|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Toxicology |
Department of Anatomy and Cell Biology,3 Faculty of Medicine, Martin Luther University Halle/Wittenberg, D-06097 Halle (Saale), Germany
Department of Anatomy of Domestic Animals,4 Faculty of Veterinary Medicine, University of Milan, I-20134 Milan, Italy
| ABSTRACT |
|---|
|
|
|---|
and ß (ER
and ERß) and progesterone receptor (PR) mRNA levels. Cumulus-oocyte complexes (COCs) were exposed during in vitro maturation to serial concentrations of OP (10.0001 µg/ml) and were compared with vehicle-treated controls and a group of COCs treated with 17ß-estradiol (E2). A dose-related decrease in the percentage of oocytes that completed maturation after 24 h and in oocyte fertilization competence was observed at doses of OP as low as 0.01 µg/ml. Groups treated with
0.001 µg/ml OP showed impaired embryo development. No adverse effects of E2 were observed. In the E2-treated COCs, ER
mRNA was decreased but PR mRNA was upregulated compared with controls. Treatment with 0.001 and 0.0001 µg/ml OP induced a decrease in ER
mRNA, but ERß and PR mRNA were not affected. Treatment with 0.01 µg/ml OP did not produce changes in the expression of any of the mRNAs studied. OP impairs meiotic progression and developmental competence of bovine oocytes without demonstrating clear estrogen-mimic activity.
embryo, environment, estradiol receptor, in vitro fertilization, meiosis
| INTRODUCTION |
|---|
|
|
|---|
A variety of man-made chemicals released into the environment that exhibit endocrinelike activity, e.g., organochlorine pesticides, polychlorinated biphenyls, dioxins, alkylphenolic chemicals, phthalates, and synthetic estrogens, have gained considerable attention during recent years because of their ability to disrupt processes governed by hormones [3]. In view of the persistence of these chemicals and their degradation products, which may also have endocrine activity, and their widespread presence in water and air, hormone-disrupting chemicals can be found in every kind of environmental matrix throughout the world. The reproductive system seems to be especially vulnerable to endocrine disruption, and abnormally high exposures to some hormonelike chemicals has affected reproductive processes in animals [46]. Because of the central role of estrogens in developmental processes and reproductive functions, compounds that mimic estrogenic agonists and antagonists are of major concern [68]. The majority of estrogenic chemicals are phenolic substances. The first evidence that para-alkylphenols could be estrogenic was published by Dodds and Lawson in 1938 [9]. Later, Mueller and Kim [10] showed that various alkylphenols are able to displace estradiol from its receptor and prevent estradiol from binding to the receptor. However, the health and environmental implications of these studies were not realized at that time, and it was not until 1991 that concerns were raised about alkylphenolic compounds [11].
Alkylphenols are degradation products of the microbial breakdown of the nonionic surfactants alkylphenol polyethoxylates (APEs). APEs, which were introduced in the 1940s, are the second largest group of nonionic surfactants in commercial production. Worldwide, approximately 360 000 tons of alkylphenols and ethoxylates were produced in 1986 [12, 13]. In Scandinavia, Germany, and Switzerland, alkylphenols are being phased out, but these substances continue to be part of the industrial process in many other countries, and residues remain in the environment.
An estimated 60% of APEs end up in the environment [14], most entering via sewage-treatment plants, where they are readily degraded to form relatively stable metabolites, such as the alkylphenols, nonylphenol, and octylphenol [15, 16]. These compounds are distributed with water on fields and have been detected in rivers, sewage-treatment plants, and drinking water [1720], and can persist in the environment for up to 150 days [21]. Concentrations of 0.1539 µg/L have been reported for untreated and treated wastewater in the United States [22]. Because of their lipophilic nature, alkylphenols are able to accumulate in animal tissues [23, 24] and are therefore likely to enter the food chain. Unfortunately, few attempts have been made to measure the levels of alkylphenolic compounds in organisms.
Among alkylphenols, nonylphenol is detected in higher levels than is p-tert-octylphenol (OP) in the environment [25]. However, various in vitro findings indicate that OP is the most potent estrogenic alkylphenol [26, 27], showing estrogenic activity in vitro at concentrations of around 0.1 µM. It competes with 17ß-estradiol for binding to both the progesterone and estrogen receptors and is able to transactivate both receptors in reporter assays [28].
Data on the in vivo effects of OP on female reproduction are limited; most of the attention has been focused on effects in males. However, abnormalities in females have been reported, including earlier onsets of puberty and menopause, disruption of estrous cyclicity [25], and anovulation [29].
Apart from concerns for human reproduction, perturbation of reproduction in domestic animals is also possible. The recent ban on the dumping of sewage sludge into the sea means that increasing amounts of sewage sludge will be spread on farmland as fertilizer, raising the question of the impact of such compounds on farm animal health. In a recent study, first evidence was presented that OP alters the follicular turnover in the ovary of sheep fetuses [30]. There is, however, a lack of information on adverse effects of OP on the reproductive health of other female farm animals. In the present study, we examined bovine oocytes to determine the effects on in vitro maturation and developmental competence of exposure to different concentrations of OP.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Collection of Cumulus-Oocyte Complexes
Ovaries were collected from a local slaughterhouse and transported within 2 h to the laboratory in Dulbecco PBS supplemented with 100 000 IU/L penicillin, 100 mg/L streptomycin, and 250 µg/L amphotericin B at 3234°C. All subsequent procedures were conducted at a constant temperature of 36°C.
Ovarian follicles were sliced with a razor blade [31], and cumulus-oocyte complexes (COCs) were collected in modified Dulbecco's PBS (catalog no. D 6650) supplemented with 2 IU heparin and 0.1% BSA Fraction V. Intact COCs were placed in tissue culture medium (TCM) 199 (no. M 5017) supplemented with 0.4% BSA (no. A 3156), 25 mM Hepes, and 10 µg/ml heparin. COCs were then washed three times in the same medium. Only COCs with at least three complete layers of cumulus cells and finely granulated homogeneous ooplasm were selected as suitable for in vitro maturation (IVM) and used for the following experiments, as previously described [32].
p-tert-Octylphenol
OP (4-(1,1,3,3-tetramethylbutyl)-phenol, >99% pure; Aldrich Chemical Co., Milwaukee, WI) was dissolved in absolute ethanol (Merck, Munich, Germany) and serially diluted in basic maturation medium (bMM; TCM 199 supplemented with 0.68 mM L-glutamine, 25 mM NaHCO3, 10% [v/v] fetal calf serum, 10 IU/ml eCG, and 5 IU/ml hCG [Suigonan; Intervet, Wiesbaden, Germany] and 1 µg/ml 17ß-estradiol) to obtain the desired concentration with the maximal alcohol content of 0.1% (v/v). Control culture dishes contained medium with the same amount of alcohol.
In Vitro Maturation
OP was added to the bMM in various concentrations, ranging from 0 to 1 µg/ml (04.8 µM). A group treated with 2 µg/ml 17ß-estradiol was included as a reference. Between 25 and 35 COCs per well were matured in 500 µl of medium. Incubation was performed for 24 h in four-well dishes (Nunc, Roskilde, Denmark) at 39°C in a humid atmosphere of 5% CO2 in air.
In Vitro Fertilization
A straw containing cryopreserved spermatozoa was thawed at 34°C in a water bath for 1 min, and the cells were layered on a 4590% Percoll gradient made with modified Tyrode medium (Tyrode albumin lactate pyruvate; TALP) [33]. The gradient was then centrifuged for 30 min at 600 x g. The motile sperm fraction was washed once in TALP medium, counted, and diluted to a final concentration of 106 spermatozoa/ml in fertilization medium, made of TALP medium supplemented with 0.6% (w/v) fatty acid-free BSA (no. A 8806), 10 µg/ml heparin, 20 µM penicillamine, 1 µM epinephrine, and 100 µM hypotaurine [34].
The following steps were conducted in the absence of OP. At the end of IVM, COCs were washed twice in TALP medium supplemented with 0.6% (w/v) fatty acid free-BSA and 20 mM Hepes (H-TALP) and once in fertilization medium. Groups of 2535 COCs were transferred to 300 µl of sperm-containing fertilization medium in four-well dishes. In vitro fertilization (IVF) was performed by sperm-oocyte coincubation for 20 h at 39°C in a humid atmosphere of 5% CO2 in air.
Embryo Culture
After fertilization, presumptive zygotes were denuded of cumulus cells by vortexing for 3 min in H-TALP. After two washes in H-TALP, embryos were washed three times in culture medium: modified synthetic oviductal fluid (mSOF) [35] supplemented with 0.8% fatty acid-free BSA (no. A 3803), 0.33 mM L-glutamine, 25 mM NaHCO3, and essential and nonessential amino acids (nos. M 5550, M 6895). Groups of 2535 embryos were transferred into 30-µl drops of mSOF and cultured in a gassed incubation chamber (Billups-Rothenberg, Del Mar, CA) at 39°C in a humid atmosphere of 5% CO2, 5% O2, and 90% N2 under mineral oil.
Evaluation of Developmental Competence
To assess the rate of meiosis at the end of IVM, a total of 576 oocytes from various treatment groups were analyzed. Oocytes were completely denuded of cumulus cells by repeated pipetting, recovered under a stereomicroscope, and transferred onto a glass slide in a small drop of fluid. Silicone was used to maintain a coverslip in contact with the oocytes without exerting excessive pressure. The slides were immersed in a 3:1 fixative solution of ethanol:acetic acid for a minimum of 24 h. Nuclear morphology was assessed by staining with 1% lacmoid, and specimens were examined under a phase contrast microscope (250x). Oocytes were classified as immature (germinal vesicle [GV] and GV breakdown stage), intermediate (anaphase I and metaphase I), or matured (telophase I and metaphase II). Oocytes showing multipolar meiotic spindle, irregular chromatin clumps, or no chromatin were considered degenerated [36].
Fertilization rates were determined employing the same procedure for 363 oocytes 18 h after their transfer to the insemination medium. Only oocytes showing two pronuclei and a sperm tail were classified as fertilized.
An additional 1094 oocytes were matured, fertilized, and cultured for 7 days. Cleavage rate was determined at the end of the second day postinsemination (dpi) under a stereomicroscope. Embryos were fixed in 100% methanol at 8 dpi, and chromatin was stained with Hoechst (no. B 2883) for an accurate count of nuclei.
Messenger RNA Isolation and cDNA Synthesis
Poly(A)+ RNA from pooled COCs was extracted using Dynabeads mRNA DIRECT kit (Deutsche Dynal, Hamburg, Germany). Pools of 3040 COCs were lysed for 10 min at room temperature in 200 µl lysis buffer: 100 mmol Tris-HCl (pH 8.0), 500 mmol LiCl, 10 mmol EDTA, 1% (w/v) SDS, and 5 mmol dithiothreitol. After lysis, 10 µl of prewashed Dynabeads oligo(dT)25 were pippetted into the tube, and binding of poly(A)+ RNAs to the oligo(dT) beads was allowed for 5 min at room temperature. The beads were then separated with a Dynal MPC-E magnetic separator (Deutsche Dynal, Hamburg, Germany) and washed twice with 30 µl of washing buffer A (10 mmol Tris-HCl pH 8.0, 0.15 mmol LiCl, 1 mmol EDTA, 0.1% [w/v] SDS) and three times with 30 µl of washing buffer B (10 mmol Tris-HCl pH 8.0, 0.15 mmol LiCl, 1 mmol EDTA). Poly(A)+ RNAs were then eluted from the beads by incubation in 11 µl diethyl pyrocarbonate-treated sterile water at 65°C for 2 min. Aliquots were immediately used for reverse transcription (RT) using the Perkin Elmer (Wellsley, MA) polymerase chain reaction (PCR) Core kit, using 2.5 µmol of random hexamers to get the widest array of cDNAs. RT was carried out in a final volume of 20 µl at 25°C for 10 min and then 42°C for 1 h, followed by a denaturation step at 99°C for 5 min and immediate cooling on ice.
Oligonucleotide Primers for PCRs
Based on the mRNA sequences available in the EMBL database, the following specific primer pairs were designed: estrogen receptor
(ER
; accession no. U64962) sense primer CCATGGAGCATCCAGGGAAG and antisense primer AGAGGCACCACGTTCTTGCAC; estrogen receptor ß (ERß; Y18017) sense primer AGAGGAACGGTGGACCCATG and antisense primer CACTCTTGGCAATCACCCAGA; progesterone receptor (PR; Z86041) sense primer TGAGCATTGAACCAGATGTGG and antisense primer CCTTCATCCGCTGTTCATTTAG; ß-actin (U39357) sense primer CCAAGGCCAACCGTGAGAAG and antisense primer CCATCTCCTGCTTCGAAGTCC. PCR products were sequenced to verify their identity and homology to corresponding mRNA sequences in the EMBL database.
Semiquantitative PCR
To normalize signals from different RNA samples, ß-actin transcripts were coamplified as an internal standard. The amplification reaction was stopped before leaving the exponential phase. Amplifications were performed on 5 µl of first-strand cDNA in a 50-µl final volume 1 U Taq polymerase (Life Technologies, Karlsruhe, Germany), 0.2 mM dNTPs, 1.5 mM MgCl2, 1x PCR buffer, and 0.2 µM of the oligonucleotide primer combinations listed above. Amplification cycles comprised denaturation for 30 sec at 94°C, annealing for 30 sec at 60°C and 58°C for ER
and ERß, respectively, and elongation at 45°C. A water control was included to identify possible contamination. In addition, all samples were amplified with an intron-exon spanning primer pair to detect possible genomic DNA contamination.
A volume of 20 µl/reaction was subjected to electrophoresis on a 1.5% agarose gel in Tris-acetate-EDTA (TAE) buffer, containing 0.2 µg/ml ethidium bromide. After separation, the fragments were visualized on a 312-nm ultraviolet transilluminator. The image of each gel was digitized using a charge-coupled device (CCD) camera (Labortechnik Gmbh, Wasserburg, Germany), and the intensity of each band was quantified by densitometric analysis using a computer-assisted image analysis system (BioProfil; LTF Software, Wasserburg, Germany). The relative amount of the mRNA of interest was calculated as a percentage of the intensity of the ß-actin band for the corresponding sample. For each mRNA, experiments were replicated at least three times.
Statistical Analysis
Data for in vitro culture were analyzed using a binary logistic regression. The control was considered the reference group. Experiments were replicated at least three times, and replicate was used as a variable in the analysis. The log-likelihood ratio statistic was used to detect between-treatment differences using the SPSS statistical package (Chicago, IL). Data for cell number and gene expression were assessed using an ANOVA followed by the Fischer protected least significant difference test. In all cases, the criterion for significance was set at P
0.05.
| RESULTS |
|---|
|
|
|---|
|
The effect of OP treatment on IVF is summarized in Table 2. Exposure to OP during IVM had a significant effect on subsequent IVF rates (P < 0.05). Because of the absence of matured oocytes after exposure to 1 and 0.1 µg/ml OP, these treatments were excluded from the following analysis.
|
The percentage of properly fertilized oocytes matured in the presence of 0.01 µg/ml OP was significantly reduced. Furthermore, the incidence of polyspermy was significantly higher in the 0.01 µg/ml group compared with the other treatments (P < 0.05). No significant differences were observed in the rates of nonfertilized and degenerated oocytes. Frequencies of normal sperm penetrations and polyspermic fertilizations were not altered with OP concentrations up to 0.001 µg/ml or with 2 µg/ml 17ß-estradiol.
Table 3 shows the effects of OP exposure on cleavage rate (2 dpi) and rate of development to the blastocyst stage (8 dpi). No effect of OP on cleavage was observed in concentrations up to 0.001 µg/ml, but exposure to 0.01 µg/ml OP significantly reduced the percentage of embryos that cleaved at least once. An OP concentration of 0.001 µg/ml (P < 0.05) represented the minimum effective dose at which the development to the blastocyst stage was significantly reduced. This dose did not affect the IVM and IVF outcome, suggesting that the decreased oocyte developmental competence observed did not only reflect lower maturation and fertilization rates. Furthermore, the blastocyst cell number was significantly decreased in all OP-treated groups (0.010.0001 µg/ml) compared with controls, suggesting poorer embryo quality. No significant differences compared with controls were observed in the 17ß-estradiol groups.
|
To correlate negative effects of OP exposure on in vitro oocyte maturation with the ability of OP to modulate the expression of estrogen-sensitive genes, the mRNA expression of ER
, ERß, and PR was analyzed in OP-treated COCs in comparison to nontreated and 17ß-estradiol-treated COCs (Fig. 1). The analysis of gene expression revealed a far more complex profile of action than the data from the developmental study. Treatment with 2 µg/ml of 17ß-estradiol led to a downregulation of both ER
and ERß but to an upregulation of PR mRNA. Treatment with 0.001 and 0.0001 µg/ml OP induced a similar decrease of ER
mRNA only. ERß and PR mRNA expression was not affected at any OP concentration. Despite its negative effects on oocyte maturation and developmental competence, exposure to 0.01 µg/ml OP did not result in alteration of mRNA levels for any of the genes analyzed. Analysis of gene expression on separated oocytes and cumulus cells after exposure indicated an expression pattern similar to that observed for entire COCs for all the genes investigated (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
Reproductive toxicants can affect ovarian function in a variety of ways. Increased levels of xenoestrogens may affect ovarian function through the disruption of feedback mechanisms in the hypothalamus-pituitary-gonadal axis [39]. The ovary also is a direct target for xenoestrogens [30, 40, 41]. Collectively, these findings suggest that xenoestrogens can influence follicular growth and, through these effects, may affect the oocyte, as has been shown in in vitro studies [42].
We found that the xenoestrogen OP significantly affects the maturation of in vitro-cultured bovine oocytes and their subsequent developmental competence. These effects were dose dependent, with complete inhibition at high OP concentrations (1 and 0.1 µg/ml). At these concentrations (1 and 0.1 µg/ml), an increased incidence of nuclear maturation abnormalities was observed, and a very small percentage of oocytes were able to complete the first meiotic division. When OP was added at a level of 0.01 µg/ml, the reduced maturation rate seemed to be linked to a block or delay of the maturation process; most of the oocytes that did not complete maturation were blocked between metaphase I and anaphase I, but no treatment effect on degeneration rate was evident. These results are in agreement with the observation that addition of OP to the culture medium (concentrations of 1100 µg/ml) perturbed the FSH-induced resumption of meiosis in mouse oocytes [42]. In addition, in vivo studies in female rats indicate that OP induces acyclicity and anovulation due to disturbance of ovarian activity [40, 43].
The negative effect of OP in the maturation medium was not limited to maturation and fertilization rates but also included subsequent embryonic development. There was a significant decrease in the percentage of embryos that reached the blastocyst stage at 8 dpi. This decrease was evident at a concentration lower than that shown to reduce the maturation rate (0.001 µg/ml). Furthermore, significantly lower numbers of cells were observed in embryos derived from all OP treatments. These results are of great concern, indicating that the effects of exposure to a toxicant during the maturation period might not be visible until later stages of development. Several of these findings suggest that exposure to low doses of certain chemicals at critical stages in organ development can result in abnormalities that lead to irreversible changes in the functioning of organ systems later in life. Furthermore, there is increasing concern that environmental pollution may have a negative impact on gamete growth and differentiation. The common thread in these diverse observations is that development can be affected by events that occur long before any defect is apparent.
The most widely investigated mechanism of action of OP is its ability to act as an estrogen mimic via the activation of estrogen receptors. In our in vitro model system, however, no direct relationship between the effects of OP on oocyte meiosis progression and developmental competence and the ability of OP to mimic the activity of natural estrogens was noted. The exposure to 17ß-estradiol during IVM did not adversely affect oocyte maturation and developmental competence at any stage but did induce a significant decrease in the expression of ER
and ERß transcripts and a significant upregulation of PR mRNA. In contrast, OP affected IVM and developmental competence by showing a markedly different gene expression fingerprint compared with 17ß-estradiol. OP exposure resulted in decreased ER
mRNA expression, but ERß and PR levels were not affected. Therefore a different dose-response relationship seems to exists for the toxic activity of OP and its ability to interfere with estrogen-related genes. These data are in agreement with the observation of Nair-Menon et al. [44] in murine splenocytes. In that system, OP negatively affected splenocyte survival, with no apparent ER-mediated effect. ER
mRNA downregulation was present only at low OP concentrations (0.001 and 0.0001 µg/ml) [44]. A discrepancy between toxic effect and hormonal mimicry has also been observed for other classes of xenoestrogens. Maggiolini et al. [45] found that low doses of the two phytoestrogens genistein and quercitin resulted in downregulation of the ER
in human breast cancer cells, whereas at higher concentrations both phytoestrogens exhibited a toxic activity completely independent of ER expression. Observations of nonlinear dose-response curves in recent years have been given great attention in toxicological studies. A wide range of specific mechanisms could account for this phenomenon. To date, nonlinear dose-response relationships have been discovered within several dozen receptor systems, but explanations that could account for this type of response are still considerably underresearched [46].
Because OP binds to ERs in other systems [4749] and we have demonstrated that OP mimics the estrogen-mediated action of ER
, it remains possible that OP is capable of competing for binding to ERs in bovine COCs. Further studies are in progress to obtain a much larger data set on the mechanism of OP action during in vitro oocyte maturation.
In the present study we identified the bovine COC as a target tissue of OP, providing the first published information on the potential reproductive risk of exposure to alkylphenolic compounds in domestic ruminants. A key question in relation to the broader significance of these results is how the levels of OP in the environment relate to the concentration used in the present study. The answer to this question is confounded by two major problems. First, little information has been collected on the levels of OP in the environment. However, alkylphenolic compounds have been found in waterways throughout Europe and the United States [50, 51] in concentrations ranging from nanograms to milligrams per liter. Second, alkylphenols bioaccumulate in body fat [23, 24]. Toxicokinetic studies have suggested gender differences in OP biological disposition, indicating a shorter half-life of this compound in males than in females [52, 53]. Thus, although concentrations of alkylphenols in the environment may be low, significant concentrations may accumulate in the body and may be mobilized during fasting or under energetically expensive physiological conditions such as pregnancy or lactation [54]. Caution is needed when trying to extrapolate from results of in vitro assays to the effect on the entire living organism. Bioactivity in vivo, and thus the detrimental effect of endocrine system-disrupting chemicals, depends on several factors such as dose, resorption, metabolism, accumulation in specific tissues, binding affinity to transport proteins and receptors, and possible synergistic effects with other endocrine active substances. Nevertheless, when other than rodent models are chosen, in vivo experiments are expensive and time consuming. Thus, preliminary in vitro models utilizing oocytes of domestic animals might represent a useful alternative.
Exposure of bovine oocytes to OP during IVM inhibits the normal resumption of meiosis and subsequent developmental competence. In our in vitro system, OP was unable to reproduce the pattern of action of natural estrogen exposure at both the morphological and molecular level, suggesting that OP toxicity is not a direct result of estrogen mimicry. These findings add to a growing body of evidence supporting the concept that exposure to environmental contaminants, such as OP, may result in adverse effects on reproductive health. Here, we provide a set of reference data for the assessment of the risk posed by these substances. The biological relevance of these observations will depend on the levels of exposure of farm animals to OP and related substances, and establishment of the long-term harmful effects on ovarian function will be important future features in assessing the in vivo biological relevance of OP effects on ruminants reproductive physiology.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Paola Pocar, Department of Anatomy and Cell Biology, Martin Luther University Halle-Wittenberg, Grosse Steinstrasse 52, D-06097 Halle (Saale), Germany. FAX: 49 345 557 1700; paola.pocar{at}medizin.uni-halle.de ![]()
Received: 15 August 2002.
First decision: 5 September 2002.
Accepted: 21 March 2003.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. Roth and P.J. Hansen Sphingosine 1-Phosphate Protects Bovine Oocytes from Heat Shock During Maturation Biol Reprod, December 1, 2004; 71(6): 2072 - 2078. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |