Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print May 14, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.016899
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/3/797    most recent
biolreprod.103.016899v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O'Shaughnessy, P.J.
Right arrow Articles by Johnston, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Shaughnessy, P.J.
Right arrow Articles by Johnston, H.
Agricola
Right arrow Articles by O'Shaughnessy, P.J.
Right arrow Articles by Johnston, H.
BIOLOGY OF REPRODUCTION 69, 797–808 (2003)
DOI: 10.1095/biolreprod.103.016899
© 2003 by the Society for the Study of Reproduction, Inc.


Testis

Identification of Developmentally Regulated Genes in the Somatic Cells of the Mouse Testis Using Serial Analysis of Gene Expression1

P.J. O'Shaughnessy2, L. Fleming, P.J. Baker, G. Jackson, and H. Johnston

Institute of Comparative Medicine, University of Glasgow Veterinary School, Glasgow, United Kingdom


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To identify genes developmentally regulated in the somatic cells of the testis, serial analysis of gene expression (SAGE) has been used to generate gene expression profiles from these cells in the fetal and adult mouse. To avoid germ cell transcripts, a fetal SAGE library was generated from germ cell-free fetal Wv/Wv mice, and an adult SAGE library was generated from adult testes depleted of germ cells with busulfan. The combined SAGE libraries contained 147 570 tags identifying 12 976 unique transcripts. Of these transcripts, 3607 were present in only the fetal library and 3941 were present in only the adult library. Most of the abundant differentially expressed tags in the adult testis library were from characterized genes, whereas 3' rapid amplification of complementary ends was required to identify most differentially expressed tags in the fetal library. These fetal tags were mostly associated with uncharacterized UniGene clusters. These data provide a comprehensive and quantitative analysis of gene expression in the somatic cells of the fetal and adult testis (including unknown transcripts) and identify genes differentially expressed in these cells during testis development. These differentially regulated genes are likely to provide insight into mechanisms regulating testis function both during development and in the adult animal.

developmental biology, gene regulation, Leydig cells, Sertoli cells, testis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During fetal growth in the mouse, the testes start to develop from the urogenital ridge around 10.5 days postcoitum (dpc) and are morphologically distinct by about 12 dpc. Initially, testis development depends upon Sry induction of Sertoli cell differentiation from migrating coelomic epithelial cells [1, 2], followed by the appearance of active fetal Leydig cells at about 12.5 dpc in the developing interstitial region. Differentiation of the male reproductive tract and descent of the testis is ensured during fetal development by Sertoli cell secretion of anti-Mullerian hormone (AMH) and Leydig cell secretion of androgen and insulin-like growth factor (IGF) 3 [3, 4]. The Sertoli cells also produce kit ligand, which is essential for germ cell survival and proliferation in the fetal testis [5]. After birth, the gonocytes differentiate into spermatagonia, and under the regulation of the Sertoli cells spermatogenesis begins, leading to the formation of mature spermatozoa after puberty. A second, adult population of Leydig cells differentiates shortly before puberty and gives rise to the pubertal surge in androgen production necessary to induce and maintain fertility, male sexual characteristics, and male behavior [6].

Functionally the somatic cells of the fetal and adult testes show some similarities (e.g., androgen production) but are more clearly characterized by differences in cell activity and function. Thus, the functions of the Sertoli cells in the fetal testis include maintenance of the gonocytes and ablation of the Mullerian duct, whereas in the adult the Sertoli cells act to maintain and stimulate spermatogenesis. These functional differences between fetal and adult Sertoli cells are also associated with clear differences in gene expression between the cells (e.g., Claudin 11 [7] and Amh [8]). The Sertoli cells probably also act to regulate differentiation and maintenance of the Leydig cells, but the mechanisms involved probably differ between the fetal and adult populations of Leydig cells [9, 10]. The Leydig cells in both fetal and adult testes function primarily to produce androgens, but the fetal and adult populations of cells are distinct and show fundamental differences in activity and function [11, 12].

Although the overall functions of the Sertoli cells and Leydig cells are understood, developmental changes in cell activity and cell function and the mechanisms underlying these changes remain unclear in many cases despite clear evidence that problems in male reproductive health can have a fetal origin [13]. As a step toward understanding somatic cell function in the testis, we have generated a full analysis of gene expression in the somatic cells of the adult and fetal testis using serial analysis of gene expression (SAGE) [14]. This technique allows a comprehensive quantification and identification of genes present in a cell or tissue without bias toward previously described sequences. Moreover, SAGE databases can be compared directly, which allows identification of genes expressed differentially during development in the testis.

One problem with identifying somatic gene expression in the testis is that in the adult >95% of testicular cells are of germ cell origin [15]. Thus, a SAGE library generated from a normal adult testis will predominantly contain genes derived from the germ cell population. To avoid this problem, we have generated SAGE libraries from mouse models that lack germ cells. The adult testis library was derived from adult mice in which the germ cell population was ablated using busulfan [16], and the fetal testis library was derived from Wv/Wv mice, which lack germ cells because of a mutation in the c-kit receptor [5].


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Treatments

The mice used in this study were bred at the University of Glasgow Veterinary School and were maintained as required under United Kingdom Home Office regulations. Normal and Wv/Wv mice, bred on a C3H/Heh-101/H genetic background, were derived from stock animals originally obtained from the MRC Radiobiology Unit (now the MRC, Mammalian Genetics Unit, Harwell, U.K.). To time fetal development Wv/+ males were caged with Wv/+ females overnight, and the morning was designated as Fetal Day 0.5 of pregnancy. Fetuses were collected at Day 18 of pregnancy, and Wv/Wv mice were identified by their lighter skin color. To ablate the germ cell population in adult normal mice, the animals were given a single i.p. injection of busulfan (30 mg/kg; Sigma Chemical Co., Poole, U.K.) in dimethyl sulfoxide/H2O (1/1 v/v) and killed up to 60 days later. For both fetal and adult animals, one testis from each animal was stored frozen in liquid N2, and the other testis was fixed overnight in Bouin fluid before being stored in 70% ethanol.

Construction of SAGE Libraries

The RNA from adult or fetal testes was extracted using TRIzol reagent (Invitrogen, Paisley, U.K.). The SAGE libraries were constructed from RNA pooled from four testes of four different adult or fetal mice. Poly(A)+ RNA was isolated using Oligo dT Cellulose (Invitrogen). The SAGE libraries were constructed as previously described [14] with modifications, including use of biotinylated phosphorothioate oligo-dT [17] for first-strand synthesis and use of a combined blunting/ligation kit (Takara Biomedicals, BioWhittaker U.K., Wokingham, U.K.). The ditags were amplified in two stages of 22 cycles [14] and 10 cycles using nested biotinylated primers. Concatemers were cloned into the SphI site of pZero (Invitrogen) at 16°C overnight and transfected into ElectroMax DH10B cells (Invitrogen). Selected clones were amplified by polymerase chain reaction (PCR) and sequenced directly as previously described [17].

SAGE Data Analysis

Tags were extracted from sequence data and initially analyzed using SAGE 2000 software (http://www.sagenet.org/sage_protocol.htm), which converted the tag information to a Microsoft Acces file. The mouse SAGEmap database was downloaded from http://www.ncbi.nlm.nih.gov/SAGE/ and converted to an Access file allowing direct comparison with tag sequences extracted through SAGE 2000 software, allowing tags to be matched to known UniGene clusters [18]. Differences in tag frequency between SAGE libraries were analyzed using the chi-square test [19].

The original SAGE data from each library have been deposited in the NCBI public gene expression database (http://www.ncbi.nlm.nih.gov/geo/), accession numbers GSM5435 and GSM5436.

Rapid Amplification of Complementary Ends

For a number of tags, it was necessary to generate 3' sequence to allow identification of the mRNA species from which the tag was derived. This was done using a 3' rapid amplification of complementary ends (RACE) technique similar to that described previously [20] but using TTCTAGAATTCAGCGGCCGC(T)30(AGC)(AGCT) to prime the reverse transcription.

Real-Time PCR

Levels of specific mRNA species were measured by real-time PCR using the TaqMan PCR method following reverse transcription of isolated RNA [11]. The fetal and adult testes used to extract RNA were from the same group used to provide RNA for generation of the SAGE libraries. The sequences of primers and probes used for real-time PCR were as previously described [11] and as shown in Table 1. The quantity of each measured cDNA was determined relative to the endogenous ubiquitous gene Wbscr1 [11], and results are presented as the ratio of expression in adult and fetal testes.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Sequences of primers/probes used in this study

Histology and Stereology

Testes for histology or stereology were fixed in Bouin fixitive and stored in 70% ethanol. Testes were embedded in Technovit 7100 resin (Kulzer and Co., Wehrheim, Germany), cut into 20-µm-thick sections, and stained with Harris hematoxylin. In testes used to count total Sertoli and Leydig cell number, testis volume was estimated using the Cavalieri principle [21], and the slides used to estimate the number of cells were also used to estimate testis volume. The optical dissector technique [22] was used to count the number of Leydig cells and Sertoli cells in each testis. The numerical cell density was estimated using an Olympus BX50 microscope fitted with a motorized stage (Prior Scientific Instruments, Cambridge, U.K.) and Stereologer software (Systems Planning Analysis, Alexandria, VA).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissues Used to Generate Libraries

In most testes from Wv/Wv fetuses, the gonocytes were either absent or present in very low numbers (Fig. 1, A and B). In about 12% of animals, gonocytes were seen frequently in tissue sections, and these animals were not used in generation of the fetal testis SAGE library. In adult animals, a single injection of busulfan caused testis weight to decline to about 30% of normal over a 60-day period. On Day 20 after busulfan treatment, the seminiferous tubules largely contained only Sertoli cells and spermatozoa, and on Days 40 and 60 after treatment, tubules were largely devoid of germ cells (Fig. 1, C and D). The total numbers of Leydig cells and Sertoli cells per testis were not significantly different from those of control animals 60 days after busulfan treatment. Testes from this 60-day treatment group were used to prepare the adult testis SAGE library.



View larger version (123K):
[in this window]
[in a new window]
 
FIG. 1. Morphology of germ cell-free mouse testes. A) Normal embryonic Day 18 testis. B) Embryonic Day 18 testes from Wv/Wv mice lacking gonocytes. C) Normal adult control testis. D) Testis from normal adult 60 days after single injection of busulfan (30 mg/kg). Bars = 40 µm

SAGE Libraries

The number of tags sequenced in each library, after removal of duplicate ditags, was 81977 in the adult testis library and 65593 in the fetal testis library. The combined total of 147570 tags contained 59464 unique tag sequences, of which 46488 were represented by a single tag. The remaining 12976 tag sequences made up 68.5% of the total tag number. Of these 12976 sequences, 5430 were present in both fetal and adult libraries, 3607 were present only in the fetal library, and 3941 were present only in the adult library.

Ubiquitous Genes

To ensure that the libraries were comparable in terms of gene expression, the number of tags in each library representing a series of known ubiquitous genes was compared. The genes chosen were those shown previously to have the least variation in tag number in a variety of human SAGE libraries [23]. For ease of comparison, the most abundant ribosomal genes showing the least variation in human SAGE libraries [23] were selected for study along with human gene KIAA0038 (mouse Wbscr1), which shows the highest consistency of expression across human SAGE libraries [23]. Of the nine genes compared, only three showed a significant difference in abundance between the fetal and adult libraries (Table 2); in only one gene (L29) was there a >2-fold difference in tag frequency between libraries.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Ubiquitous transcripts

Frequent Tags

The 30 most common tags in the adult testis library are shown in Table 3. Seven of the tags on this list are from the mitochondrial genome, four encode ribosomal proteins, and one matches to more than one gene. The remaining tags match to known genes, many of which have been shown to be highly expressed in the adult testis.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Most common tags in adult testis library

The 30 most common tags in the fetal testis library are listed in Table 4. Three of these tags are mitochondrial, and eight are ribosomal. Unlike the adult testis library, nine of the remaining tags were unknown, had multiple matches, or matched only to expressed sequence tags (ESTs). Tags with multiple matches or with no reliable map were used to generate 3' RACE data to help identify a reliable match, as indicated in Table 4. This approach was successful in assigning a match to most tags, with the exceptions of AACATACAAG, for which the 3' RACE sequence matched to numerous ESTs and UniGene clusters, and ATTTTCAGTT, because the tag sequence (without the NlaIII recognition site) is present at the 3' end of the Sentrin gene and all RACE sequence recovered was from this gene.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Most common tags in fetal testis library

Cell-Specific and Functional Groups

Table 5 shows selected tags that represent genes known to be expressed in the Leydig cells or Sertoli cells or that are linked with established functional groups. Tags representing most of the listed Sertoli cell-specific transcripts (Table 5A) were expressed at a higher frequency in the adult testis library than in the fetal testis library, while other tags, such as cystatin 9, cystatin-SC, claudin 11, tissue plasminogen activator, and transferrin, were barely or not expressed in the fetal testis library. A number of tags (epidermal fatty acid binding protein 5, clusterin, prosaposin, connexin 43, kit ligand, and testis defensin-like gene [Tdl]) were present at a high frequency in the fetal testis, although in each case tag frequency was higher in the adult. AMH was the only transcript present in the fetal testis library but not in the adult library (Table 5A).


View this table:
[in this window]
[in a new window]
 
TABLE 5. Tags associated with specific cells or functional groups


View this table:
[in this window]
[in a new window]
 
TABLE 5. Continued

Tags representing most known Leydig cell-specific transcripts are present at a markedly higher frequency in the adult library than in the fetal library (Table 5B). The exceptions were 3ß-hydroxysteroid dehydrogenase (3ßHSD) I, which was present at a higher frequency in the fetal library, cytochrome P450 side chain cleavage (P450scc), which was expressed at similar levels in both libraries, and LH receptor, which was expressed at low levels in both libraries. Tags representing 3ßHSD VI and estrogen sulfotransferase were present in the adult library only.

The list of tags representing gene transcripts involved in steroid production (Table 5C) includes a number of transcripts, such as P450scc and 3ßHSD VI, that are known to be specific to the Leydig cells (and thus also appear in Table 5B). However, many other transcripts are also present that have not previously been shown to be expressed in the testis or not specifically in the Leydig cells. These other transcripts include scavenger receptor B1, which is expressed in both Sertoli cells and Leydig cells [24, 25], and a number of members of the 17ß-hydoxysteroid dehydrogenase family whose function within the testis is unknown. With the exception again of 3ßHSD I, these tags were more highly expressed in the adult testis library.

Tables 5D and 5E list known tags representing growth factors and hormone and growth factor receptors. Most growth factors were expressed in both adult and fetal libraries, although there was apparent differential expression of some factors such as growth arrest specific (GAS) 6, which was higher in the adult testis library, and connective tissue growth factor and Wnt 5A, which were higher in the fetal library (Table 5D). Most of the hormone and growth factor receptors showed differential expression between libraries (Table 5E). The more highly expressed receptors such as AMH type II tended to be more highly expressed in the adult library, the main exception being the pheromone receptor V3R4, which showed markedly greater expression in the fetal library. Receptors expressed at lower levels were either predominantly in the adult library (e.g., prolactin receptor) or predominantly in the fetal library (e.g., IGF2 receptor).

A number of transcripts encoding known extracellular matrix (ECM) components are listed in Table 5F. The list is dominated by procollagen species, most of which show clear differential expression between fetal and adult testis libraries. Of the other factors listed, decorin, laminins, and fibronectin were differentially expressed between libraries.

Comparison of Data Generated by SAGE and by Real-Time PCR

To confirm that differerences in tag expression between adult and fetal SAGE libraries reflect differences in mRNA levels in the two tissues, real-time PCR was used to measure relative mRNA levels. Testes from fetal Wv/Wv mice and adult busulfan-treated mice were used to prepare cDNA, which was subjected to real-time PCR using specific primer/probe combinations as described in Materials and Methods. The ratio of expression in adult and fetal testes was determined and compared with that from the SAGE libraries. Data obtained by real-time PCR correlated well with data derived from the SAGE libraries (Fig. 2).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. Comparison of SAGE and real-time PCR data. The relative expression levels of specific mRNA species were determined in fetal and adult testes using real-time PCR or SAGE. Values are expressed as the ratio of expression levels in adult testes compared with fetal testes. Real-time PCR data shows the mean ratio of quadruplicate adult and fetal samples, and SAGE data come from information given in Table 4. tPA, Tissue plaminogen activator; ABP, androgen-binding protein; FABP, epidermal fatty acid binding protein 5; Cys-TE, cystatin-TE

Abundant Tags Differentially Expressed Between Libraries

To screen for tags differentially expressed in the adult testis library, we identified those tags with both a >=10-fold frequency in the adult library and an abundance of five or more (in the adult library). The total number of tags identified in this way was 1193. If enrichment criterion in the adult library was reduced to 5-fold, the total number of tags identified was 1643. The baseline of five tags in the adult library was the minimum that would produce a significant differences between adult and fetal libraries. Table 6 shows the most abundant tags that fulfil the criterion of 10-fold difference. Most of the tags listed matched unambiguously to known genes. Two of the listed tags either had no match (GATTCTTGAG) or matched only to ESTs (TAAGTAGCAA), and mappings were confirmed by 3' RACE. Many of the transcripts listed in this table are known to be developmentally expressed in the testis, e.g., IGF3, prostaglandin (PG) D2 synthase, vascular cell adhesion molecule (VCAM), 3ßHSD VI, and claudin 11 [11, 2628].


View this table:
[in this window]
[in a new window]
 
TABLE 6. Abundant tags with 10-fold higher frequency in adult testis library

Similar criteria were used to identify tags differentially expressed in the fetal library, except that the baseline used was reduced to a minimum of three tags in the fetal library (and none in the adult library), the minimum number that would generate a significant difference between libraries. The number of tags in the fetal library that showed a 10-fold difference in expression compared with the adult library was 920. When a 5-fold difference was used as the cutoff, the number of tags increased to 965. Table 7 shows the most abundant tags that fulfill the criterion of a 10-fold difference. Most of the tags in this list were matched only to ESTs, had multiple matches, or had no known match in the mouse SAGEmap database. For 14 tags where no reliable mapping could be made, tags were used to generate 3' RACE sequence with which to identify a reliable map where possible (Table 7). The 3' RACE technique was successful in assigning tags in most cases. Two of the tags (TAGAGACTGC and GAAGGAGTTA) that showed multiple mapping in SAGEmap were shown by 3' RACE to be derived from the same repeat element. Which tag appeared at the 3' end of the repeat sequence in any one gene depended on the degree of sequence conservation of the NlaIII sites. Multiple products were obtained for both tags using the 3' RACE method, and further identification was not made. In total, incorporating the 3' RACE data, 18 tags were assigned to a UniGene cluster, 7 remained unknown, and 3 could be matched to ESTs but not to a known UniGene cluster.


View this table:
[in this window]
[in a new window]
 
TABLE 7. Abundant tags with 10-fold higher frequency in fetal testis library

Comparison with Other SAGE Libraries

To identify transcripts in the testis libraries not present in other SAGE libraries, the combined testis libraries were queried against the 11 currently available mouse SAGE libraries from other tissues. The libraries queried were a 3T3 cell library (http://www.sagenet.org/SAGEData/3T3.htm), a kidney library (http://www-dsv.cea.fr/thema/get/PNAS-99/Data-1/ltag.html) [29], a combined T-cell library (http://www.immunobiology.umds.ac.uk/SAGE) [17], a combined brain library [30], and six mouse libraries available through Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov.geo) with accession numbers GSM55 and GSM56 (developing limb), GSM580 (stem cells), GSM766 (medullablastoma), and GSM767, GSM787, and GSM788 (granule cells). The combined number of tags in this pooled nontestis library was 935 258, representing 137 535 unique transcripts of which 53 806 were represented by >1 tag. Comparison of the combined testis libraries with the pooled SAGE libraries identified 3340 transcripts present only in the testis libraries and with >=2 tags. Table 8 lists 20 of the most abundant transcripts present only in the testis libraries. Most of the tags on this list are differentially expressed in the fetal and adult libraries, and several appear in Tables 6 and 7. Of the tags listed, 15 could be assigned to a UniGene cluster, but the remainder were either unknown or could be assigned only to ESTs. Where an expression pattern is known, the genes listed have been shown previously to be restricted to a small number of tissues or to the testis alone.


View this table:
[in this window]
[in a new window]
 
TABLE 8. Most frequent tags in testis library not appearing in other mouse SAGE libraries


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we used the SAGE technique to study gene expression profiles in the somatic cells of the fetal and adult mouse testis. While the raw data provide insights into the patterns of gene expression in these tissues, SAGE libraries can also be compared directly to identify genes differentially expressed during testis development. In addition, SAGE libraries generated from the testis can be compared directly with SAGE libraries from other tissues to identify tissue-specific gene expression. After comparing fetal and adult testis SAGE libraries, a total of 7548 transcripts were identified as being uniquely expressed in either the adult or fetal testis libraries. Here, we report only a small number of these transcripts; the remainder can be identified through the original SAGE data (http://www.ncbi.nlm.nih.gov/geo/ accession numbers GSM5435 and GSM5436).

In the SAGE analysis reported here, an essential component was the use of germ cell-free testes to prevent the libraries from being dominated by tags generated from transcripts derived from the germ cell population. This difference can be seen if comparison is made between the adult testis SAGE library and NCBI UniGene library 293, which contains 37 793 EST sequences (representing 11 175 genes) from the whole adult mouse testis (http://www.ncbi.nlm.nih.gov/UniGene/lib.cgi?ORG=Mm&LID=293). Of the genes in the EST library, >60% are not present in the SAGE library. Taking into account that ubiquitous genes will be in both libraries, this difference shows that a SAGE library of the normal testis would be dominated by tags relating to the germ cell compartment. In rats, busulfan treatment of the mother will destroy the gonocytes in the developing fetuses [31], but equivalent treatment was not effective in the mouse. Consequently, the Wv/Wv mouse was used to generate germ cell-free fetal testes. The Wv mutation is caused by an amino acid substitution in c-kit, which reduces receptor kinase activity. This reduced activity is enough to severely deplete the germ cell population in most animals without affecting overall viability [32].

Although ablation of the germ cells was necessary to generate SAGE libraries of the somatic cells of the testis, loss of germ cells is likely to affect Sertoli cell activity in these animals [33, 34]. This altered activity in turn may affect Leydig cell activity [10], although Leydig cell number was not affected and circulating androgen levels were unchanged by busulfan treatment [35]. Thus, a caveat for the data reported here is that expression levels for particular genes may be altered by ablation of the germ cell compartment. Nevetheless, this study provides a valuable database of testicular gene expression that can be used as a basis for further studies of testicular development and control.

The lists of frequent tags in the adult and fetal libraries (Tables 3 and 4) were, as expected, dominated by ubiquitous transcripts. Nevertheless, the most frequent tags in the adult testis library included many, such as IGF3, cytochrome P450c17, clusterin, cystatin C, and PGD synthase, which are known to be highly expressed in the adult testis [11, 36]. In the fetal testis, in contrast, most tags that were not derived from ubiquitous genes were either unknown or were from UniGene clusters of unknown function. From these data and from the list of tags differentially expressed in the fetal testis, it is clear that the major transcripts expressed in the somatic cells of the fetal testis are either novel or are of unknown function.

Of the known Sertoli cell transcripts (Table 5A), most were expressed more frequently in the adult library than in the fetal library, which might be expected because a number of these genes are likely to be involved directly in spermatogenesis. The most frequent Sertoli cell tags in the adult library were clusterin and prosposin, which are the most abundant proteins secreted by Sertoli cells [37]. The most frequent tag in the fetal testis library that is known to be of Sertoli cell origin is Tdl, which is expressed in the fetal/neonatal testis and the adult testis [38]. Clusterin and prosaposin were also relatively highly expressed in the fetal testis, as was connexin 43, although this gap junction protein is also expressed in Leydig cells, which may account for some of the high tag frequencies measured [39].

The most abundant tag present in the list of known Leydig cell transcripts (and the most abundant tag overall in either library) was IGF3, which is highly expressed in the Leydig cell [40]. In general, tag frequency of the known Leydig cell transcripts was markedly higher in the adult library than in the fetal library, although the steroidogenic enzymes required for androgen synthesis (P450scc, 3ßHSD I, and P450c17) are all expressed at relatively high levels in the fetal testis. Four specific markers of the adult population of Leydig cells have been identified [11], and two of these (3ßHSD VI and estrogen sulfotransferase) were, as expected, only expressed in the adult library. The other two markers, 17ßHSD III and PGD synthase, showed expression in the fetal testis, but this expression is due to expression in the fetal tubulues [12, 27]. PGD synthase is represented by two tags in Table 5B because alternative splicing of the PGD synthase gene generates two different mRNA species with a different 3' end [27].

The list of genes involved in steroidogenesis (Table 5C) includes all major enzymes involved in androgen biosynthesis and, in addition, a relatively large number of different 17ßHSD genes. The type III enzyme, expressed in the Leydig cells of the adult animal, is the only one required for testosterone synthesis in the testis [41], although both 17-ketosteroid reductase and 17ßHSD activity have been found in the seminiferous tubules [12, 42], which may account for the presence of other members of this family. Both adult and fetal libraries contained relatively high levels of the scavenger receptor class B1 (SR-B1), which mediates intracellular delivery of cholesterol from high-density lipoprotein to act as substrate for steroid synthesis [43]. SR-B1 may also play a role in Sertoli cell phagocytosis in the adult animal [44]. There were also high levels of steroidogenic acute regulatory (StAR) protein in the adult library, with significantly lower levels in the fetal library. This protein is required for cholesterol movement into the mitochondrion and is the rate-limiting step in steroid synthesis [45]. Studies using StAR-null mice have revealed that the fetal testes are capable of a limited amount of androgen synthesis [46], suggesting that StAR-independent steroidogenesis can occur in the fetal Leydig cells. This scenario would be consistent with lower levels of StAR expression in the fetal testis library.

Most growth factors listed in Table 5D did not show marked differential expression between adult and fetal libraries, with only GAS 6, connective tissue growth factor (CTGF), and Wnt 5A showing a significant difference. GAS 6 was the dominant growth factor expressed in the adult library and has been reported to be an essential regulator of spermatogenesis [47]. Both CTGF and Wnt 5A were expressed in only the fetal testis, suggesting that these factors may have a specific role in testicular development. There was clearer differential expression of growth factor and hormone receptors (Table 5E). AMH receptor II showed the highest expression in the adult library, consistent with previous reports of high expression in adult rat Sertoli cells [48]. Other receptors highly expressed in the adult library but not in the fetal library included the natriuretic peptide receptor and the leptin receptor. Natriuretic peptide has been shown previously to have a regulatory effect on Leydig cell steroidogenesis [49], while leptin receptors have been shown to be present on both Leydig cells and Sertoli cells [50]. In the fetal testis library, pheromone receptor V3R4 showed the highest expression, although the function of this receptor in reproductive tissues is not clear. The receptor for platelet-derived growth factor {alpha} was also highly expressed in the fetal library, and this factor is required for adult Leydig cell differentiation [51]. There was considerable variation in expression of ECM components between fetal and adult libraries (Table 5F). Both Sertoli cells and Leydig cells have been reported to express components of the ECM [52, 53], and differences between fetal and adult libraries will reflect, at least in part, changes in the activity of these cells during development. ECM components also can influence the activity of these cells [54], and developmental changes in ECM expression may play a role in regulation of somatic cell activity.

The list of abundant tags differentially expressed in the adult testis library (Table 6) was largely made up of characterized transcripts, many of which have been identified as expressed mainly or exclusively in the adult testis (e.g., PGD synthase, VCAM, 3ßHSD VI, clusterin, prosaposin cystatin C, cystatin TE, claudin 11, and cystatin 9) [11, 28, 37, 5557]. Two tags listed in the differentially expressed adult library had no reliable mapping in SAGEmap, and the 3' RACE technique [20] was used to generate more information on these tags. One tag (TATAGTATGT) was mapped to glutamine synthase, and the other (GATTCTTGAG) was mapped to four ESTs. A preliminary identification of these ESTs suggests that these tags belong to a member of the ß-defensin family. Glutamine synthase is present in all available mouse SAGE libraries, but the tag numbers (tags per million) are an order of magnitude lower than those in the adult testis library. In the testis, glutamine synthase is primarily located in the Leydig cells [58], and the markedly higher expression in the adult testis suggests that this enzyme is associated specifically with the adult population of Leydig cells. Other transcripts identified by these studies as being highly expressed in the adult testis include angiotensinogen and betaine-homocysteine methyltransferase. The presence of renin in the testis has been reported previously [59], and tags representing renin 2 are present in both the adult and fetal SAGE libraries (data not shown), which indicates the possible presence of an active renin/angiotensin system in the testis. Betaine-homocysteine methyltransferase is primarily expressed in the liver [60], but data from the UniGene cluster confirm that the testes are also a site of expression. The cellular localization and role of this enzyme in testicular function are not known.

The most frequent tags differentially expressed in the fetal testis library (Table 7) were dominated by those with no reliable mapping in SAGEmap or with multiple mappings. Use of 3' RACE was successful in identifying a number of these tags, although problems arose when the tags were part of a repeat element. It will be necessary to use a 5' RACE technique to identify these tags. Most of the tags in the differentially expressed fetal library were linked to UniGene clusters that contain only uncharacterized ESTs. Further study of these clusters is needed because their abundant differential expression in the fetal testis suggests that they have a specific role within this stage of testis development.

The proportions of different somatic cell types change in the testis from the fetal/neonatal period to adulthood. In the absence of germ cells, the testis will contain Sertoli cells, Leydig cells, mesenchymal cells, endothelial and lymphatic cells, myoid cells, macrophages, and fibroblasts. In the adult, the Sertoli cells and Leydig cells make up about 75% of the somatic cells of the testis [61, 62] and would be expected to dominate genes identified within the SAGE library, especially because no other single cell type makes up >10% of total cell number. Nevertheless, other cells will contribute to the adult SAGE library, particularly the myoid cells, which is the third largest cell group after germ cell ablation [61]. Contributions from the myoid cells and other cells would be most likely to affect the low-medium and low abundance tags in the SAGE library. In the fetus, in contrast, the Sertoli cells and Leydig cells make up around 45% of the total somatic cell number, whereas the contribution from mesenchymal cells to the SAGE library will be significant. Individually, the Sertoli cells, as a percentage of overall somatic cell number, increase from around 35% in the late fetal testis to about 50% in the adult testis, whereas Leydig cells increase from about 8% to around 25%. Thus, part of the apparent increase in Sertoli cell and Leydig cell gene expression outlined in Table 4 is due to the increased relative number of these cells.

One of the main strengths of the SAGE technique is that libraries from different tissues can be compared directly. There are currently 11 mouse SAGE libraries available for comparison, which means that the number of tissues represented is limited, but tags present only in the testis libraries must show at least some specificity of expression. Of the 20 tags shown in Table 8, 9 (45%) could be reliable assigned to characterized transcripts, and of these, 5 (Tdl, 3ßHSD VI, cystatin-TE, cystatin 9, and 17ßHSD III) have a highly limited expression pattern that includes the testis [38, 57, 63, 64]. Three of the remaining four transcripts (AMH receptor, P450c17, and P450scc) are expressed in the testis and have a restricted pattern of expression in other tissues. The forth transcript (synaptogamin) is more widely expressed, but the tag representing it in the testis libraries is likely to be from a shortened alternative transcript because it is not from the most downstream NlaIII site in the full-length transcript but matches a number of ESTs derived from the 5' end of the gene. Alternatively, the tag may be derived from an unknown gene that is not represented in the SAGEmap database. The remaining tags in Table 8 are mapped to uncharacterized UniGene clusters or ESTs or have no match in the SAGEmap database. Because a number of these tags also show differential expression between the fetal and adult testis libraries, they are clearly worth further characterization.

The aims of this study have been to generate a database of genes expressed in the somatic cells of the testis and to identify genes differentially expressed during development. The data have allowed us to identify a number of differentially expressed novel transcripts and will serve as a baseline for studying changes in testicular gene expression during development or under altered states of physiological control.


    FOOTNOTES
 
1 This study was supported by the Wellcome Trust and the Biotechnology and Biological Sciences Research Council. Back

2 Correspondence: P.J. O'Shaughnessy, Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Rd, Glasgow G61 1QH, UK. FAX: 44 141 330 5797; p.j.oshaughnessy{at}vet.gla.ac.uk Back

Received: 6 March 2003.

First decision: 27 March 2003.

Accepted: 30 April 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Karl J, Capel B. Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev Biol 1998 203:323-333[CrossRef][Medline]
  2. Palmer SJ, Burgoyne PS. In situ analysis of fetal, prepuberal and adult XX/XY chimeric mouse testes—Sertoli cells are predominantly, but not exclusively, XY. Development 1991 112:265-268[Abstract]
  3. Jost A, Vigier B, Prepin J, Perchellet J. Studies on sex differentiation in mammals. Recent Prog Horm Res 1973 29:1-41
  4. Nef S, Parada LF. Cryptorchidism in mice mutant for Insl3. Nat Genet 1999 22:295-299[CrossRef][Medline]
  5. Motro B, van der Kooy D, Rossant J, Reith A, Bernstein A. Contiguous patterns of c-kit and steel expression: analysis of mutations at the W and Sl locus. Development 1991 113:1207-1221[Abstract]
  6. Habert R, Lejeune H, Saez JM. Origin, differentiation and regulation of fetal and adult Leydig cells. Mol Cell Endocrinol 2001 179:47-74[CrossRef][Medline]
  7. Hellani A, Ji J, Mauduit C, Deschildre C, Tabone E, Benahmed M. Developmental and hormonal regulation of the expression of oligodendrocyte-specific protein/claudin 11 in mouse testis. Endocrinology 2000 141:3012-3019[Abstract/Free Full Text]
  8. Munsterberg A, Lovell-Badge R. Expression of the mouse anti-Mullerian hormone gene suggests a role in both male and female sexual differentiation. Development 1991 113:613-624[Abstract]
  9. Yao HH, Whoriskey W, Capel B. Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes Dev 2002 16:1433-1440[Abstract/Free Full Text]
  10. Russell LD, Warren J, Debeljuk L, Richardson LL, Mahar PL, Waymire KG, Amy SP, Ross AJ, MacGregor GR. Spermatogenesis in Bclw-deficient mice. Biol Reprod 2001 65:318-332[Abstract/Free Full Text]
  11. O'Shaughnessy PJ, Willerton L, Baker PJ. Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 2002 66:966-975[Abstract/Free Full Text]
  12. O'Shaughnessy PJ, Baker PJ, Heikkila M, Vainio S, McMahon AP. Localization of 17ß-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis—androstenedione is the major androgen secreted by fetal/neonatal Leydig cells. Endocrinology 2000 141:2631-2637[Abstract/Free Full Text]
  13. Sharpe RM. Hormones and testis development and the possible adverse effects of environmental chemicals. Toxicol Lett 2001 120:221-232[CrossRef][Medline]
  14. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW. Serial analysis of gene expression. Science 1995 270:484-487[Abstract/Free Full Text]
  15. Wreford NG, Rajendra Kumar T, Matzuk MM, de Kretser DM. Analysis of the testicular phenotype of the follicle-stimulating hormone beta-subunit knockout and the activin type II receptor knockout mice by stereological analysis. Endocrinology 2001 142:2916-2920[Abstract/Free Full Text]
  16. Bucci LR, Meistrich ML. Effects of busulfan on murine spermatogenesis: cytotoxicity, sterility, sperm abnormalities, and dominant lethal mutations. Mutat Res 1987 176:259-268[CrossRef][Medline]
  17. Shires J, Theodoridis E, Hayday AC. Biological insights into TCRgammadelta+ and TCRalphabeta+ intraepithelial lymphocytes provided by serial analysis of gene expression (SAGE). Immunity 2001 15:419-434[CrossRef][Medline]
  18. Lal A, Lash AE, Altschul SF, Velculescu V, Zhang L, McLendon RE, Marra MA, Prange C, Morin PJ, Polyak K, Papadopoulos N, Vogelstein B, Kinzler KW, Strausberg RL, Riggins GJ. A public database for gene expression in human cancers. Cancer Res 1999 59:5403-5407[Abstract/Free Full Text]
  19. Man MZ, Wang X, Wang Y. POWER_SAGE: comparing statistical tests for SAGE experiments. Bioinformatics 2000 16:953-959[Abstract/Free Full Text]
  20. Chen JJ, Rowley JD, Wang SM. Generation of longer cDNA fragments from serial analysis of gene expression tags for gene identification. Proc Natl Acad Sci U S A 2000 97:349-353[Abstract/Free Full Text]
  21. Mayhew TM. A review of recent advances in stereology for quantifying neural structure. J Neurocytol 1992 21:313-328[CrossRef][Medline]
  22. Wreford NG. Theory and practice of stereological techniques applied to the estimation of cell number and nuclear volume of the testis. Microsc Res Tech 1995 32:423-436[CrossRef][Medline]
  23. Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, Lal A, Wang CJ, Beaudry GA, Ciriello KM, Cook BP, Dufault MR, Ferguson AT, Gao Y, He TC, Hermeking H, Hiraldo SK, Hwang PM, Lopez MA, Luderer HF, Mathews B, Petroziello JM, Polyak K, Zawel L, Kinzler KW. Analysis of human transcriptomes. Nat Genet 1999 23:387-388[Medline]
  24. Reaven E, Zhan L, Nomoto A, Leers-Sucheta S, Azhar S. Expression and microvillar localization of scavenger receptor class B, type I (SR-BI) and selective cholesteryl ester uptake in Leydig cells from rat testis. J Lipid Res 2000 41:343-356[Abstract/Free Full Text]
  25. Shiratsuchi A, Kawasaki Y, Ikemoto M, Arai H, Nakanishi Y. Role of class B scavenger receptor type I in phagocytosis of apoptotic rat spermatogenic cells by Sertoli cells. J Biol Chem 1999 274:5901-5908[Abstract/Free Full Text]
  26. O'Shaughnessy PJ, Johnston H, Willerton L, Baker PJ. Failure of normal adult Leydig cell development in androgen-receptor-deficient mice. J Cell Sci 2002 115:3491-3496[Abstract/Free Full Text]
  27. Baker PJ, O'Shaughnessy PJ. Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 2001 122:553-559[Abstract]
  28. Baker PJ, Sha JA, McBride MW, Peng L, Payne AH, O'Shaughnessy PJ. Expression of 3ß-hydroxysteriod dehydrogenase type I and VI isoforms in the mouse testis during development. Eur J Biochem 1999 260:911-916[Medline]
  29. Robert-Nicoud M, Flahaut M, Elalouf JM, Nicod M, Salinas M, Bens M, Doucet A, Wincker P, Artiguenave F, Horisberger JD, Vandewalle A, Rossier BC, Firsov D. Transcriptome of a mouse kidney cortical collecting duct cell line: effects of aldosterone and vasopressin. Proc Natl Acad Sci U S A 2001 98:2712-2716[Abstract/Free Full Text]
  30. Chrast R, Scott HS, Papasavvas MP, Rossier C, Antonarakis ES, Barras C, Davisson MT, Schmidt C, Estivill X, Dierssen M, Pritchard M, Antonarakis SE. The mouse brain transcriptome by SAGE: differences in gene expression between P30 brains of the partial trisomy 16 mouse model of Down syndrome (Ts65Dn) and normals. Genome Res 2000 10:2006-2021[Abstract/Free Full Text]
  31. Hirshfield AN. Relationship between the supply of primordial follicles and the onset of follicular growth in rats. Biol Reprod 1994 50:421-428[Abstract]
  32. Besmer P, Manova K, Duttlinger R, Huang EJ, Packer A, Gyssler C, Bachvarova RF. The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl 1993; 125–137
  33. Stallard BJ, Griswold MD. Germ cell regulation of Sertoli cell transferrin mRNA levels. Mol Endocrinol 1990 4:393-401[Abstract]
  34. Guitton N, Touzalin AM, Sharpe RM, Cheng CY, Pinon-Lataillade G, Meritte H, Chenal C, Jegou B. Regulatory influence of germ cells on Sertoli cell function in the pre-pubertal rat after acute irradiation of the testis. Int J Androl 2000 23:332-339[CrossRef][Medline]
  35. Gomes WR, Hall RW, Jain SK, Boots LR. Serum gonadotropin and testosterone levels during loss and recovery of spermatogenesis in rats. Endocrinology 1973 93:800-809[Medline]
  36. Pusch W, Balvers M, Ivell R. Molecular cloning and expression of the relaxin-like factor from the mouse testis. Endocinology 1996 137:3009-3013[Abstract]
  37. Griswold MD. Protein secretions of Sertoli cells. Int Rev Cytol 1988 110:133-156[Medline]
  38. Yamamoto M, Matsui Y. Testis-specific expression of a novel mouse defensin-like gene, Tdl. Mech Dev 2002 116:217-221[CrossRef][Medline]
  39. Perez-Armendariz EM, Lamoyi E, Mason JI, Cisneros-Armas D, Luu-The V, Bravo Moreno JF. Developmental regulation of connexin 43 expression in fetal mouse testicular cells. Anat Rec 2001 264:237-246[CrossRef][Medline]
  40. Ivell R, Bathgate RA. Reproductive biology of the relaxin-like factor (RLF/INSL3). Biol Reprod 2002 67:699-705[Abstract/Free Full Text]
  41. Geissler WM, Davis DL, Wu L, Bradshaw KD, Patel S, Mendonca BB, Elliston KO, Wilson JD, Russell DW, Andersson S. Male pseudohermaphroditism caused by mutations of testicular 17ß-hydroxysteroid dehydrogenase-3. Nat Genet 1994 7:34-39[CrossRef][Medline]
  42. Tcholakian RK, Steinberger A. In vitro metabolism of testosterone by cultured Sertoli cells and the effect of FSH. Steroids 1979 33:495-526[CrossRef][Medline]
  43. Silver DL, Tall AR. The cellular biology of scavenger receptor class B type I. Curr Opin Lipidol 2001 12:497-504[CrossRef][Medline]
  44. Kawasaki Y, Nakagawa A, Nagaosa K, Shiratsuchi A, Nakanishi Y. Phosphatidylserine binding of class B scavenger receptor type I, a phagocytosis receptor of testicular Sertoli cells. J Biol Chem 2002 277:27559-27566[Abstract/Free Full Text]
  45. Stocco DM. StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol 2001 63:193-213[CrossRef][Medline]
  46. Caron KM, Soo SC, Wetsel WC, Stocco DM, Clark BJ, Parker KL. Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc Natl Acad Sci U S A 1997 94:11540-11545[Abstract/Free Full Text]
  47. Lu Q, Gore M, Zhang Q, Camenisch T, Boast S, Casagranda F, Lai C, Skinner MK, Klein R, Matsushima GK, Earp HS, Goff SP, Lemke G. Tyro-3 family receptors are essential regulators of mammalian spermatogenesis. Nature 1999 398:723-728[CrossRef][Medline]
  48. Baarends WM, Hoogerbrugge JW, Post M, Visser JA, de Rooij DG, Parvinen M, Themmen AP, Grootegoed JA. Anti-Mullerian hormone and anti-Mullerian hormone type II receptor messenger ribonucleic acid expression during postnatal testis development and in the adult testis of the rat. Endocrinology 1995 136:5614-5622[Abstract]
  49. Khurana ML, Pandey KN. Receptor-mediated stimulatory effect of atrial natriuretic factor, brain natriuretic peptide, and C-type natriuretic peptide on testosterone production in purified mouse Leydig cells: activation of cholesterol side-chain cleavage enzyme. Endocrinology 1993 133:2141-2149[Abstract]
  50. Tena-Sempere M, Manna PR, Zhang FP, Pinilla L, Gonzalez LC, Dieguez C, Huhtaniemi I, Aguilar E. Molecular mechanisms of leptin action in adult rat testis: potential targets for leptin-induced inhibition of steroidogenesis and pattern of leptin receptor messenger ribonucleic acid expression. J Endocrinol 2001 170:413-423[Abstract]
  51. Gnessi L, Basciani S, Mariani S, Arizzi M, Spera G, Wang C, Bondjers C, Karlsson L, Betsholtz C. Leydig cell loss and spermatogenic arrest in platelet-derived growth factor (PDGF)-A-deficient mice. J Cell Biol 2000 149:1019-1026[Abstract/Free Full Text]
  52. Borland K, Muffly KE, Hall PF. Production of components of extracellular matrix by cultured rat Sertoli cells. Biol Reprod 1986 35:997-1008[Abstract]
  53. Denduchis B, Schteingart H, Cigorraga S, Vianello SE, Casanova MB, Lustig L. Immunodetection of cell adhesion molecules and extracellular matrix proteins in rat Leydig cell cultures. Int J Androl 1996 19:353-361[Medline]
  54. Diaz ES, Pellizzari E, Meroni S, Cigorraga S, Lustig L, Denduchis B. Effect of extracellular matrix proteins on in vitro testosterone production by rat Leydig cells. Mol Reprod Dev 2002 61:493-503[CrossRef][Medline]
  55. Morita K, Sasaki H, Fujimoto K, Furuse M, Tsukita S. Claudin-11/OSP-based tight junctions of myelin sheaths in brain and Sertoli cells in testis. J Cell Biol 1999 145:579-588[Abstract/Free Full Text]
  56. Batias C, Siffroi JP, Fenichel P, Pointis G, Segretain D. Connexin43 gene expression and regulation in the rodent seminiferous epithelium. J Histochem Cytochem 2000 48:793-805[Abstract/Free Full Text]
  57. Li Y, Friel PJ, Robinson MO, McLean DJ, Griswold MD. Identification and characterization of testis- and epididymis-specific genes: cystatin SC and cystatin TE-1. Biol Reprod 2002 67:1872-1880[Abstract/Free Full Text]
  58. Holash JA, Harik SI, Perry G, Stewart PA. Barrier properties of testis microvessels. Proc Natl Acad Sci U S A 1993 90:11069-11073[Abstract/Free Full Text]
  59. Kon Y. Local renin-angiotensin system: especially in coagulating glands of mice. Arch Histol Cytol 1996 59:399-420[Medline]
  60. Delgado-Reyes CV, Wallig MA, Garrow TA. Immunohistochemical detection of betaine-homocysteine S-methyltransferase in human, pig, and rat liver and kidney. Arch Biochem Biophys 2001 393:184-186[CrossRef][Medline]
  61. Vergouwen RPFA, Huiskamp R, Bas RJ, Roepers-Gajadien HL, Davids JAG, de Rooij DG. Postnatal development of testicular populations in mice. J Reprod Fertil 1993 99:479-485[Abstract]
  62. Baker PJ, O'Shaughnessy PJ. Role of gonadotrophins in regulating numbers of Leydig and Sertoli cells during fetal and postnatal development in mice. Reproduction 2001 122:227-234[Abstract]
  63. Abbaszade IG, Arenburg J, Park CHJ, Kasa Vubu JZ, Orly J, Payne AH. Isolation of a new mouse 3ß-hydroxysteroid dehydrogenase isoform, 3ß-HSD VI, expressed during early pregnancy. Endocrinology 1997 138:1392-1399[Abstract/Free Full Text]
  64. Sha JA, Dudley K, Rajapaksha WRAKJS, O'Shaughnessy PJ. Sequence of mouse 17ß-hydroxysteroid dehydrogenase type 3 cDNA and tissue distribution of the type 1 and type 3 isoform mRNAs. J Steroid Biochem Mol Biol 1997 60:19-24[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
P J O'Shaughnessy, L Hu, and P J Baker
Effect of germ cell depletion on levels of specific mRNA transcripts in mouse Sertoli cells and Leydig cells
Reproduction, June 1, 2008; 135(6): 839 - 850.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
I. Fenic, H. M. Hossain, V. Sonnack, S. Tchatalbachev, F. Thierer, J. Trapp, K. Failing, K. S. Edler, M. Bergmann, M. Jung, et al.
In Vivo Application of Histone Deacetylase Inhibitor Trichostatin-A Impairs Murine Male Meiosis
J Androl, March 1, 2008; 29(2): 172 - 185.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
M Mihm, P J Baker, L M Fleming, A M Monteiro, and P J O'Shaughnessy
Differentiation of the bovine dominant follicle from the cohort upregulates mRNA expression for new tissue development genes
Reproduction, February 1, 2008; 135(2): 253 - 265.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L. Benbrahim-Tallaa, B. Siddeek, A. Bozec, V. Tronchon, A. Florin, C. Friry, E. Tabone, C. Mauduit, and M. Benahmed
Alterations of Sertoli cell activity in the long-term testicular germ cell death process induced by fetal androgen disruption
J. Endocrinol., January 1, 2008; 196(1): 21 - 31.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. J. O'Shaughnessy, M. Abel, H. M. Charlton, B. Hu, H. Johnston, and P. J. Baker
Altered Expression of Genes Involved in Regulation of Vitamin A Metabolism, Solute Transportation, and Cytoskeletal Function in the Androgen-Insensitive Tfm Mouse Testis
Endocrinology, June 1, 2007; 148(6): 2914 - 2924.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. A. L. Tan, K. De Gendt, N. Atanassova, M. Walker, R. M. Sharpe, P. T. K. Saunders, E. Denolet, and G. Verhoeven
The Role of Androgens in Sertoli Cell Proliferation and Functional Maturation: Studies in Mice with Total or Sertoli Cell-Selective Ablation of the Androgen Receptor
Endocrinology, June 1, 2005; 146(6): 2674 - 2683.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R.-S. Ge, Q. Dong, C. M. Sottas, H. Chen, B. R. Zirkin, and M. P. Hardy
Gene Expression in Rat Leydig Cells During Development from the Progenitor to Adult Stage: A Cluster Analysis
Biol Reprod, June 1, 2005; 72(6): 1405 - 1415.
[Abstract] [Full Text] [PDF]