface of polarized Madin-Darby canine kidney cells. J Cell Biol 1987 104:231-241[Abstract/Free Full Text]
  10. Johnson KJ, Patel SR, Boekelheide K. Multiple cadherin superfamily members with unique expression profiles are produced in rat testis. Endocrinology 2000 141:675-683[Abstract/Free Full Text]
  11. Allard EK, Johnson KJ, Boekelheide K. Colchicine disrupts the cytoskeleton of rat testis seminiferous epithelium in a stage-dependent manner. Biol Reprod 1993 48:143-153[Abstract]
  12. Russell LD, Malone JP, MacCurdy DS. Effect of the microtubule disrupting agents, colchicine and vinblastine, on seminiferous tubule structure in the rat. Tissue Cell 1981 13:349-367[CrossRef][Medline]
  13. Beach SF, Vogl AW. Spermatid translocation in the rat seminiferous epithelium: coupling membrane trafficking machinery to a junction plaque. Biol Reprod 1999 60:1036-1046[Abstract/Free Full Text]
  14. Guttman JA, Kimel GH, Vogl AW. Dynein and plus-end microtubule-dependent motors are associated with specialized Sertoli cell junction plaques (ectoplasmic specializations). J Cell Sci 2000 113:Pt 122167-2176[Abstract]
  15. Redenbach DM, Boekelheide K, Vogl AW. Binding between mammalian spermatid-ectoplasmic specialization complexes and microtubules. Eur J Cell Biol 1992 59:433-448[Medline]
  16. Russell L. Observations on rat Sertoli ectoplasmic (‘junctional’) specializations in their association with germ cells of the rat testis. Tissue Cell 1977 9:475-498[CrossRef][Medline]
  17. Vogl AW, Pfeiffer DC, Mulholland D, Kimel G, Guttman J. Unique and multifunctional adhesion junctions in the testis: ectoplasmic specializations. Arch Histol Cytol 2000 63:1-15[CrossRef][Medline]
  18. Richburg JH, Redenbach DM, Boekelheide K. Seminiferous tubule fluid secretion is a Sertoli cell microtubule-dependent process inhibited by 2,5-hexanedione exposure. Toxicol Appl Pharmacol 1994 128:302-309[CrossRef][Medline]
  19. Russell LD, Saxena NK, Turner TT. Cytoskeletal involvement in spermiation and sperm transport. Tissue Cell 1989 21:361-379[CrossRef][Medline]
  20. Boekelheide K. 2,5-Hexanedione alters microtubule assembly. II. Enhanced polymerization of crosslinked tubulin. Toxicol Appl Pharmacol 1987 88:383-396[CrossRef][Medline]
  21. Boekelheide K. 2,5-Hexanedione alters microtubule assembly. I. Testicular atrophy, not nervous system toxicity, correlates with enhanced tubulin polymerization. Toxicol Appl Pharmacol 1987 88:370-382[CrossRef][Medline]
  22. Boekelheide K. Rat testis during 2,5-hexanedione intoxication and recovery. I. Dose response and the reversibility of germ cell loss. Toxicol Appl Pharmacol 1988 92:18-27[CrossRef][Medline]
  23. Boekelheide K, Eveleth J. The rate of 2,5-hexanedione intoxication, not total dose, determines the extent of testicular injury and altered microtubule assembly in the rat. Toxicol Appl Pharmacol 1988 94:76-83[CrossRef][Medline]
  24. Boekelheide K, Hall SJ. 2,5-Hexanedione exposure in the rat results in long-term testicular atrophy despite the presence of residual spermatogonia. J Androl 1991 12:18-26[Abstract/Free Full Text]
  25. Hall ES, Hall SJ, Boekelheide K. 2,5-Hexanedione exposure alters microtubule motor distribution in adult rat testis. Fundam Appl Toxicol 1995 24:173-182[CrossRef][Medline]
  26. Redenbach DM, Richburg JH, Boekelheide K. Microtubules with altered assembly kinetics have a decreased rate of kinesin-based transport. Cell Motil Cytoskeleton 1994 27:79-87[CrossRef][Medline]
  27. Blanchard KT, Boekelheide K. Adenovirus-mediated gene transfer to rat testis in vivo. Biol Reprod 1997 56:495-500[Abstract]
  28. Scobey M, Bertera S, Somers J, Watkins S, Zeleznik A, Walker W. Delivery of a cyclic adenosine 3',5'-monophosphate response element-binding protein (creb) mutant to seminiferous tubules results in impaired spermatogenesis. Endocrinology 2001 142:948-954[Abstract/Free Full Text]
  29. Kanatsu-Shinohara M, Ogura A, Ikegawa M, Inoue K, Ogonuki N, Tashiro K, Toyokuni S, Honjo T, Shinohara T. Adenovirus-mediated gene delivery and in vitro microinsemination produce offspring from infertile male mice. Proc Natl Acad Sci U S A 2002 99:1383-1388[Abstract/Free Full Text]
  30. Horio T, Basaki A, Takeoka A, Yamato M. Lethal level overexpression of gamma-tubulin in fission yeast causes mitotic arrest. Cell Motil Cytoskeleton 1999 44:284-295[CrossRef][Medline]
  31. Shu HB, Joshi HC. Gamma-tubulin can both nucleate microtubule assembly and self-assemble into novel tubular structures in mammalian cells. J Cell Biol 1995 130:1137-1147[Abstract/Free Full Text]
  32. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998 95:2509-2514[Abstract/Free Full Text]
  33. Howe JR, Skryabin BV, Belcher SM, Zerillo CA, Schmauss C. The responsiveness of a tetracycline-sensitive expression system differs in different cell lines. J Biol Chem 1995 270:14168-14174[Abstract/Free Full Text]
  34. Hoffmann A, Villalba M, Journot L, Spengler D. A novel tetracycline-dependent expression vector with low basal expression and potent regulatory properties in various mammalian cell lines. Nucleic Acids Res 1997 25:1078-1079[Abstract/Free Full Text]
  35. Harding TC, Geddes BJ, Noel JD, Murphy D, Uney JB. Tetracycline-regulated transgene expression in hippocampal neurones following transfection with adenoviral vectors. J Neurochem 1997 69:2620-2623[Medline]
  36. Massie B, Couture F, Lamoureux L, Mosser DD, Guilbault C, Jolicoeur P, Belanger F, Langelier Y. Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. J Virol 1998 72:2289-2296[Abstract/Free Full Text]
  37. Harding TC, Geddes BJ, Murphy D, Knight D, Uney JB. Switching transgene expression in the brain using an adenoviral tetracycline-regulatable system. Nat Biotechnol 1998 16:553-555[CrossRef][Medline]
  38. Molin M, Shoshan MC, Ohman-Forslund K, Linder S, Akusjarvi G. Two novel adenovirus vector systems permitting regulated protein expression in gene transfer experiments. J Virol 1998 72:8358-8361[Abstract/Free Full Text]
  39. Strathdee CA, McLeod MR, Hall JR. Efficient control of tetracycline-responsive gene expression from an autoregulated bi-directional expression vector. Gene 1999 229:21-29[CrossRef][Medline]
  40. Forster K, Helbl V, Lederer T, Urlinger S, Wittenburg N, Hillen W. Tetracycline-inducible expression systems with reduced basal activity in mammalian cells. Nucleic Acids Res 1999 27:708-710[Abstract/Free Full Text]
  41. Ralph GS, Bienemann A, Harding TC, Hopton M, Henley J, Uney JB. Targeting of tetracycline-regulatable transgene expression specifically to neuronal and glial cell populations using adenoviral vectors. Neuroreport 2000 11:2051-2055[Medline]
  42. Zheng Y, Jung MK, Oakley BR. Gamma-tubulin is present in Drosophila melanogaster and Homo sapiens and is associated with the centrosome. Cell 1991 65:817-823[CrossRef][Medline]
  43. Graham FL, Prevec L. Methods for construction of adenovirus vectors. Mol Biotechnol 1995 3:207-220[Medline]
  44. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970 227:680-685[CrossRef][Medline]
  45. Morales C, Hermo L, Clermont Y. Endocytosis in epithelial cells lining the rete testis of the rat. Anat Rec 1984 209:185-195[CrossRef][Medline]
  46. Chapin RE, Ross MD, Lamb JC. Immersion fixation methods for glycol methacrylate-embedded testes. Toxicol Pathol 1984 12:221-227[Medline]
  47. Dictenberg JB, Zimmerman W, Sparks CA, Young A, Vidair C, Zheng Y, Carrington W, Fay FS, Doxsey SJ. Pericentrin and gamma-tubulin form a protein complex and are organized into a novel lattice at the centrosome. J Cell Biol 1998 141:163-174[Abstract/Free Full Text]
  48. Young A, Dictenberg JB, Purohit A, Tuft R, Doxsey SJ. Cytoplasmic dynein-mediated assembly of pericentrin and gamma tubulin onto centrosomes. Mol Biol Cell 2000 11:2047-2056[Abstract/Free Full Text]
  49. Do Carmo Avides M, Tavares A, Glover DM. Polo kinase and Asp are needed to promote the mitotic organizing activity of centrosomes. Nat Cell Biol 2001 3:421-424[CrossRef][Medline]
  50. Moritz M, Zheng Y, Alberts BM, Oegema K. Recruitment of the gamma-tubulin ring complex to Drosophila salt-stripped centrosome scaffolds. J Cell Biol 1998 142:775-786[Abstract/Free Full Text]
  51. Oegema K, Wiese C, Martin OC, Milligan RA, Iwamatsu A, Mitchison TJ, Zheng Y. Characterization of two related Drosophila gamma-tubulin complexes that differ in their ability to nucleate microtubules. J Cell Biol 1999 144:721-733[Abstract/Free Full Text]
  52. Moritz M, Braunfeld MB, Sedat JW, Alberts B, Agard DA. Microtubule nucleation by gamma-tubulin-containing rings in the centrosome. Nature 1995 378:638-640[CrossRef][Medline]
  53. Bacallao R, Antony C, Dotti C, Karsenti E, Stelzer EH, Simons K. The subcellular organization of Madin-Darby canine kidney cells during the formation of a polarized epithelium. J Cell Biol 1989 109:2817-2832[Abstract/Free Full Text]
  54. Buendia B, Bre MH, Griffiths G, Karsenti E. Cytoskeletal control of centrioles movement during the establishment of polarity in Madin-Darby canine kidney cells. J Cell Biol 1990 110:1123-1135[Abstract/Free Full Text]
  55. Meads T, Schroer TA. Polarity and nucleation of microtubules in polarized epithelial cells. Cell Motil Cytoskeleton 1995 32:273-288[CrossRef][Medline]
  56. Redenbach DM, Boekelheide K. Microtubules are oriented with their minus-ends directed apically before tight junction formation in rat Sertoli cells. Eur J Cell Biol 1994 65:246-257[Medline]
  57. Redenbach DM, Hall ES, Boekelheide K. Distribution of Sertoli cell microtubules, microtubule-dependent motors, and the Golgi apparatus before and after tight junction formation in developing rat testis. Microsc Res Tech 1995 32:504-519[CrossRef][Medline]
  58. Salas PJ. Insoluble gamma-tubulin-containing structures are anchored to the apical network of intermediate filaments in polarized CACO-2 epithelial cells. J Cell Biol 1999 146:645-658[Abstract/Free Full Text]
  59. Baron U, Freundlieb S, Gossen M, Bujard H. Co-regulation of two gene activities by tetracycline via a bidirectional promoter. Nucleic Acids Res 1995 23:3605-3606[Free Full Text]
  60. Khodjakov A, Rieder CL. The sudden recruitment of gamma-tubulin to the centrosome at the onset of mitosis and its dynamic exchange throughout the cell cycle, do not require microtubules. J Cell Biol 1999 146:585-596[Abstract/Free Full Text]
  61. Khodjakov A, Rieder CL. Centrosomes enhance the fidelity of cytokinesis in vertebrates and are required for cell cycle progression. J Cell Biol 2001 153:237-242[Abstract/Free Full Text]
  62. Leask A, Stearns T. Expression of amino- and carboxyl-terminal gamma- and alpha-tubulin mutants in cultured epithelial cells. J Biol Chem 1998 273:2661-2668[Abstract/Free Full Text]
  63. Horio T, Oakley BR. Human gamma-tubulin functions in fission yeast. J Cell Biol 1994 126:1465-1473[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
R P Hooley, M Paterson, P Brown, K Kerr, and P T K Saunders
Intra-testicular injection of adenoviral constructs results in Sertoli cell-specific gene expression and disruption of the seminiferous epithelium
Reproduction, February 1, 2009; 137(2): 361 - 370.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
R. J. Markelewicz Jr., S. J. Hall, and K. Boekelheide
2,5-Hexanedione and Carbendazim Coexposure Synergistically Disrupts Rat Spermatogenesis Despite Opposing Molecular Effects on Microtubules
Toxicol. Sci., July 1, 2004; 80(1): 92 - 100.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
N. P.Y. Lee and C. Y. Cheng
Ectoplasmic specialization, a testis-specific cell-cell actin-based adherens junction type: is this a potential target for male contraceptive development?
Hum. Reprod. Update, July 1, 2004; 10(4): 349 - 369.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/1/310    most recent
biolreprod.102.011791v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.
Agricola
Right arrow Articles by Fleming, S. L.
Right arrow Articles by Boekelheide, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS