Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print April 16, 2003.
Biol Reprod 2003, 10.1095/biolreprod.102.010355
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/2/462    most recent
biolreprod.102.010355v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Agricola
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
BIOLOGY OF REPRODUCTION 69, 462–468 (2003)
DOI: 10.1095/biolreprod.102.010355
© 2003 by the Society for the Study of Reproduction, Inc.

Toxicology

Toxic Effects of In Vitro Exposure to p-tert-Octylphenol on Bovine Oocyte Maturation and Developmental Competence1

Paola Pocar2,3, Robert Augustin3, Fulvio Gandolfi4, and Bernd Fischer3

Department of Anatomy and Cell Biology,3 Faculty of Medicine, Martin Luther University Halle/Wittenberg, D-06097 Halle (Saale), Germany Department of Anatomy of Domestic Animals,4 Faculty of Veterinary Medicine, University of Milan, I-20134 Milan, Italy


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Alkylphenolic compounds are a widespread family of xenoestrogens. High concentrations of these substances are present in sewage sludge that is spread on arable land and pasture as fertilizer. Because of their known endocrine system-disrupting activity, alkylphenols represent a potential risk for the reproductive health of farm animals. In this study, the impact of p-tert-octylphenol (OP) on the developmental competence of bovine oocytes was evaluated. Endocrine activity of OP was investigated for its effect on estrogen receptors {alpha} and ß (ER{alpha} and ERß) and progesterone receptor (PR) mRNA levels. Cumulus-oocyte complexes (COCs) were exposed during in vitro maturation to serial concentrations of OP (1–0.0001 µg/ml) and were compared with vehicle-treated controls and a group of COCs treated with 17ß-estradiol (E2). A dose-related decrease in the percentage of oocytes that completed maturation after 24 h and in oocyte fertilization competence was observed at doses of OP as low as 0.01 µg/ml. Groups treated with >=0.001 µg/ml OP showed impaired embryo development. No adverse effects of E2 were observed. In the E2-treated COCs, ER{alpha} mRNA was decreased but PR mRNA was upregulated compared with controls. Treatment with 0.001 and 0.0001 µg/ml OP induced a decrease in ER{alpha} mRNA, but ERß and PR mRNA were not affected. Treatment with 0.01 µg/ml OP did not produce changes in the expression of any of the mRNAs studied. OP impairs meiotic progression and developmental competence of bovine oocytes without demonstrating clear estrogen-mimic activity.

embryo, environment, estradiol receptor, in vitro fertilization, meiosis


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During recent decades, a decline in fertility has been recorded in high-yield dairy cattle herds [1]. Reproductive impairment may be attributable to various factors, including hormonal imbalance, genetic improvement for milk production, diversion of nutrients into growth, and environmental factors such as farm management practices [2]. At the same time, evidence of adverse effects of xenobiotics on the physiology of a wide range of species suggests that there is a potential risk of reproductive failure in domestic animals as a consequence of acute or long-term exposure to environmental contaminants. In contrast to the many studies on humans and wildlife, the effects of exposure to xenobiotics in ruminants so far has attracted little attention. However, domestic ruminants may be exposed to these compounds in air, food, and water, and their reproductive health might be affected. Circumstantial evidence of adverse effects of xenobiotics was provided by Boerjan et al. [1], who demonstrated reduced reproductive performance in dairy cattle exposed to drinking water contaminated with sewage overflows.

A variety of man-made chemicals released into the environment that exhibit endocrinelike activity, e.g., organochlorine pesticides, polychlorinated biphenyls, dioxins, alkylphenolic chemicals, phthalates, and synthetic estrogens, have gained considerable attention during recent years because of their ability to disrupt processes governed by hormones [3]. In view of the persistence of these chemicals and their degradation products, which may also have endocrine activity, and their widespread presence in water and air, hormone-disrupting chemicals can be found in every kind of environmental matrix throughout the world. The reproductive system seems to be especially vulnerable to endocrine disruption, and abnormally high exposures to some hormonelike chemicals has affected reproductive processes in animals [4–6]. Because of the central role of estrogens in developmental processes and reproductive functions, compounds that mimic estrogenic agonists and antagonists are of major concern [6–8]. The majority of estrogenic chemicals are phenolic substances. The first evidence that para-alkylphenols could be estrogenic was published by Dodds and Lawson in 1938 [9]. Later, Mueller and Kim [10] showed that various alkylphenols are able to displace estradiol from its receptor and prevent estradiol from binding to the receptor. However, the health and environmental implications of these studies were not realized at that time, and it was not until 1991 that concerns were raised about alkylphenolic compounds [11].

Alkylphenols are degradation products of the microbial breakdown of the nonionic surfactants alkylphenol polyethoxylates (APEs). APEs, which were introduced in the 1940s, are the second largest group of nonionic surfactants in commercial production. Worldwide, approximately 360 000 tons of alkylphenols and ethoxylates were produced in 1986 [12, 13]. In Scandinavia, Germany, and Switzerland, alkylphenols are being phased out, but these substances continue to be part of the industrial process in many other countries, and residues remain in the environment.

An estimated 60% of APEs end up in the environment [14], most entering via sewage-treatment plants, where they are readily degraded to form relatively stable metabolites, such as the alkylphenols, nonylphenol, and octylphenol [15, 16]. These compounds are distributed with water on fields and have been detected in rivers, sewage-treatment plants, and drinking water [17–20], and can persist in the environment for up to 150 days [21]. Concentrations of 0.15–39 µg/L have been reported for untreated and treated wastewater in the United States [22]. Because of their lipophilic nature, alkylphenols are able to accumulate in animal tissues [23, 24] and are therefore likely to enter the food chain. Unfortunately, few attempts have been made to measure the levels of alkylphenolic compounds in organisms.

Among alkylphenols, nonylphenol is detected in higher levels than is p-tert-octylphenol (OP) in the environment [25]. However, various in vitro findings indicate that OP is the most potent estrogenic alkylphenol [26, 27], showing estrogenic activity in vitro at concentrations of around 0.1 µM. It competes with 17ß-estradiol for binding to both the progesterone and estrogen receptors and is able to transactivate both receptors in reporter assays [28].

Data on the in vivo effects of OP on female reproduction are limited; most of the attention has been focused on effects in males. However, abnormalities in females have been reported, including earlier onsets of puberty and menopause, disruption of estrous cyclicity [25], and anovulation [29].

Apart from concerns for human reproduction, perturbation of reproduction in domestic animals is also possible. The recent ban on the dumping of sewage sludge into the sea means that increasing amounts of sewage sludge will be spread on farmland as fertilizer, raising the question of the impact of such compounds on farm animal health. In a recent study, first evidence was presented that OP alters the follicular turnover in the ovary of sheep fetuses [30]. There is, however, a lack of information on adverse effects of OP on the reproductive health of other female farm animals. In the present study, we examined bovine oocytes to determine the effects on in vitro maturation and developmental competence of exposure to different concentrations of OP.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Unless otherwise stated, all reagents were purchased from Sigma Chemical Co. (St. Louis, MO).

Collection of Cumulus-Oocyte Complexes

Ovaries were collected from a local slaughterhouse and transported within 2 h to the laboratory in Dulbecco PBS supplemented with 100 000 IU/L penicillin, 100 mg/L streptomycin, and 250 µg/L amphotericin B at 32–34°C. All subsequent procedures were conducted at a constant temperature of 36°C.

Ovarian follicles were sliced with a razor blade [31], and cumulus-oocyte complexes (COCs) were collected in modified Dulbecco's PBS (catalog no. D 6650) supplemented with 2 IU heparin and 0.1% BSA Fraction V. Intact COCs were placed in tissue culture medium (TCM) 199 (no. M 5017) supplemented with 0.4% BSA (no. A 3156), 25 mM Hepes, and 10 µg/ml heparin. COCs were then washed three times in the same medium. Only COCs with at least three complete layers of cumulus cells and finely granulated homogeneous ooplasm were selected as suitable for in vitro maturation (IVM) and used for the following experiments, as previously described [32].

p-tert-Octylphenol

OP (4-(1,1,3,3-tetramethylbutyl)-phenol, >99% pure; Aldrich Chemical Co., Milwaukee, WI) was dissolved in absolute ethanol (Merck, Munich, Germany) and serially diluted in basic maturation medium (bMM; TCM 199 supplemented with 0.68 mM L-glutamine, 25 mM NaHCO3, 10% [v/v] fetal calf serum, 10 IU/ml eCG, and 5 IU/ml hCG [Suigonan; Intervet, Wiesbaden, Germany] and 1 µg/ml 17ß-estradiol) to obtain the desired concentration with the maximal alcohol content of 0.1% (v/v). Control culture dishes contained medium with the same amount of alcohol.

In Vitro Maturation

OP was added to the bMM in various concentrations, ranging from 0 to 1 µg/ml (0–4.8 µM). A group treated with 2 µg/ml 17ß-estradiol was included as a reference. Between 25 and 35 COCs per well were matured in 500 µl of medium. Incubation was performed for 24 h in four-well dishes (Nunc, Roskilde, Denmark) at 39°C in a humid atmosphere of 5% CO2 in air.

In Vitro Fertilization

A straw containing cryopreserved spermatozoa was thawed at 34°C in a water bath for 1 min, and the cells were layered on a 45–90% Percoll gradient made with modified Tyrode medium (Tyrode albumin lactate pyruvate; TALP) [33]. The gradient was then centrifuged for 30 min at 600 x g. The motile sperm fraction was washed once in TALP medium, counted, and diluted to a final concentration of 106 spermatozoa/ml in fertilization medium, made of TALP medium supplemented with 0.6% (w/v) fatty acid-free BSA (no. A 8806), 10 µg/ml heparin, 20 µM penicillamine, 1 µM epinephrine, and 100 µM hypotaurine [34].

The following steps were conducted in the absence of OP. At the end of IVM, COCs were washed twice in TALP medium supplemented with 0.6% (w/v) fatty acid free-BSA and 20 mM Hepes (H-TALP) and once in fertilization medium. Groups of 25–35 COCs were transferred to 300 µl of sperm-containing fertilization medium in four-well dishes. In vitro fertilization (IVF) was performed by sperm-oocyte coincubation for 20 h at 39°C in a humid atmosphere of 5% CO2 in air.

Embryo Culture

After fertilization, presumptive zygotes were denuded of cumulus cells by vortexing for 3 min in H-TALP. After two washes in H-TALP, embryos were washed three times in culture medium: modified synthetic oviductal fluid (mSOF) [35] supplemented with 0.8% fatty acid-free BSA (no. A 3803), 0.33 mM L-glutamine, 25 mM NaHCO3, and essential and nonessential amino acids (nos. M 5550, M 6895). Groups of 25–35 embryos were transferred into 30-µl drops of mSOF and cultured in a gassed incubation chamber (Billups-Rothenberg, Del Mar, CA) at 39°C in a humid atmosphere of 5% CO2, 5% O2, and 90% N2 under mineral oil.

Evaluation of Developmental Competence

To assess the rate of meiosis at the end of IVM, a total of 576 oocytes from various treatment groups were analyzed. Oocytes were completely denuded of cumulus cells by repeated pipetting, recovered under a stereomicroscope, and transferred onto a glass slide in a small drop of fluid. Silicone was used to maintain a coverslip in contact with the oocytes without exerting excessive pressure. The slides were immersed in a 3:1 fixative solution of ethanol:acetic acid for a minimum of 24 h. Nuclear morphology was assessed by staining with 1% lacmoid, and specimens were examined under a phase contrast microscope (250x). Oocytes were classified as immature (germinal vesicle [GV] and GV breakdown stage), intermediate (anaphase I and metaphase I), or matured (telophase I and metaphase II). Oocytes showing multipolar meiotic spindle, irregular chromatin clumps, or no chromatin were considered degenerated [36].

Fertilization rates were determined employing the same procedure for 363 oocytes 18 h after their transfer to the insemination medium. Only oocytes showing two pronuclei and a sperm tail were classified as fertilized.

An additional 1094 oocytes were matured, fertilized, and cultured for 7 days. Cleavage rate was determined at the end of the second day postinsemination (dpi) under a stereomicroscope. Embryos were fixed in 100% methanol at 8 dpi, and chromatin was stained with Hoechst (no. B 2883) for an accurate count of nuclei.

Messenger RNA Isolation and cDNA Synthesis

Poly(A)+ RNA from pooled COCs was extracted using Dynabeads mRNA DIRECT kit (Deutsche Dynal, Hamburg, Germany). Pools of 30–40 COCs were lysed for 10 min at room temperature in 200 µl lysis buffer: 100 mmol Tris-HCl (pH 8.0), 500 mmol LiCl, 10 mmol EDTA, 1% (w/v) SDS, and 5 mmol dithiothreitol. After lysis, 10 µl of prewashed Dynabeads oligo(dT)25 were pippetted into the tube, and binding of poly(A)+ RNAs to the oligo(dT) beads was allowed for 5 min at room temperature. The beads were then separated with a Dynal MPC-E magnetic separator (Deutsche Dynal, Hamburg, Germany) and washed twice with 30 µl of washing buffer A (10 mmol Tris-HCl pH 8.0, 0.15 mmol LiCl, 1 mmol EDTA, 0.1% [w/v] SDS) and three times with 30 µl of washing buffer B (10 mmol Tris-HCl pH 8.0, 0.15 mmol LiCl, 1 mmol EDTA). Poly(A)+ RNAs were then eluted from the beads by incubation in 11 µl diethyl pyrocarbonate-treated sterile water at 65°C for 2 min. Aliquots were immediately used for reverse transcription (RT) using the Perkin Elmer (Wellsley, MA) polymerase chain reaction (PCR) Core kit, using 2.5 µmol of random hexamers to get the widest array of cDNAs. RT was carried out in a final volume of 20 µl at 25°C for 10 min and then 42°C for 1 h, followed by a denaturation step at 99°C for 5 min and immediate cooling on ice.

Oligonucleotide Primers for PCRs

Based on the mRNA sequences available in the EMBL database, the following specific primer pairs were designed: estrogen receptor {alpha} (ER{alpha}; accession no. U64962) sense primer CCATGGAGCATCCAGGGAAG and antisense primer AGAGGCACCACGTTCTTGCAC; estrogen receptor ß (ERß; Y18017) sense primer AGAGGAACGGTGGACCCATG and antisense primer CACTCTTGGCAATCACCCAGA; progesterone receptor (PR; Z86041) sense primer TGAGCATTGAACCAGATGTGG and antisense primer CCTTCATCCGCTGTTCATTTAG; ß-actin (U39357) sense primer CCAAGGCCAACCGTGAGAAG and antisense primer CCATCTCCTGCTTCGAAGTCC. PCR products were sequenced to verify their identity and homology to corresponding mRNA sequences in the EMBL database.

Semiquantitative PCR

To normalize signals from different RNA samples, ß-actin transcripts were coamplified as an internal standard. The amplification reaction was stopped before leaving the exponential phase. Amplifications were performed on 5 µl of first-strand cDNA in a 50-µl final volume 1 U Taq polymerase (Life Technologies, Karlsruhe, Germany), 0.2 mM dNTPs, 1.5 mM MgCl2, 1x PCR buffer, and 0.2 µM of the oligonucleotide primer combinations listed above. Amplification cycles comprised denaturation for 30 sec at 94°C, annealing for 30 sec at 60°C and 58°C for ER{alpha} and ERß, respectively, and elongation at 45°C. A water control was included to identify possible contamination. In addition, all samples were amplified with an intron-exon spanning primer pair to detect possible genomic DNA contamination.

A volume of 20 µl/reaction was subjected to electrophoresis on a 1.5% agarose gel in Tris-acetate-EDTA (TAE) buffer, containing 0.2 µg/ml ethidium bromide. After separation, the fragments were visualized on a 312-nm ultraviolet transilluminator. The image of each gel was digitized using a charge-coupled device (CCD) camera (Labortechnik Gmbh, Wasserburg, Germany), and the intensity of each band was quantified by densitometric analysis using a computer-assisted image analysis system (BioProfil; LTF Software, Wasserburg, Germany). The relative amount of the mRNA of interest was calculated as a percentage of the intensity of the ß-actin band for the corresponding sample. For each mRNA, experiments were replicated at least three times.

Statistical Analysis

Data for in vitro culture were analyzed using a binary logistic regression. The control was considered the reference group. Experiments were replicated at least three times, and replicate was used as a variable in the analysis. The log-likelihood ratio statistic was used to detect between-treatment differences using the SPSS statistical package (Chicago, IL). Data for cell number and gene expression were assessed using an ANOVA followed by the Fischer protected least significant difference test. In all cases, the criterion for significance was set at P <= 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
The exposure of bovine oocytes to OP during IVM significantly affected the outcome of maturation, fertilization, and subsequent embryo development in a dose-dependent manner. Analysis revealed a significant effect for different OP concentrations on maturation rate (P < 0.05) (Table 1). In the presence of 1 and 0.1 µg/ml OP, oocytes did not mature after 24 h of culture (0.0% and 2.7%, respectively) compared with a mean of 80.0% observed in the control. Correspondingly, an increased incidence of immature and degenerated oocytes was found at both concentrations. In oocytes cultured in the presence of 0.01 µg/ml OP, an increased percentage of oocytes arrested prematurely at the intermediate stage was observed. The exposure of COCs to 0.001 and 0.0001 µg/ml OP and to 2 µg/ml 17ß-estradiol did not induce significant differences compared with the control (water) group.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Effect of OP on in vitro maturation of bovine oocytes

The effect of OP treatment on IVF is summarized in Table 2. Exposure to OP during IVM had a significant effect on subsequent IVF rates (P < 0.05). Because of the absence of matured oocytes after exposure to 1 and 0.1 µg/ml OP, these treatments were excluded from the following analysis.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Effects of exposure of OP during IVM on the in vitro fertilization of bovine oocytes

The percentage of properly fertilized oocytes matured in the presence of 0.01 µg/ml OP was significantly reduced. Furthermore, the incidence of polyspermy was significantly higher in the 0.01 µg/ml group compared with the other treatments (P < 0.05). No significant differences were observed in the rates of nonfertilized and degenerated oocytes. Frequencies of normal sperm penetrations and polyspermic fertilizations were not altered with OP concentrations up to 0.001 µg/ml or with 2 µg/ml 17ß-estradiol.

Table 3 shows the effects of OP exposure on cleavage rate (2 dpi) and rate of development to the blastocyst stage (8 dpi). No effect of OP on cleavage was observed in concentrations up to 0.001 µg/ml, but exposure to 0.01 µg/ml OP significantly reduced the percentage of embryos that cleaved at least once. An OP concentration of 0.001 µg/ml (P < 0.05) represented the minimum effective dose at which the development to the blastocyst stage was significantly reduced. This dose did not affect the IVM and IVF outcome, suggesting that the decreased oocyte developmental competence observed did not only reflect lower maturation and fertilization rates. Furthermore, the blastocyst cell number was significantly decreased in all OP-treated groups (0.01–0.0001 µg/ml) compared with controls, suggesting poorer embryo quality. No significant differences compared with controls were observed in the 17ß-estradiol groups.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Effects of bovine oocyte exposure to different concentrations of OP during IVM on embryo development

To correlate negative effects of OP exposure on in vitro oocyte maturation with the ability of OP to modulate the expression of estrogen-sensitive genes, the mRNA expression of ER{alpha}, ERß, and PR was analyzed in OP-treated COCs in comparison to nontreated and 17ß-estradiol-treated COCs (Fig. 1). The analysis of gene expression revealed a far more complex profile of action than the data from the developmental study. Treatment with 2 µg/ml of 17ß-estradiol led to a downregulation of both ER{alpha} and ERß but to an upregulation of PR mRNA. Treatment with 0.001 and 0.0001 µg/ml OP induced a similar decrease of ER{alpha} mRNA only. ERß and PR mRNA expression was not affected at any OP concentration. Despite its negative effects on oocyte maturation and developmental competence, exposure to 0.01 µg/ml OP did not result in alteration of mRNA levels for any of the genes analyzed. Analysis of gene expression on separated oocytes and cumulus cells after exposure indicated an expression pattern similar to that observed for entire COCs for all the genes investigated (data not shown).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. Semiquantitative RT-PCR analysis of ER{alpha}, ERß, and PR mRNA expression in bovine COCs after treatment with OP or 2 µg/ml 17ß-estradiol (E2). Pooled RNA of 30–40 COCs was analyzed for each treatment. Complementary DNA synthesis and semiquantitative PCR analysis was performed independently at least five times. The results are shown as mean ± SEM. Significant differences (P < 0.05) in mRNA expression level are indicated by different superscripts


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the adult female, the ovary performs two important roles: 1) development and delivery of female gametes and 2) production of ovarian hormones, such as inhibin and the female sex steroids estrogen and progesterone [37, 38]. The oocyte is required for fertilization, whereas ovarian hormone output is required for oocyte development, feedback signalling to the hypothalamus and pituitary, and establishment and maintenance of early pregnancy.

Reproductive toxicants can affect ovarian function in a variety of ways. Increased levels of xenoestrogens may affect ovarian function through the disruption of feedback mechanisms in the hypothalamus-pituitary-gonadal axis [39]. The ovary also is a direct target for xenoestrogens [30, 40, 41]. Collectively, these findings suggest that xenoestrogens can influence follicular growth and, through these effects, may affect the oocyte, as has been shown in in vitro studies [42].

We found that the xenoestrogen OP significantly affects the maturation of in vitro-cultured bovine oocytes and their subsequent developmental competence. These effects were dose dependent, with complete inhibition at high OP concentrations (1 and 0.1 µg/ml). At these concentrations (1 and 0.1 µg/ml), an increased incidence of nuclear maturation abnormalities was observed, and a very small percentage of oocytes were able to complete the first meiotic division. When OP was added at a level of 0.01 µg/ml, the reduced maturation rate seemed to be linked to a block or delay of the maturation process; most of the oocytes that did not complete maturation were blocked between metaphase I and anaphase I, but no treatment effect on degeneration rate was evident. These results are in agreement with the observation that addition of OP to the culture medium (concentrations of 1–100 µg/ml) perturbed the FSH-induced resumption of meiosis in mouse oocytes [42]. In addition, in vivo studies in female rats indicate that OP induces acyclicity and anovulation due to disturbance of ovarian activity [40, 43].

The negative effect of OP in the maturation medium was not limited to maturation and fertilization rates but also included subsequent embryonic development. There was a significant decrease in the percentage of embryos that reached the blastocyst stage at 8 dpi. This decrease was evident at a concentration lower than that shown to reduce the maturation rate (0.001 µg/ml). Furthermore, significantly lower numbers of cells were observed in embryos derived from all OP treatments. These results are of great concern, indicating that the effects of exposure to a toxicant during the maturation period might not be visible until later stages of development. Several of these findings suggest that exposure to low doses of certain chemicals at critical stages in organ development can result in abnormalities that lead to irreversible changes in the functioning of organ systems later in life. Furthermore, there is increasing concern that environmental pollution may have a negative impact on gamete growth and differentiation. The common thread in these diverse observations is that development can be affected by events that occur long before any defect is apparent.

The most widely investigated mechanism of action of OP is its ability to act as an estrogen mimic via the activation of estrogen receptors. In our in vitro model system, however, no direct relationship between the effects of OP on oocyte meiosis progression and developmental competence and the ability of OP to mimic the activity of natural estrogens was noted. The exposure to 17ß-estradiol during IVM did not adversely affect oocyte maturation and developmental competence at any stage but did induce a significant decrease in the expression of ER{alpha} and ERß transcripts and a significant upregulation of PR mRNA. In contrast, OP affected IVM and developmental competence by showing a markedly different gene expression fingerprint compared with 17ß-estradiol. OP exposure resulted in decreased ER{alpha} mRNA expression, but ERß and PR levels were not affected. Therefore a different dose-response relationship seems to exists for the toxic activity of OP and its ability to interfere with estrogen-related genes. These data are in agreement with the observation of Nair-Menon et al. [44] in murine splenocytes. In that system, OP negatively affected splenocyte survival, with no apparent ER-mediated effect. ER{alpha} mRNA downregulation was present only at low OP concentrations (0.001 and 0.0001 µg/ml) [44]. A discrepancy between toxic effect and hormonal mimicry has also been observed for other classes of xenoestrogens. Maggiolini et al. [45] found that low doses of the two phytoestrogens genistein and quercitin resulted in downregulation of the ER{alpha} in human breast cancer cells, whereas at higher concentrations both phytoestrogens exhibited a toxic activity completely independent of ER expression. Observations of nonlinear dose-response curves in recent years have been given great attention in toxicological studies. A wide range of specific mechanisms could account for this phenomenon. To date, nonlinear dose-response relationships have been discovered within several dozen receptor systems, but explanations that could account for this type of response are still considerably underresearched [46].

Because OP binds to ERs in other systems [47–49] and we have demonstrated that OP mimics the estrogen-mediated action of ER{alpha}, it remains possible that OP is capable of competing for binding to ERs in bovine COCs. Further studies are in progress to obtain a much larger data set on the mechanism of OP action during in vitro oocyte maturation.

In the present study we identified the bovine COC as a target tissue of OP, providing the first published information on the potential reproductive risk of exposure to alkylphenolic compounds in domestic ruminants. A key question in relation to the broader significance of these results is how the levels of OP in the environment relate to the concentration used in the present study. The answer to this question is confounded by two major problems. First, little information has been collected on the levels of OP in the environment. However, alkylphenolic compounds have been found in waterways throughout Europe and the United States [50, 51] in concentrations ranging from nanograms to milligrams per liter. Second, alkylphenols bioaccumulate in body fat [23, 24]. Toxicokinetic studies have suggested gender differences in OP biological disposition, indicating a shorter half-life of this compound in males than in females [52, 53]. Thus, although concentrations of alkylphenols in the environment may be low, significant concentrations may accumulate in the body and may be mobilized during fasting or under energetically expensive physiological conditions such as pregnancy or lactation [54]. Caution is needed when trying to extrapolate from results of in vitro assays to the effect on the entire living organism. Bioactivity in vivo, and thus the detrimental effect of endocrine system-disrupting chemicals, depends on several factors such as dose, resorption, metabolism, accumulation in specific tissues, binding affinity to transport proteins and receptors, and possible synergistic effects with other endocrine active substances. Nevertheless, when other than rodent models are chosen, in vivo experiments are expensive and time consuming. Thus, preliminary in vitro models utilizing oocytes of domestic animals might represent a useful alternative.

Exposure of bovine oocytes to OP during IVM inhibits the normal resumption of meiosis and subsequent developmental competence. In our in vitro system, OP was unable to reproduce the pattern of action of natural estrogen exposure at both the morphological and molecular level, suggesting that OP toxicity is not a direct result of estrogen mimicry. These findings add to a growing body of evidence supporting the concept that exposure to environmental contaminants, such as OP, may result in adverse effects on reproductive health. Here, we provide a set of reference data for the assessment of the risk posed by these substances. The biological relevance of these observations will depend on the levels of exposure of farm animals to OP and related substances, and establishment of the long-term harmful effects on ovarian function will be important future features in assessing the in vivo biological relevance of OP effects on ruminants reproductive physiology.


   ACKNOWLEDGMENTS
 
The authors thank Dr. Christine Lautenschläger for assistance in statistical interpretation of the results. The expert technical assistance of Mrs. Michaela Kirstein for the in vitro bovine embryo culture procedures also is sincerely appreciated.


   FOOTNOTES
 
1 This study was supported by the EU Marie Curie Fellowship Program grant QLK-CT-2000-52163. Back

2 Correspondence: Paola Pocar, Department of Anatomy and Cell Biology, Martin Luther University Halle-Wittenberg, Grosse Steinstrasse 52, D-06097 Halle (Saale), Germany. FAX: 49 345 557 1700; paola.pocar{at}medizin.uni-halle.de Back

Received: 15 August 2002.

First decision: 5 September 2002.

Accepted: 21 March 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Boerjan ML, Freijnagel S, Rhind SM, Meijer GAL. The potential reproductive effects of exposure of domestic ruminants to endocrine disrupting compounds. Anim Sci 2002 74:3-12
  2. Darwash AO, Lamming GE, Woolliams JA. The potential for identifying heritable endocrine parameters associated with fertility in post-partum dairy cows. Anim Sci 1999 68:333-347
  3. Colborn T, vom Saal FS, Soto AM. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect 1993 101:378-384[Medline]
  4. Bhatt RV. Environmental influence on reproductive health. Int J Gynaecol Obstet 2000 70:69-75[CrossRef][Medline]
  5. Cooper RL, Kavlock RJ. Endocrine disruptors and reproductive development: a weight-of-evidence overview. J Endocrinol 1997 152:159-166[Abstract]
  6. Guillette LJ Jr, Gross TS, Masson GR, Matter JM, Percival HF, Woodward AR. Developmental abnormalities of the gonad and abnormal sex hormone concentrations in juvenile alligators from contaminated and control lakes in Florida. Environ Health Perspect 1994 102:680-688[Medline]
  7. Faqi AS, Chahoud I. Antiestrogenic effects of low doses of 2,3,7,8-TCDD in offspring of female rats exposed throughout pregnancy and lactation. Bull Environ Contam Toxicol 1998 61:462-469[CrossRef][Medline]
  8. Akingbemi BT, Hardy MP. Oestrogenic and antiandrogenic chemicals in the environment: effects on male reproductive health. Ann Med 2001 33:391-403[Medline]
  9. Dodds EC, Lawson W. Molecular structure in relation to oestrogenic activity. Compounds without a phenanthrene nucleus. Proc R Soc Lond B 1938 125:222-232
  10. Mueller GC, Kim UH. Displacement of estradiol from estrogen receptors by simple alkylphenols. Endocrinology 1978 102:1429-1703[Abstract]
  11. Soto AM, Justicia H, Wray JW, Sonnenschein C. p-Nonyl-phenol: an estrogenic xenobiotic released from "modified" polystyrene. Environ Health Perspect 1991 92:167-173[Medline]
  12. Richtler HJ, Knaut J. World prospect for surfactants. In: Proceedings of the 2nd World Surfactants Conference; 1988; Paris, France. Pages 3–58
  13. [Anonymous]. Alkylphenol Ethoxylates in the Environment. Alkylphenol Ethoxylates Panel; Chemical Manufacturer's Association; 1994; Washington, DC
  14. Naylor CG, Mieure JP, Adams WJ, Weeks JA, Castaldi FJ, Ogle LD, Romano RR. Alkylphenol ethoxylates in the environment. J Am Oil Chem Soc 1992 69:695-703
  15. Ahel M, Conrad T, Giger W. Persistent organic chemicals in sewage effluents. 3. Determinations of nonylphenoxy carbolic acids by high-resolution gas chromatography/mass spectrometry and high-performance liquid chromatography. Environ Sci Technol 1987 21:697-703[CrossRef]
  16. Giger W, Ahel M, Koch M, Laubscher HU, Schaffner C, Schneider J. Behaviour of alkylphenol polaethoxylate surfactants and of nitriloacetate in sewage treatment. Water Sci Technol 1987 19:449-460
  17. Stephanou E, Giger W. Persistent organic chemicals in sewage effluents. 2. Quantitative determinations of nonylphenols and nonylphenol ethoxylates by glass capillary gas chromatography. Environ Sci Technol 1982 16:800-805[CrossRef]
  18. Ahel M, Giger W, Koch M. Behaviour of alkylphenol polyethoxylate surfactants in the aquatic environment. 1. Occurrence and transformation in sewage treatment. Water Res 1994 28:1131-1142[CrossRef]
  19. Ahel M, Giger W, Schaffner C. Behaviour of alkylphenol polyethoxylate surfactants in the aquatic environment. 2. Occurrence and transformation in rivers. Water Res 1994 28:1143-1152[CrossRef]
  20. Zoller U. Groundwater contamination by detergents and polycyclic aromatic hydrocarbons—a global problem of organic contaminants: is the solution locally specific?. Water Sci Technol 1993 27:187-194
  21. Ejlertsson J, Nilsson ML, Kylin H, Bergman Å, Karlson L, Öquist M, Svensson BH. Anaerobic degradation of nonylphenol mono- and diethoxylates in digestor sludge, landfill municipal solid waste, and landfilled sludge. Environ Sci Technol 1999 33:301-306
  22. Rudel RA, Melly SJ, Geno PW, Sun G, Brody JG. Identification of alkylphenols and other estrogenic phenolic compounds in wastewater, septage, and groundwater on Cape Cod, Massachussetts. Environ Sci Technol 1998 32:861-869[CrossRef]
  23. Ekelund R, Bergman A, Granmo A, Berggren M. Bioaccumulation of 4-nonylphenol in marine animals—a re-evaluation. Environ Pollut 1990 64:107-120
  24. Ahel M, Giger W. Partitioning of alkylphenol polyethxylates between water and organic solvents. Chemosphere 1993 28:1361-1368[CrossRef]
  25. Blake CA, Ashiru OA. Disruption of rat estrous cyclicity by the environmental estrogen 4-tert-octylphenol. Proc Soc Exp Biol Med 1997 216:446-451[Abstract]
  26. White R, Jobling S, Hoare SA, Sumpter JP, Parker MG. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 1994 135:175-182[Abstract]
  27. Nagel SC, vom Saal FS, Thayer KA, Dhar MG, Boechler M, Welshons WV. Relative binding affinity-serum modified access (RBA-SMA) assay predicts the relative in vivo bioactivity of the xenoestrogens bisphenol A and octylphenol. Environ Health Perspect 1997 105:70-76[Medline]
  28. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 1998 139:4252-4263[Abstract/Free Full Text]
  29. Katsuda S, Yoshida M, Isagawa S, Asagawa Y, Kuroda H, Watanabe T, Ando J, Takahashi M, Maekawa A. Dose- and treatment duration-related effects of p-tert-octylphenol on female rats. Reprod Toxicol 2000 14:119-126[CrossRef][Medline]
  30. Picton H, Siddiqui S, Chambers E, Briggs D, Sweeney T. Xenoestrogen exposure in utero disrupts folliculogenesis in foetal sheep ovary. J Reprod Fertil Abstr Ser 2000 25:19
  31. Eckert J, Tao T, Niemann H. Ratio of inner cell mass and trophoblastic cells in blastocysts derived from porcine 4- and 8-cell embryos and isolated blastomeres cultured in vitro in the presence or absence of protein and human leukemia inhibitory factor. Biol Reprod 1997 57:552-560[Abstract]
  32. Gandolfi F, Luciano AM, Modina S, Ponzini A, Pocar P, Armstrong DT, Lauria A. The in vitro developmental competence of bovine oocytes can be related to the morphology of the ovary. Theriogenology 1997 48:1153-1160
  33. Bavister BD, Leibfried ML, Lieberman G. Development of preimplantation embryos of the golden hamster in a defined culture medium. Biol Reprod 1983 28:235-247[Abstract]
  34. Bavister BD. A consistently successful procedure for in vitro fertilization of golden hamster eggs. Gamete Res 1989 23:139-158[CrossRef][Medline]
  35. Tervit HR, Whittingham DG, Rowson LEA. Successful culture in vitro of sheep and cattle ova. J Reprod Fertil 1972 30:493-497[Medline]
  36. Luciano AM, Pocar P, Milanesi E, Modina S, Rieger D, Lauria A, Gandolfi F. Effect of different levels of intracellular cAMP on the in vitro maturation of cattle oocytes and their subsequent development following in vitro fertilization. Mol Reprod Dev 1999 54:86-91[CrossRef][Medline]
  37. Hirshfield AN. Development of follicles in the mammalian ovary. Int Rev Cytol 1991 124:43-101[Medline]
  38. Richards JS. Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiol Rev 1980 60:51-89[Free Full Text]
  39. Crisp TM, Clegg ED, Cooper RL, Wood WP, Anderson DG, Baetcke KP, Hoffmann JL, Morrow MS, Rodier DJ, Schaeffer JE, Touart LW, Zeeman MG, Patel YM. Environmental endocrine disruption: an effects assessment and analysis. Environ Health Perspect 1998 106:suppl 111-56
  40. Katsuda S, Yoshida M, Watanabe G, Taya K, Maekawa A. Irreversible effects of neonatal exposure to p-tert-octylphenol on the reproductive tract in female rats. Toxicol Appl Pharmacol 2000 165:217-226[CrossRef][Medline]
  41. Xu J, Osuga Y, Yano T, Morita Y, Tang X, Fujiwara T, Takai Y, Matsumi H, Koga K, Taketani Y, Tsutsumi O. Bisphenol A induces apoptosis and G2-to-M arrest of ovarian granulosa cells. Biochem Biophys Res Commun 2002 292:456-462[CrossRef][Medline]
  42. Hafne AL, Byskov AG, Ynding-Larsen C, Tcerdal A. Response on spontaneous and induced maturation in vitro from estradiol, diethylstilbestrol and octylphenol in mouse oocytes. Theriogenology 2000 53:454
  43. Laws SC, Carey SA, Ferrell JM, Bodman GJ, Cooper RL. Estrogenic activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats. Toxicol Sci 2000 54:154-167[Abstract/Free Full Text]
  44. Nair-Menon JU, Campbell GT, McCoy GL, Blake CA. Interactions between estrogen, tamoxifen, octylphenol, and two polychlorinated biphenyls in murine splenocytes. Life Sci 1999 65:1125-1133[CrossRef][Medline]
  45. Maggiolini M, Bonofiglio D, Marsico S, Panno ML, Cenni B, Picard D, Ando S. Estrogen receptor alpha mediates the proliferative but not the cytotoxic dose-dependent effects of two major phytoestrogens on human breast cancer cells. Mol Pharmacol 2001 60:595-602[Abstract/Free Full Text]
  46. Calabrese EJ, Baldwin LA. Applications of hormesis in toxicology, risk assessment and chemotherapeutics. Trends Pharmacol Sci 2002 23:331-337[CrossRef][Medline]
  47. Sheeler CQ, Dudley MW, Khan SA. Environmental estrogens induce transcriptionally active estrogen receptor dimers in yeast: activity potentiated by the coactivator RIP140. Environ Health Perspect 2000 108:97-103[Medline]
  48. Tollefsen KE, Mathisen R, Stenersen J. Estrogen mimics bind with similar affinity and specificity to the hepatic estrogen receptor in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 2002 126:14-22[CrossRef][Medline]
  49. Kwack SJ, Kwon O, Kim HS, Kim SS, Kim SH, Sohn KH, Lee RD, Park CH, Jeung EB, An BS, Park KL. Comparative evaluation of alkylphenolic compounds on estrogenic activity in vitro and in vivo. J Toxicol Environ Health A 2002 65:419-431[CrossRef][Medline]
  50. Marcomini A, Pavoni B, Sfriso A, Orio AA. Persistent metabolites of alkylphenol polyethoxylates in the marine environment. Mar Chem 1990 29:307-323[CrossRef]
  51. Bennie DT, Sullivan CA, Lee HB, Peart TE, Maguire RJ. Occurrence of alkylphenols and alkylphenol mono- and diethoxylates in natural waters of the Laurentian Great Lakes Basin and the upper St. Lawrence River. Sci Total Environ 1997 193:263-275[CrossRef]
  52. Certa H, Fedtke N, Wiegand HJ, Muller AM, Bolt HM. Toxicokinetics of p-tert-octylphenol in male Wistar rats. Arch Toxicol 1996 71:112-122[CrossRef][Medline]
  53. Upmeier A, Degen GH, Schuhmacher US, Certa H, Bolt HM. Toxicokinetics of p-tert-octylphenol in female DA/Han rats after single i.v. and oral application. Arch Toxicol 1999 73:217-222[CrossRef][Medline]
  54. Bigsby RM, Caperell-Grant A, Madhukar BV. Xenobiotics released from fat during fasting produce estrogenic effects in ovariectomized mice. Cancer Res 1997 57:865-869[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
Z. Roth and P.J. Hansen
Sphingosine 1-Phosphate Protects Bovine Oocytes from Heat Shock During Maturation
Biol Reprod, December 1, 2004; 71(6): 2072 - 2078.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/2/462    most recent
biolreprod.102.010355v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.
Agricola
Right arrow Articles by Pocar, P.
Right arrow Articles by Fischer, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS