Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print May 14, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.017293
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/3/902    most recent
biolreprod.103.017293v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mann, M. R.W.
Right arrow Articles by Bartolomei, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mann, M. R.W.
Right arrow Articles by Bartolomei, M. S.
Agricola
Right arrow Articles by Mann, M. R.W.
Right arrow Articles by Bartolomei, M. S.
BIOLOGY OF REPRODUCTION 69, 902–914 (2003)
DOI: 10.1095/biolreprod.103.017293
© 2003 by the Society for the Study of Reproduction, Inc.

Reproductive Technology

Disruption of Imprinted Gene Methylation and Expression in Cloned Preimplantation Stage Mouse Embryos1

Mellissa R.W. Mann3, Young Gie Chung4, Leisha D. Nolen3, Raluca I. Verona3, Keith E. Latham2,4, and Marisa S. Bartolomei3

Howard Hughes Medical Institute and Department of Cell and Developmental Biology,3 University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104 The Fels Institute for Cancer Research and Molecular Biology and Department of Biochemistry,4 Temple University School of Medicine, Philadelphia, Pennsylvania 19140


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning by somatic cell nuclear transfer requires that epigenetic information possessed by the donor nucleus be reprogrammed to an embryonic state. Little is known, however, about this remodeling process, including when it occurs, its efficiency, and how well epigenetic markings characteristic of normal development are maintained. Examining the fate of epigenetic information associated with imprinted genes during clonal development offers one means of addressing these questions. We examined transcript abundance, allele specificity of imprinted gene expression, and parental allele-specific DNA methylation in cloned mouse blastocysts. Striking disruptions were seen in total transcript abundance and allele specificity of expression for five imprinted genes. Only 4% of clones recapitulated a blastocyst mode of expression for all five genes. Cloned embryos also exhibited extensive loss of allele-specific DNA methylation at the imprinting control regions of the H19 and Snprn genes. Thus, epigenetic errors arise very early in clonal development in the majority of embryos, indicating that reprogramming is inefficient and that some epigenetic information may be lost.

early development, embryo, gene regulation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The recent success of somatic cell cloning in mammals gives promise to applications such as species preservation, livestock propagation, and cell therapy for medical treatment [1–7]. Importantly, this success provides a striking demonstration of the remarkable capacity of the egg cytoplasm to modify nuclear function. Because embryonic gene transcription commences at the late one-cell stage in the mouse, the ability to obtain live offspring suggests that modification of the somatic genome may be completed fairly quickly. Such an ability would reflect the principal function of the oocyte, which is to transform the haploid genomes from two highly differentiated gametes into a single, diploid, totipotent embryonic genome.

Many questions regarding this reprogramming have yet to be addressed. When is the donor cell nucleus reprogrammed, how efficient is reprogramming, and to what degree is characteristic epigenetic information retained? Addressing such basic questions should provide new insight regarding the molecular mechanisms that control epigenetic information during normal development, the underlying ability of the cloned embryo to either maintain or modify such information, and the potential risks that may be associated with therapeutic or reproductive cloning.

Recent studies of cloned embryos during preimplantation development have revealed striking defects, indicating that cloned embryos do not faithfully recapitulate many of the essential early events of normal development. Cloned embryos exhibit defects in the expression of key regulatory genes such as Oct4, a POU domain, class 5, transcription factor 1 [8]. These embryos display dramatic alterations in culture-medium preferences with a shift toward somatic cell characteristics, indicating a lack of nuclear reprogramming in genes affecting basic physiology and metabolism [9]. Cloned preimplantation embryos also exhibit defects in demethylation processes, including global demethylation and demethylation of some repetitive elements [10–13]. Finally, cloned embryos aberrantly express the somatic form of the DNA methyltransferase protein, DNMT1, and are inefficient at nuclear uptake of the maternally inherited oocyte form [14]. These observations indicate that epigenetic information may not be faithfully preserved during early clonal development.

One way to address the ability of cloned embryos to reprogram epigenetic information is to elucidate the fate of imprinted gene modifications during clonal development. To date, most studies have been limited to the analysis of a few, rare, surviving clones that reached fetal, neonatal, or adult stages of development [15–19]. To our knowledge, no study thus far has examined imprinting during the earliest stages of clonal development to determine how epigenetic information in cloned embryos may be affected or assessed allele specificity of imprinted gene expression in conjunction with DNA methylation analyses in somatic cell cloned embryos. We therefore undertook a detailed analysis of allele-specific expression and DNA methylation of imprinted genes in cloned mouse blastocysts.

For this analysis, we developed novel methods to assay imprinted gene methylation using small numbers of embryos and to assay parental allele expression of multiple genes at the single-embryo level. By applying this combination of methodologies, we have achieved what we believe to be the first detailed analysis of the effects of cloning on epigenetic information associated with imprinted genes during the earliest stages of cloned embryo development. Our results indicate that cloned blastocysts rarely, if ever, display normal expression patterns of imprinted genes, even in morphologically high-quality cloned embryos. Defects in gene expression are accompanied by aberrant methylation patterns of the H19 and Snrpn (for small nuclear ribonucleoprotein N) genes. These results suggest that at least some forms of epigenetic information are not faithfully retained during cloning and that such defects arise early during clonal development. The observed disruptions in DNA methylation and expression of imprinted genes are most likely only a subset of the spectrum of defects related to reprogramming of the donor nucleus to an embryonic state.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Generation of a Substrain of B6(CAST 7) Mice

For allele-specific expression studies, cumulus cells were obtained from F1 hybrid females that were derived from crosses with C57BL/6J (B6) females and Mus musculus castaneus (CAST) males (The Jackson Laboratory, Bar Harbor, ME) and with B6(CAST7) females and B6 males. The B6(CAST7) substrain was generated by backcrossing [CASTXB6]F1 progeny to B6 mice for two generations. Progeny heterozygous for CAST and B6 on chromosome 7 were intercrossed to generate mice homozygous for CAST on chromosome 7. Mice were genotyped with MIT markers (Research Genetics, Carlsbad, CA) approximately every 5 cM as described previously [20]. All studies adhered to procedures consistent with the National Research Council Guide for the Care and Use of Laboratory Animals.

Generation of Clones and Control Embryos

Cloned embryos were generated as described previously [9]. Recipient oocytes for all studies were from (B6D2)F1 females. Cumulus cell nuclei were isolated from individual cells by several rounds of trituration into the injection pipette and then injected into the oocytes, and the oocytes were activated as described previously [6, 9]. Tetraploid control embryos were produced by injecting nuclei into intact eggs. Parthenogenetic control embryos were obtained by activation of intact oocytes in the same manner. Cloned, parthenogenetic, and tetraploid embryos were cultured at 37°C in an atmosphere of 5% CO2 in air [6]. Fertilized embryos were cultured in 5% CO2, 5% O2, and 90% N2. Media included in the present study were as described previously [9]. Embryos were cultured continuously in CZB plus glucose or initially in Whitten medium or in KSOM (for potassium simplex-optimized medium with increased salt concentrations) without amino acids, then switched at the eight-cell stage to KSOM augmented with amino acids.

Isolation of mRNA from Pooled Blastocysts

Pools of 12–20 blastocysts were placed in 20 µl of guanidine thiocyanate lysis buffer (5 M guanidine thiocyanate, 0.5% sarcosyl, 25 mM sodium citrate [pH 7.0], and 20 mM dithiothreitol [DTT]), vortexed, and stored at -80°C. Before mRNA isolation, Dynabeads Oligo (dT)25 (Dynal, Lake Success, NY) was equilibrated with 100 µl of 1x dilution buffer (100 mM Tris-HCl [pH 8.0], 400 mM LiCl, and 20 mM EDTA) according to the manufacturer's instructions. The volume of frozen embryo lysate was brought up to 100 µl with guanidine thiocyanate lysis buffer and thawed quickly by vortexing. Dilution buffer (100 µl) was added, and the embryo lysate was incubated with the equilibrated Dynabead Oligo (dT)25 for 5 min at room temperature with continuous shaking. This mixture was washed twice in 200 µl of washing buffer (10 mM Tris-HCl [pH 8.0], 0.15 M LiCl, and 1 mM EDTA) with 0.1% lauryl sarcosinate and three times in 200 µl of washing buffer. The mRNA was eluted by addition of 9.4 µl of H2O and incubation at 65°C for 2 min. For the reverse transcription (RT) reaction, 9.6 µl of RT mix (1x First-Strand buffer (Invitrogen, Grand Island, NY), 10 mM DTT (Invitrogen), 0.5 mM of each dNTP (Amersham Bioscience Corp, Piscatoway, NJ), 25 ng of oligo (dT)12–18 (Amersham), and 20 U of RNaseOut Recombinant Ribonuclease Inhibitor [Life Technologies, Carlsbad, CA]) were added to the mRNA. The mixture was incubated at 42°C for 2 min, and then 200 U of Superscript II (Life Technologies) were added and first-strand synthesis allowed to proceed for 1 h at 42°C. The reaction was heat inactivated at 95°C for 10 min.

Allele-Specific Expression Assays

For the Igf2r (insulin-like growth factor II receptor), Meg3 (maternally expressed gene 3), and Ascl2 (achaete-scute complex homolog-like 2) RT expression assays, polymerase chain reaction (PCR) amplification was conducted on two to four embryo equivalents of cDNA under conditions specific for each primer set. To a Ready-To-Go PCR Bead (Amersham Bioscience Corp, Piscataway, NJ), 0.3 µM of each primer (Invitrogen, Grand Island, NY) and [32P]dCTP (1 µCi; Perkin Elmer, Boston, MA) were added. The Igf2r primers, Ir1 (5'-GAGACCTCACCCTCATCTATTC-3') and Ir2 (5'-GCACACAGCAGCATCTTCAG-3'), amplified a 388-base pair (bp) fragment (95°C for 2 min followed by 35 cycles at 95°C for 15 sec, 58°C for 10 sec, and 72°C for 20 sec) containing a polymorphism between B6 (A) and CAST (G) (position 1549, MMU04710) [21]. Restriction digestion with TaqI resulted in 210- and 178-bp fragments in CAST, whereas the B6 amplicon was uncleaved. A 337-bp Meg3 fragment was amplified with Meg3 (5'-CCAAAGCCATCATCTGGAATC-3') and Meg4 (5'-CAGCCCTGTGAGGTAGGAAC-3') primers at 95°C for 2 min followed by 34 cycles at 95°C for 15 sec, 55°C for 10 sec, and 72°C for 20 sec (polymorphism at position 1570, MMGT12) [22]. Restriction digestion with SfcI resulted in 250- and 88-bp fragments in B6, whereas the CAST amplicon was uncut. The Ascl2 primers, Ascl1 (5'-TGAGCATCCCACCCCCCTA-3') and Ascl2 (5'-CCAAACATCAGCGTCAGTATAG-3'), amplified a 474-bp fragment (95°C for 2 min followed by 35 cycles at 95°C for 15 sec, 58°C for 10 sec, and 72°C for 20 sec). A polymorphic SfcI restriction site between B6 (T) and CAST (C) (position 10828, AF139595) (L. Lefebvre, A. Nagy, and J. Mann, personal communication) distinguished the parental alleles (CAST, 266- and 207-bp fragments; B6, 474 bp). Products were resolved on a 7% polyacrylamide gel. After a 16-h exposure, the relative band intensities were quantified using ImageQuant (Molecular Dynamics, Sunnyvale, CA).

The H19 and Snrpn expression LightCycler (LC) assays were conducted on cDNA using the LC Real Time PCR System (Roche Molecular Biochemicals, Indianapolis, IN). The H19 LC assay was performed as described previously [23] except that two embryo equivalents of cDNA were used, amplification proceeded for 45 cycles, and the contribution of each allele was calculated as the peak area of the melting curve generated at the allele-specific temperature, approximately 67.5°C for B6 and 61.5°C for CAST. The Snrpn primers, Sn1 (5'-CTCCACCAGGAATTAGAGGC-3') and Sn3 (5'TATAGTTAATGCAGTAAGAGG3'), were used to amplify a 155-bp region of the Snrpn gene (MMSMN [21]). Fluoresence resonance energy transfer (FRET) hybridization probes were designed to the B6 amplicon. The Snrpn sensor probe (5'-GAAGCATTGTAGGGGAAGAGAA-FL-3'; Idaho Technologies, Salt Lake City, UT) spans a single nucleotide polymorphism at nucleotide 915 between B6 (C) and CAST (T) and was labeled with fluorescein at the 3' end. The Snrpn anchor probe (5'-RED640-GGCTGAGATTTATCAACTGTATCTTAGGGTC-P-3'; Idaho Technologies) was labeled with LC-Red640 at the 5' end and phosphorylated at the 3' end. To a Ready-To-Go PCR Bead, 5.12 µl of H2O, 0.38 µl of TaqStart Antibody (BD Biosciences Clontech, Palo Alto, CA), and 1.5 µl of 25 mM MgCl2 (final concentration, 3.0 mM) were added, and the reaction was incubated at room temperature for 5 min. After incubation, a final concentration of 12% dimethyl sulfoxide (DMSO), 0.5 µM of each primer, and 0.3 µM of each probe was added to the mix and the volume brought to 12.5 µl. From this reaction mix, 10 µl were removed and added to a LC glass capillary (Roche Molecular Biochemicals), and 10 µl of cDNA (two embryo equivalents) and H2O were added for a final reaction volume of 20 µl. After an initial denaturation step at 95°C for 2 min, amplification was performed for 65 cycles at 95°C for 1 sec, 50°C for 15 sec, and 72°C for 6 sec. A single fluorescence acquisition occurred at the end of each annealing step. After amplification, a final denaturation and annealing step was conducted (95°C for 3 min, 35°C for 2 min) followed by a melting-curve analysis with fluorescence acquisition occurring continuously as the temperature was increased from 35°C to 85°C in 0.2°C increments. After background subtraction, the contribution of each allele was calculated as the peak height of the melting curve generated at the allele-specific temperature, approximately 56.5°C for B6 and 51.0°C for CAST (LC Data Analysis Software, Roche Molecular Biochemicals).

Synthesis of a Reusable Dynabead Oligo (dT)25-cDNA Library from Single Blastocysts

Individual blastocyst-stage embryos were placed in 20 µl of guanidine thiocyanate lysis buffer, vortexed, and stored at -80°C. Dynabeads Oligo (dT)25 were equilibrated and embryo lysates processed as described above. After removal of the last wash, 10 µl of RT mix (1x First-Strand buffer, 10 mM DTT, 0.5 mM dNTPs each, 20 U of RNaseOut Recombinant Ribonuclease Inhibitor, and 50 U of Superscript II) were added to the Dynabead Oligo (dT)25, and the complex was incubated at 42°C for 1 h while rotating in a hybridization oven. The resulting Dynabead Oligo (dT)25 covalently linked cDNA library was washed twice in 10 µl of TNT buffer (Tris-EDTA buffer, 0.01% IGEPAL(NP-40), and 0.01% Tween 20), and the RNA was removed after an incubation at 95°C for 1 min. After removal of the RNA, the Dynabead Oligo (dT)25-cDNA library was washed twice in 100 µl of TNT buffer and stored at 4°C in 100 µl of TNT buffer.

Before PCR amplification, second strand was synthesized from the Dynabead Oligo (dT)25-cDNA library. To a Ready-To-Go PCR bead, 2x forward primer was added in a volume of 25 µl. Ten microliters of 2x forward primer-PCR mix was added to the Dynabead Oligo (dT)25-cDNA library, and second strand was synthesized by one cycle in a Hybaid rapid cycler (95°C for 15 sec, annealing temperature for 10 sec, and 72°C for 20 sec followed by denaturation at 94°C for 2 min). Second-strand product was removed quickly from the Dynabead Oligo (dT)25-cDNA library and then centrifuged to collect any remaining condensation. The second-strand product was then separated a second time to ensure removal of all Dynabeads (any remaining Dynabeads were resuspended in TNT and added back to the library). In preparation for the next gene of interest, the Dynabead Oligo (dT)25-cDNA library was washed twice in 100 µl of TNT buffer and stored at 4°C in 100 µl of TNT buffer.

Allele-Specific Expression Assays Using Second-Strand Product

For RT-PCR analysis, 2x reverse primer and [32P]dCTP (2 µCi) were added to a Ready-To-Go PCR Bead. Ten microliters of 2x reverse primer-PCR reaction mix were added to the second-strand product that contained 2x forward primer, resulting in a final concentration of 0.3 µM for each primer. The PCR amplification was conducted as described above.

The H19 and Snrpn LC expression assays were conducted on second-strand product using the LC Real Time PCR System. For the H19 LC expression assay, Ready-To-Go PCR Beads were preincubated with TaqStart Antibody, after which a final concentration of 4.5 mM MgCl2, 0.6 µM reverse primer, and 0.3 µM of each probe was added to the mix and the volume brought to 25 µl. From this reaction mix, 10 µl were removed and added to a glass capillary, and then 10 µl of second-strand product were added (final concentration, 3.0 mM MgCl2, 0.3 µM of each primer, and 0.15 µM of each probe). Amplification and analysis were performed as described above.

For the Snrpn LC expression assay, 11.62 µl of H2O, 0.38 µl of TaqStart Antibody, and 3 µl of 25 mM MgCl2 were added to a Ready-To-Go PCR Bead, and the reaction was incubated at room temperature for 5 min. After incubation, a final concentration of 24% DMSO, 1.0 µM reverse primer, and 0.6 µM of each probe was added to the mix and the volume brought to 25 µl. From this reaction mix, 10 µl were removed and added to a glass capillary. Then, 10 µl of second-strand product were added (final concentration, 3.0 mM MgCl2, 12% DMSO, 0.5 µM of each primer, and 0.3 µM of each probe), and amplification was performed as described above.

Glyceraldehyde-3-Phosphate Dehydrogenase Gene Expression Analysis

For analysis of glyceraldehyde-3-phosphate dehydrogenase (Gapd) levels, GAPDHF1 (5'-ATCACTGCCACCCAGAACAC-3') and GAPDHB1 (5'-ATCCACGACGGACACATTGG-3') primers were used to amplify a 185-bp region in the Gapd gene. Second-strand synthesis was carried out as described above with 2x forward primer (0.6 µM) at an annealing step of 58°C. For the LC analysis, Ready-To-Go PCR beads were preincubated with TaqStart antibody, and then a final concentration of 0.6 µM reverse primer, 6 mM MgCl2, and 2x SYBR Green (Molecular Probes, Eugene, OR) was added and the volume brought to 25 µl. Ten microliters of this reaction mix were added to a glass capillary together with 10 µl of second-strand product (final concentration, 3.0 mM MgCl2, 0.3 µM of each primer, and 1x SYBR Green). After an initial denaturation step at 95°C for 2 min, amplification was performed for 24 cycles at 95°C for 0 sec, 58°C for 10 sec, and 72°C for 9 sec, with a single fluorescence acquisition step at the end of each elongation step. Melting-curve analysis was performed after a final denaturation step at 95°C for 0 sec followed by 65°C for 15 sec, after which the temperature was increased to 97°C in 0.1°C increments with continuous acquisition. After background subtraction, the total amount of product was calculated as the peak area of the melting curve generated (~92°C).

Parental allele-specific expression patterns for all genes were calculated as the percentage expression of the B6 or CAST allele relative to the total expression of both alleles. Expression was classified as monoallelic (defined as <=10% expression from the normally silent allele), biallelic, or no expression. Total expression levels for each gene were classified independently as no, low (H19, crosspoint value [cp] > 38; Meg3, Igf2r, and Ascl2, 102–103 cpm; Snrpn, cp > 43; and Gapd, >0.008 peak area), medium (H19, cp > 34; Meg3, Igf2r, and Ascl2, 104–105 cpm; Snrpn, cp > 35; and Gapd, >0.1 peak area), and high (H19, cp > 30; Meg3, Igf2r, and Ascl2, 106–107 cpm; Snrpn, cp > 30; and Gapd, >1.0 peak area) expression. The cp was determined by the second-derivative maximum method using the LC Data Analysis Software. Each value was generated during the log-linear phase at the threshold cycle (i.e., the point at which the fluorescence signal exceeds the level of background noise).

Allele-Specific DNA Methylation Analysis

The DNA was isolated from pools of 25–30 blastocysts and subjected to bisulfite modification, PCR amplification, subcloning, and sequencing as previously described [24] with the following modifications. The mutagenized DNA was resuspended in 5 µl of TE (10 mM Tris-Cl [pH 8.0], 1 mM EDTA), and 1 µl was used for PCR amplification. All mutagenized DNAs were subjected to multiple independent PCR amplifications to ensure recovery of different strands of DNA. For the H19 differentially methylated domain (DMD) and promoter proximal region, the regions from 1304 to 1726 bp and from 4397 to 4778 bp (U19619) were assayed, respectively [24]. For Snrpn, the region from 2073 to 2601 bp (AF081460) was assayed [25]. Parental alleles were distinguished by single nucleotide polymorphisms (SNPs) in the regions of interest. The SNPs for H19 were previously described [26]. The SNPs for Snrpn were as follows (B6/CAST): 2181 G/A, 2191 T/A, 2251 T/G, 2260 T/A, 2268 G/A, 2281 C/T, 2292 C/T, and 2348 G/T.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Elucidating the fate of epigenetic information before the severe attrition that occurs soon after implantation and during fetal life should provide insight regarding how rapidly reprogramming of the donor nucleus occurs, the efficiency of this reprogramming, and the fidelity of maintaining epigenetic information characteristic of normal development. The analysis of specific genes for which epigenetic regulation is well-studied and which likely are representative of similarly controlled genes should address these key questions. In the present study, the expression, imprinted regulation, and methylation states of multiple imprinted genes were examined in cloned blastocyst-stage embryos.

Expression of Imprinted Genes in Pooled Blastocysts

Two imprinted genes expressed at significant levels in blastocysts are H19 and Snurf-Snrpn (herein called Snrpn). The H19 gene transcription initiates at the blastocyst stage, whereas expression of the Snrpn gene begins at the 4-cell stage [20, 27]. Allele-specific expression of these genes was initially examined in pools of cloned blastocysts [B6(CAST7)XB6 or B6XCAST cumulus cell nuclei injected into B6D2 oocytes from which spindle-chromosome complexes had been removed (designated as cCBBD and cBCBD, respectively)], parthenogenetic blastocysts [activated oocytes (pC/B)], tetraploid blastocysts [B6(CAST7)XB6 or B6XCAST cumulus cell nuclei injected into intact B6D2 oocytes (designated as tCBBD and tBCBD, respectively)], in vitro-cultured blastocysts [B6(CAST7)XB6 (iCB)], and in vivo-derived blastocyst [B6(CAST7)XB6 (vCB)]. These middle three sets of embryos served as controls to reveal possible effects of cloning and culturing procedures.

Diploid parthenogenetic B6(CAST7)XB6 blastocysts, which possess two maternal genomes, displayed expression of both CAST and B6 H19 alleles and no expression of the oppositely imprinted Snrpn gene, as expected (Table 1). Tetraploid blastocysts contain four haploid genomes, three of which are maternal. Expression of H19 in pooled tCBBD blastocysts [one CAST, two B6 or D2 maternal alleles (D2 transcripts are indistinguishable from B6), and one paternal B6 allele] was observed from the maternal CAST somatic genome and the B6 oocyte genome(s), indicating that the H19 gene of the donor cell was reactivated and expressed in blastocyst-stage embryos (Table 1). The maternal CAST somatic Snrpn allele remained silent. Analysis of the tBCBD pool (three maternal B6 or D2 alleles and one paternal CAST allele) likewise demonstrated imprinted expression of H19 and Snrpn, because the paternal CAST somatic H19 allele maintained its silent state and the paternal CAST somatic Snrpn allele was solely expressed (Table 1). Similar to in vitro-cultured and in vivo-derived blastocysts, pools of cloned blastocysts exhibited imprinted H19 and Snrpn expression with only the maternal H19 alleles and only the paternal Snrpn alleles transcribed (Table 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Expression of H19 and Snrpn in pooled lysates.a

Expression Levels of Imprinted Genes in Individual Blastocysts

Whereas a majority of parthenogenetic, tetraploid, and fertilized embryo pools yielded measurable signals for both H19 and Snrpn mRNAs, approximately half (5 of 11) of the cloned embryo pools failed to yield signals for either mRNA. Because cloned embryos have been shown previously to contain reduced numbers of cells in comparison to the other embryo types [9], the simplest explanation is that a significant number of cloned embryos within some of the pooled samples were developmentally delayed and failed to activate expression of these genes to a detectable level. Thus, it was essential to account for individual embryo quality by assaying expression within single embryos. To do this, we developed a method that synthesizes reusable Dynabead Oligo (dT)25-cDNA libraries from individual blastocysts. This allows expression from multiple genes to be analyzed in a single embryo. Individual cloned embryos were classified, with respect to size and morphology, as excellent (well-expanded and comparable in size to fertilized control blastocysts), good (expanded but smaller than fertilized blastocysts, with cell debris possible), or poor (poorly expanded with a small cavity and numerous excluded cells) and were assayed for expression of five imprinted genes and one nonimprinted gene (Fig. 1).



View larger version (77K):
[in this window]
[in a new window]
  		FIG. 1. Total transcript abundance in individual WK- and KK-cultured cloned (c), parthenogenetic (p), tetraploid (t), and in vivo-derived (v) blastocysts for imprinted genes and one nonimprinted gene. Levels for each gene were classified as no (black), low (blue), medium (yellow), or high (red) expression. A significant number of cloned blastocysts failed to show any expression and were identified by good (G) to poor (P) morphology compared to embryos with excellent (E) morphology. Embryos were cultured initially in Whitten media or in KSOM without amino acids and then switched at the 8-cell stage to KSOM augmented with amino acids. Clones, B6XCAST cumulus cell nuclei injected into B6D2 oocytes from which spindle-chromosome complexes had been removed; parthenotes, activated B6(CAST7)XB oocytes; tetraploids, B6XCAST cumulus cell nuclei injected into intact B6D2 oocytes; in vivo-derived, B6(CAST7)XB6 blastocysts; b followed by a number, individual numbered blastocysts

Expression of imprinted genes was examined in blastocysts obtained by culture in a system that we previously determined supports a high rate (35%) of blastocyst formation: Whitten medium to the 8-cell stage and KSOM augmented with amino acids thereafter (WK) [9]. This culture system produces cloned blastocysts at an efficiency comparable to that reported by others [6]. A significant number of cloned blastocysts failed to express any of the imprinted genes (Fig. 1). These embryos were generally of good or poor morphology. The majority of expressing clones had excellent morphologies. The compromised morphology exhibited by approximately 50% of the blastocysts is consistent with the observation that many cloned embryos likely arrest during the preimplantation period [28].

The analysis of transcript abundance in the expressing embryos revealed a large degree of variability among clones compared to in vivo-derived blastocysts (Fig. 1). No discernible pattern emerged with regard to the number or identity of the expressed genes in the cloned samples. All permutations were observed from only one imprinted gene to five genes being expressed in a given embryo, suggesting that each gene responded independently to the cloning process.

The apparent deficiencies in imprinted gene expression could conceivably be attributed to an effect of culture rather than to an effect of cloning per se [20]. To distinguish between these possibilities, we examined gene expression in additional single cloned blastocysts in a second culture system that also supports a high rate (22%) of blastocyst formation: KSOM without amino acids to the 8-cell stage followed by KSOM with amino acid augmentation (KK) [29; unpublished results]. The results obtained with these KK cloned embryos were virtually identical to those obtained with the WK combination (Fig. 1). In contrast, the expression level of imprinted genes in parthenogenetic embryos was better in KK than in WK (Fig. 1). Parthenogenetic embryos resembled fertilized embryos, for which KSOM supports a more in vivo-like pattern of gene expression than Whitten medium [30], as demonstrated by Gapd expression. The opposite held true for tetraploid blastocysts, because transcript levels for all genes were higher in WK-cultured tetraploids.

It is noteworthy that good correlation was found between the level of expression of the imprinted genes analyzed and the expression of the control gene Gapd: Medium to high levels of Gapd were associated with overall medium to high levels of imprinted gene expression, whereas low or lack of expression of Gapd was correlated with similar low levels of expression of imprinted genes (Fig. 1). This result indicates that effects of the cloning procedure on expression may be widespread and that differences in Gapd expression among cloned blastocysts likely reflect the general health of the embryo.

Parental Allele-Specific Expression of Imprinted Genes in Individual Blastocysts

The expression levels of imprinted genes varied among individual cloned blastocysts, but the question remained whether imprinted expression was preserved in these embryos. A number of outcomes may be anticipated from the analysis of allele specificity. First, the somatic cell nucleus may be reprogrammed, and imprinted expression will mimic that of a normal fertilized embryo. Second, the somatic nucleus may not be capable of being reprogrammed and will maintain the somatic imprint associated with the cumulus cell. Third, imprinting may be lost because of incomplete reprogramming or other epigenetic events. To distinguish among these possibilities, embryos were tested for parental allele-specific expression of five imprinted genes that have various allelic expression patterns in normal blastocysts and cumulus cells.

Control blastocysts behaved as expected. Parthenogenetic blastocysts expressed both maternally derived alleles of the H19, Meg3, Igf2r, and Ascl2 genes (data not shown). No expression was observed for Snrpn in parthenotes. In tetraploids (tBCBD), H19 and Meg3 genes displayed imprinted expression in most cases, whereas the Igf2r and Ascl2 genes exhibited a low level of expression from the normally silent somatic CAST paternal allele (data not shown). The Snrpn gene displayed exclusively imprinted expression from the somatic paternal CAST allele in the tBCBD embryos.

Parental allele-specific expression was examined in cloned blastocysts after exclusion of samples that failed to express Gapd at medium to high levels (Fig. 2). Of the 17 embryos that expressed H19, nearly all (15 embryos) transcribed only the maternal H19 allele. Thus, appropriate parental allele expression was maintained for H19 in most cloned blastocysts. Furthermore, cloned blastocysts exhibited exclusively maternal Meg3 and paternal Snrpn expression (Fig. 2). Thus, genomic imprinting was retained with high fidelity for these genes in healthy clones.



View larger version (71K):
[in this window]
[in a new window]
  		FIG. 2. Allelic expression patterns of imprinted genes in individual WK- and KK-cultured cloned blastocysts. Data are presented for embryos that expressed Gapd at medium to high levels. Black bar height indicates the percentage of maternal allelic expression; gray bar height shows the percentage of paternal allelic expression relative to the total expression of both alleles. Monoallelic expression was observed in cumulus cells for all genes that are expressed. Fertilized, in vivo-derived blastocysts display monoallelic expression for H19 and Snrpn and biallelic expression of Ascl2 and Igf2r [20, 31–33]. Details are as described in Fig. 1

Two imprinted genes, Ascl2 and Igf2r, exhibit biallelic expression in normal blastocysts [31–33], thereby providing an informative test of reprogramming from a monoallelic cumulus pattern to a biallelic mode of expression. In 14 cloned blastocysts that expressed Ascl2, 8 clones exhibited maternal-only expression, 4 clones displayed biallelic expression, and 2 clones had paternal-only expression (Fig. 2), suggesting that the imprint associated with this gene was not reprogrammed in a large proportion of embryos. Almost all cloned blastocysts (91%) that were cultured in WK exhibited a biallelic Igf2r expression pattern, indicating a switch in mode of expression. This result differed from that obtained with KK-cultured cloned blastocysts (50% biallelic expression).

The allelic expression patterns for these five imprinted genes revealed that only two cloned embryos exhibited a somewhat normal pattern of imprinted gene regulation (b23 WK and b23 KK) (Fig. 2). In summary, a large number of cloned blastocysts failed to express one or more imprinted genes, suggesting that expression from the somatic nucleus was not properly activated. In the remaining clones, the somatic imprint associated with the H19, Meg3, and Snrpn genes appeared to be retained and to direct monoallellic expression. For the Ascl2 and Igf2r genes, some clones were not efficiently reprogrammed (maternal expression), whereas others adopted a biallelic expression pattern.

Allele-Specific Methylation of Imprinting Control Regions

To understand the effects of cloning on imprinted gene regulation, it was essential to assess imprinted gene expression in conjunction with DNA methylation analyses. We observed that many of the cloned embryos had low gene transcript levels, lacked expression, or exhibited allelic expression patterns uncharacteristic of blastocysts. These patterns could be the result of an alteration of imprinting marks, because methylation of distinct CpG-rich regions around imprinted genes plays an important role in the regulation of monoallelic expression of these genes. We analyzed methylation of regions that determine the imprint to assess directly the epigenetic state of cloned blastocysts.

Methylation of two regions that are essential to the regulation of H19- and Snprn-imprinted expression was assayed by bisulfite mutagenesis. The DMD of the H19 gene is paternally hypermethylated [26], whereas the Snrpn promoter-exon 1 region is maternally hypermethylated [34]. These patterns are present in in vivo-derived blastocysts [26; J. Trasler and M. Toppings, personal communication] and were observed in donor cumulus cell nuclei (Figs. 3–5). In comparison, these alleles were significantly demethylated in cloned blastocysts. Some strands exhibited the typical pattern of hypermethylation, but a large proportion of strands at both imprinted loci lacked significant methylation (Figs. 3–5 ). This heterogeneity of methylation observed in cloned blastocysts was not found in the cumulus cell population.



View larger version (54K):
[in this window]
[in a new window]
  		FIG. 3. Methylation status of individual DNA strands in the H19 upstream DMD (top) and promoter proximal region (bottom) as determined by bisulfite analysis. Unmethylated CpGs are represented as empty circles; methylated CpGs are depicted as filled circles. Each line denotes an individual strand of DNA. Cumulus cells (BC) and in vitro-cultured (iCB), parthenogenetic (pB/C), tetraploid (tBCBD), and cloned (WK-cultured clones cCBBD and cBCBD and KK-cultured clones cBCBD) blastocysts were assayed. Parthenotes have two maternal alleles. Only data for the somatic paternal allele are shown for tetraploids. Fewer strands were obtained for this allele, because they are expected at a lower (one in four) frequency. In the DMD, the B6 and D2 alleles have a polymorphism at CpG 8; therefore, only CAST alleles have this position indicated. Missing circles (CpGs) are the result of ambiguous sequencing results



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 5. Cumulative data of the H19 upstream region (A) and the Snrpn promoter-exon 1 region (B) of cumulus cells and in WK- and KK-cultured blastocysts. Bar height indicates the fraction of strands that have a methylated CpG at each specific site (numbers correspond to positions depicted in Figs. 3 and 4). Paternal and maternal alleles are depicted by gray and black bars, respectively. Horizontal lines in the cumulus cell graphs indicate the average fraction of methylation observed in the in vivo-derived blastocysts



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 4. Methylation status of individual DNA strands in the Snrpn promoter-exon 1 region as determined by bisulfite analysis. Cumulus cells (BC) and in vitro cultured (iCB), parthenogenetic (pB/C and pC/B), tetraploid (tCBBD), and cloned (WK-cultured clones cCBBD and cBCBD and KK-cultured clones cBCBD) blastocysts were assayed. The CAST allele has a polymorphism at CpG 1; this position is indicated for B6 and D2 alleles only. Details are as described in Fig. 3

The extent of methylation loss was affected by the culture regime employed. Clones cultured in WK exhibited more dramatic demethylation than the clones cultured in KK. Whereas 30% of DNA strands from WK-cultured cloned blastocysts maintained a hypermethylated pattern on the paternal H19 allele (defined as >50% CpGs on a given strand methylated), 79% of the paternal alleles from KK-cultured cloned blastocysts were hypermethylated (Fig. 3). A similar loss of methylation (27% hypermethylated strands) was observed at the Snrpn locus for cloned blastocysts cultured in WK, but KK-cultured clones showed an intermediate level (55%) of hypermethylated strands (Fig. 4).

Control embryos were examined to determine the effect of nuclear transfer, oocyte activation, and embryo culture on the DNA methylation patterns of imprinted genes. In vitro-cultured fertilized, parthenogenetic, and tetraploid blastocysts showed less pronounced perturbations in methylation than cloned embryos, except for H19 in KK-cultured blastocysts. Considerable methylation was maintained at the H19 DMD and the Snprn promoter-exon 1 region, although the levels were slightly lower than those detected in cumulus cells (Figs. 3– 5). Thus, whereas culturing embryos affects the methylation of imprinted genes, this culture effect does not fully explain the patterns of hypomethylation seen in cloned blastocysts, nor can the nuclear transfer and activation processes fully account for the hypomethylation of cloned blastocysts.

A third region of differential methylation was examined in cumulus cells and in control and cloned blastocysts. Though not part of the region regulating imprinted expression, the promoter proximal region of the H19 gene displays differential methylation in midgestation embryos but not in blastocysts [26]. Similar to conceptuses, DNA from cumulus cells was methylated on both parental alleles, with higher levels of methylation found on the paternal allele (Fig. 3). Thus, this region provided an additional test of reprogramming from a differentially methylated cumulus pattern to one of hypomethylation in blastocysts. Control blastocysts exhibited little or no methylation on the maternal and paternal alleles, as has been reported for in vivo-derived blastocysts [26]. Very little methylation remained in cloned blastocysts, indicating that the somatic nucleus had lost the hypermethylation associated with this region.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our data reveal that cloned embryos exhibit widespread defects in imprinted gene regulation on all three levels examined: total transcript abundance, allele specificity of expression, and allelic DNA methylation. Nearly all embryos exhibited some level of abnormality, even clones of high morphological quality. Considerable heterogeneity was seen among individual embryos. These observations indicate that defects in epigenetic inheritance arise very early during clonal development, that a significant proportion of clones fail to express any of the imprinted or nonimprinted genes analyzed, and that epigenetic information associated with imprinted genes is not faithfully retained in the majority of cloned embryos. These disruptions are most likely only a subset of the range of defects related to the reprogramming of genes to an embryonic state. The proportion of embryos exhibiting a comparatively normal pattern of imprinted gene expression at the blastocyst stage is consistent with the proportion of live-born cumulus cell clones as observed by us and others using similar methods [6; unpublished observations].

Defects in the Expression Level of Imprinted Genes

Successful cloning can be expected to occur through proper recapitulation of the normal embryonic pattern of gene expression. One defect that was observed in the analysis of individual cloned blastocysts was the significant number (~30%) that failed to express any of the five imprinted genes, as would be expected for normal embryos. We conclude either that these clones underwent comparatively little reprogramming of the cumulus cell genome or that generalized transcription failure occurred, which correlated with the clone's compromised morphology and poor Gapd expression. In the remaining clones, considerable heterogeneity was found in the level of expression and in both the number and identities of expressed genes. Previous examination of gene expression levels in placentae of cesarean-delivered pups derived from embryonic stem cell nuclei also revealed heterogeneity in the levels of expression of several imprinted genes [35]. Misregulation of one locus was found to be independent of abnormal expression at other imprinted loci. The similarity between the data presented here and the results from term placentae of embryonic stem cell clones suggests that differences in epigenetic state among clones arise early during preimplantation development. A recent study of Oct4 gene expression suggested an early origin for defects affecting expression of that gene, with a large number of clones failing to reactivate expression of Oct4 and Oct4-related genes in individual cloned blastocysts [8, 36]. Thus, our data, together with data from others, indicate that most cloned embryos are unable to recapitulate a normal embryonic pattern of gene expression.

Defects in Allele Specificity of Imprinted Gene Expression

Two differing expectations exist for the control of imprinted genes during cloning. For many imprinted genes, cloning should not alter the parental imprints present in the donor cell genome, because both blastocysts and somatic cells have identical imprints and show monoallelic expression. For some imprinted genes, however, biallelic expression is expected for normal blastocysts, so recapitulation of the embryonic program would be accompanied by a shift from monoallelic to biallelic expression. Examination of allele-specific expression revealed appropriate imprinted expression for Meg3 and Snrpn in all expressing embryos and appropriate imprinted expression of H19 in a majority of embryos. Thus, for these genes, imprinting information appeared to be retained in cloned embryos. For the Ascl2 and Igf2r genes, the expected shift from a monoallelic to a biallelic mode of expression was seen in at least half the embryos, whereas other clones were not efficiently reprogrammed but, instead, maintained a somatic expression pattern. A greater fraction (91%) of embryos displayed biallelic Igf2r expression using the WK culture system. In theory, a shift to biallelic expression could reflect either true recapitulation of the biallelic embryonic pattern of expression or simply a loss of imprinting.

These data suggest that cloned embryos were partly successful at remodeling the somatic nucleus, but an assessment of individual clones revealed that rarely did all five genes behave in the same manner. In fact, many clones appeared to lose expression or maintain a somatic pattern of imprinted expression for some genes. One cloned blastocyst maintained a somatic expression pattern for all five genes (b4 KK). Even among those embryos displaying excellent morphologies, rarely did these embryos exhibit an entirely normal imprinting pattern. Of the 48 cumulus cell clones examined, 2 clones (4%) exhibited a blastocyst pattern of imprinted expression for the five genes. This number approximates the proportion of embryos that typically support term development [6].

Defects in Imprinted Gene Methylation

Just as imprinted patterns of expression should be retained for some genes during clonal development, so too should allele-specific DNA methylation. Failure to do so could compromise later development or viability. We found that cloned embryos exhibit loss of methylation during development to the blastocyst stage at the H19 DMD region and at the Snrpn promoter-exon 1 region. The degree of methylation loss is much greater than that seen in control embryos, indicating that the loss is not caused simply by in vitro culture or other procedures but, rather, is a specific attribute of cloned embryos. The loss of methylation at the H19 and Snrpn loci in cloned blastocysts contrasts with the monoallelic pattern of expression observed for these genes. These data indicate that even when substantial loss of DNA methylation occurs, cloned embryos can maintain appropriate allele-specific expression. This was a surprising result, because loss of methylation typically is associated with loss of imprinted gene regulation [37]. It should be noted, however, that the precise molecular mechanisms controlling allelic expression and silencing for imprinted genes have only been partly illuminated for somatic tissues, with little information documenting the existence or regulation of these mechanisms in preimplantation embryos.

One possibility to account for the apparent discrepancy between loss of DNA methylation and maintenance of allele specificity of expression is that partial DNA methylation may be adequate to maintain appropriate expression at the blastocyst stage. Alternatively, some aspect of somatic cell chromatin structure may persist throughout the preimplantation period in cloned embryos to maintain allele specificity of expression. Support for the latter model comes from the study of H19 methylation in spermatogenic cells [38]. Parental allelic identity was retained in the absence of differential methylation, implicating another epigenetic modification in identity preservation. In either case, the modifications may not be sufficient to maintain allelic expression patterns when transcription of these genes increases after implantation.

Another possible explanation for the apparent discordance in imprinted expression and methylation is that the observed partial DNA methylation pattern reflects the embryo composition within the pools. For this explanation to apply, one must assume that the nonexpressing clones would have undergone preferential loss of methylation at these loci whereas cloned blastocysts displaying imprinted expression would maintain allele-specific methylation. Interestingly, we found that the H19 promoter proximal region is demethylated in all embryos. Thus, demethylation events of unique sequences, like the H19 promoter proximal region, may occur readily in all embryos, similar to bovine cloned blastocysts [39], whereas mechanisms that protect against inappropriate demethylation events may only operate in a select few clones.

If monoallelic expression is retained despite an erosion of differential methylation, this would pose an interesting problem for cloned embryos, because biallelic expression (i.e., loss of imprinting) likely would manifest rapidly as development progressed. In this case, only the most healthy cloned embryos that preserved imprinted expression and methylation would be expected to display extended developmental potential. To this point, loss of imprinting has not, to our knowledge, been observed in midgestation cloned conceptuses [40, 41].

Resolution of these alternatives will require single-embryo methylation analysis. At this time, however, available technology does not permit comprehensive analysis of DNA methylation to be applied with great confidence to single embryos, especially those embryos of good or poor morphological classes, which are handicapped by severely reduced cell numbers.

Possible Defects in Nuclear-Cytoplasmic Interactions in Cloned Embryos

The observed disruptions in DNA methylation and expression of imprinted genes most likely are only part of a spectrum of defects related to reprogramming of epigenetic information to an embryonic state. These results suggest that reprogramming of the donor cell nucleus by the egg cytoplasm may be impaired. In fact, reprogramming of the somatic genome may be largely stochastic in nature, with the result that only a small fraction of cloned embryos are able to regulate their genes appropriately. Earlier nuclear transfer studies revealed a striking effect of one-cell stage cytoplasm on cleavage-stage nuclei [42]. It was hypothesized that the one-cell stage cytoplasm has the capacity to render chromatin transcriptionally inactive so that it may be remodeled for zygotic transcription. Such effects offer a possible explanation for the large number of clones that failed to initiate specific gene expression both in the present and in earlier studies [8]. More recent studies have indicated that the cloned embryo lacks certain gene-regulatory capacities that appear to be encoded uniquely by an authentic embryonic genome. Cloned preimplantation embryos exhibited defects in demethylation processes, including global demethylation and demethylation of some repetitive elements [10–13]. The presence of an oocyte nucleus in tetraploid embryos overcomes the inefficient demethylation of satellite regions in cloned blastocysts [43]. One explanation for the failure to demethylate cloned embryos may be the ectopic presence of DNA methyltransferase. By counteracting the normal preimplantation demethylation processes, the net result would be maintenance of methylation at these repetitive elements. Cloned embryos aberrantly express the somatic form of DNMT1 [14]. Tetraploid embryos successfully prevent this aberrant expression, indicating that the presence of an authentic set of gamete-derived chromosomes is required for correct regulation of DNMT1 expression. Thus, gamete-derived genomes may be endowed with protective epigenetic properties that prevent inappropriate expression of genes that provide essential regulatory functions. The somatic cell genomes used to make cloned embryos would lack these important attributes and, as a result, would be expected to undergo an unpredictable series of epigenetic modifications. These ooplasmic effects may reverberate through preimplantation development, because cloned embryos are also inefficient at nuclear uptake of the maternally inherited oocyte form of DNMT1 at the 8-cell stage [14]. The substantial loss of methylation we observed in clones may be partly attributable to the failure of cloned embryos to regulate correctly DNA methyltransferase at the eight-cell stage, suggesting that the protective mechanism employed by preimplantation embryos to preserve gametic methylation of imprinted genes failed in cloned blastocysts. Thus, most, if not all, somatic cell clones would be expected to show epigenetic defects, even those rare clones that develop to advanced stages or birth, as has been seen [17, 35].

A spectrum of outcomes has been predicted based on the success of reprogramming [44]. In the first category, reprogramming by the egg cytoplasm has failed, resulting in preimplantation lethality of these clones. In the present study, these embryos likely are characterized by compromised morphology, lack of imprinted gene expression, and little or no Gapd expression. In the second category, the egg cytoplasm has limited success at remodeling the somatic chromatin. Initially, cloned embryos survive implantation, but ultimately, abnormal phenotypes and/or lethality ensues. The stage at which these developmental defects arise may be dependent on the extent of the partial reprogramming. We suggest that reprogramming errors are established early during clonal development and that the majority of clones experience fatal reprogramming errors, resulting in major embryonic wastage by the early postimplantation stages. Finally, in the third category, reprogramming is completed to an extent that the majority of genes can be engaged in a normal pattern of expression so that development and survival of cloned animals results. We predict that all clones surviving to advanced stages or birth fall into this grouping and that, although imprinting may appear to be normal, the eventual fate of these clones will depend on the number of nonimprinted genes that still harbor reprogramming errors. Given the vast degree of embryonic wastage and the poor degree of reprogramming of both imprinted and nonimprinted genes in preimplantation embryos, it appears that cloned embryos may be rather ineffective at reprogramming the donor somatic genome.


   ACKNOWLEDGMENTS
 
We would like to thank Susan Lee and Bela Patel for technical assistance; Barney Crum and Brian Caplin for technical advice; Louis Lefebvre, Andras Nagy, and Jeff Mann for the Ascl2 polymorphism; Jacquetta Trasler for help with the Snrpn methylation assay; and Jacquetta Trasler and Marc Toppings for sharing unpublished data.


   FOOTNOTES
 
1 This research was supported by the National Institutes of Health (HD38381 and 5 T32 CA09214-20) and the Howard Hughes Medical Institute. M.R.W.M. was supported by a grant from The Lalor Foundation. R.I.V. is a Rena and Vic Damone fellow of the American Cancer Society. M.R.W.M, Y.G.C., and L.D.N. contributed equally to this work Back

2 Correspondence: Keith E. Latham, The Fels Institute for Cancer Research and Molecular Biology and Department of Biochemistry, Temple University School of Medicine, Philadelphia, PA 19140. FAX: 215 707 1454; klatham{at}temple.edu Back

Received: 18 March 2003.

First decision: 7 April 2003.

Accepted: 8 May 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Baguisi A, Behboodi E, Melican DT, Pollock JS, Destrempes MM, Cammuso C, Williams JL, Nims SD, Porter CA, Midura P, Palacios MJ, Ayres SL, Denniston RS, Hayes ML, Ziomek CA, Meade HM, Godke RA, Gavin WG, Overstrom EW, Echelard Y. Production of goats by somatic cell nuclear transfer. Nat Biotechnol 1999 17:456-461[CrossRef][Medline]
  2. Campbell KH, McWhir J, Ritchie WA, Wilmut I. Sheep cloned by nuclear transfer from a cultured cell line. Nature 1996 380:64-66[CrossRef][Medline]
  3. Chesne P, Adenot PG, Viglietta C, Baratte M, Boulanger L, Renard JP. Cloned rabbits produced by nuclear transfer from adult somatic cells. Nat Biotechnol 2002 20:366-369[CrossRef][Medline]
  4. Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J, Doguchi H, Yasue H, Tsunoda Y. Eight calves cloned from somatic cells of a single adult. Science 1998 282:2095-2098[Abstract/Free Full Text]
  5. Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T, Hanada H, Perry AC. Pig cloning by microinjection of fetal fibroblast nuclei. Science 2000 289:1188-1190[Abstract/Free Full Text]
  6. Wakayama T, Perry ACF, Zuccotti M, Johnson KR, Yanagimachi R. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 1998 394:369-373[CrossRef][Medline]
  7. Shin T, Kraemer D, Pryor J, Liu L, Rugila J, Howe L, Buck S, Murphy K, Lyons L, Westhusin M. A cat cloned by nuclear transplantation. Nature 2002 415:859[CrossRef][Medline]
  8. Boiani M, Eckardt S, Scholer HR, McLaughlin KJ. Oct4 distribution and level in mouse clones: consequences for pluripotency. Genes Dev 2002 16:1209-1219[Abstract/Free Full Text]
  9. Chung YG, Mann MR, Bartolomei MS, Latham KE. Nuclear-cytoplasmic "tug of war" during cloning: effects of somatic cell nuclei on culture medium preferences of preimplantation cloned mouse embryos. Biol Reprod 2002 66:1178-1184[Abstract/Free Full Text]
  10. Bourc'his D, Le Bourhis D, Patin D, Niveleau A, Comizzoli P, Renard J, Viegas-Pequignot E. Delayed and incomplete reprogramming of chromosome methylation patterns in bovine cloned embryos. Curr Biol 2001 11:1542-1546[CrossRef][Medline]
  11. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001 98:13734-13738[Abstract/Free Full Text]
  12. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001 28:173-177[CrossRef][Medline]
  13. Kang YK, Koo DB, Park JS, Choi YH, Kim HN, Chang WK, Lee KK, Han YM. Typical demethylation events in cloned pig embryos. Clues on species-specific differences in epigenetic reprogramming of a cloned donor genome. J Biol Chem 2001 276:39980-39984[Abstract/Free Full Text]
  14. Chung YG, Ratnam S, Chaillet JR, Latham K. Abnormal regulation of DNA methyltransferase expression in cloned mouse embryos. Biol Reprod 2003 69:146-153[Abstract/Free Full Text]
  15. Eggan K, Akutsu H, Loring J, Jackson-Grusby L, Klemm M, Rideout WM III, Yanagimachi R, Jaenisch R. Hybrid vigor, fetal overgrowth, and viability of mice derived by nuclear cloning and tetraploid embryo complementation. Proc Natl Acad Sci U S A 2001 98:6209-6214[Abstract/Free Full Text]
  16. Ogonuki N, Inoue K, Yamamoto Y, Noguchi Y, Tanemura K, Suzuki O, Nakayama H, Doi K, Ohtomo Y, Satoh M, Nishida A, Ogura A. Early death of mice cloned from somatic cells. Nat Genet 2002 30:253-254[CrossRef][Medline]
  17. Tamashiro KL, Wakayama T, Akutsu H, Yamazaki Y, Lachey JL, Wortman MD, Seeley RJ, D'Alessio DA, Woods SC, Yanagimachi R, Sakai RR. Cloned mice have an obese phenotype not transmitted to their offspring. Nat Med 2002 8:262-267[CrossRef][Medline]
  18. Tanaka S, Oda M, Toyoshima Y, Wakayama T, Tanaka M, Yoshida N, Hattori N, Ohgane J, Yanagimachi R, Shiota K. Placentomegaly in cloned mouse concepti caused by expansion of the spongiotrophoblast layer. Biol Reprod 2001 65:1813-1821[Abstract/Free Full Text]
  19. Ohgane J, Wakayama T, Kogo Y, Senda S, Hattori N, Tanaka S, Yanagimachi R, Shiota K. DNA methylation variation in cloned mice. Genesis 2001 30:45-50[CrossRef][Medline]
  20. Doherty AS, Mann MRW, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000 62:1526-1535[Abstract/Free Full Text]
  21. Szabo PE, Mann JR. Biallelic expression of imprinted genes in the mouse germ line: implications for erasure, establishment, and mechanisms of genomic imprinting. Genes Dev 1995 9:1857-1868[Abstract/Free Full Text]
  22. Schmidt JV, Matteson PG, Jones BK, Guan XJ, Tilghman SM. The Dlk1 and Gtl2 genes are linked and reciprocally imprinted. Genes Dev 2000 14:1997-2002[Abstract/Free Full Text]
  23. Thorvaldsen JL, Mann MR, Nwoko O, Duran KL, Bartolomei MS. Analysis of sequence upstream of the endogenous H19 gene reveals elements both essential and dispensable for imprinting. Mol Cell Biol 2002 22:2450-2462[Abstract/Free Full Text]
  24. Davis TL, Trasler JM, Moss SB, Yang GJ, Bartolomei MS. Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 1999 58:18-28[CrossRef][Medline]
  25. Lucifero D, Mertineit C, Clarke HJ, Bestor TH, Trasler JM. Methylation dynamics of imprinted genes in mouse germ cells. Genomics 2002 79:530-538[CrossRef][Medline]
  26. Tremblay KD, Duran KL, Bartolomei MS. A 5' 2-kilobase-pair region of the imprinted mouse H19 gene exhibits exclusive paternal methylation throughout development. Mol Cell Biol 1997 17:4322-4329[Abstract]
  27. Szabo PE, Mann JR. Allele-specific expression and total expression levels of imprinted genes during early mouse development: implications for imprinting mechanisms. Genes Dev 1995 9:3097-3108[Abstract/Free Full Text]
  28. Wakayama T, Yanagimachi R. Cloning the laboratory mouse. Semin Cell Dev Biol 1999 10:253-258[CrossRef][Medline]
  29. Heindryckx B, Rybouchkin A, Van Der Elst J, Dhont M. Effect of culture media on in vitro development of cloned mouse embryos. Cloning 2001 3:41-50[CrossRef][Medline]
  30. Ho Y, Wigglesworth K, Eppig JJ, Schultz RM. Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Mol Reprod Dev 1995 41:232-238[CrossRef][Medline]
  31. Latham KE, Doherty AS, Scott CD, Schultz RM. Igf2r and Igf2 gene expression in androgenetic, gynogenetic, and parthenogenetic preimplantation mouse embryos: absence of regulation by genomic imprinting. Genes Dev 1994 8:290-299[Abstract/Free Full Text]
  32. Lerchner W, Barlow DP. Paternal repression of the imprinted mouse Igf2r locus occurs during implantation and is stable in all tissues of the post-implantation mouse embryo. Mech Dev 1997 61:141-149[CrossRef][Medline]
  33. Rossant J, Guillemot F, Tanaka M, Latham K, Gertenstein M, Nagy A. Mash2 is expressed in oogenesis and preimplantation development but is not required for blastocyst formation. Mech Dev 1998 73:183-191[CrossRef][Medline]
  34. Shemer R, Birger Y, Riggs AD, Razin A. Structure of the imprinted mouse Snrpn gene and establishment of its parental-specific methylation pattern. Proc Natl Acad Sci U S A 1997 94:10267-10272[Abstract/Free Full Text]
  35. Humpherys D, Eggan K, Akutsu H, Hochedlinger K, Rideout WM III, Biniszkiewicz D, Yanagimachi R, Jaenisch R. Epigenetic instability in ES cells and cloned mice. Science 2001 293:95-97[Abstract/Free Full Text]
  36. Bortvin A, Eggan K, Skaletsky H, Akutsu H, Berry D, Yanagimachi R, Page DC, Jaenisch R. Incomplete reactivation of Oct4-related genes in mouse embryos cloned from somatic nuclei. Development 2003 130:1673-1680[Abstract/Free Full Text]
  37. Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprinting. Nature 1993 366:362-365[CrossRef][Medline]
  38. Davis TL, Yang GJ, McCarrey JR, Bartolomei MS. The H19 methylation imprint is erased and reestablished differentially on the parental alleles during male germ cell development. Hum Mol Genet 2000 9:2885-2894[Abstract/Free Full Text]
  39. Kang YK, Park JS, Koo DB, Choi YH, Kim SU, Lee KK, Han YM. Limited demethylation leaves mosaic-type methylation states in cloned bovine preimplantation embryos. EMBO J 2002 21:1092-1100[CrossRef][Medline]
  40. Humpherys D, Eggan K, Akutsu H, Friedman A, Hochedlinger K, Yanagimachi R, Lander ES, Golub TR, Jaenisch R. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc Natl Acad Sci U S A 2002 99:12889-12894[Abstract/Free Full Text]
  41. Inoue K, Kohda T, Lee J, Ogonuki N, Mochida K, Noguchi Y, Tanemura K, Kaneko-Ishino T, Ishino F, Ogura A. Faithful expression of imprinted genes in cloned mice. Science 2002 295:297[Free Full Text]
  42. Latham KE, Garrels JI, Solter D. Alterations in protein synthesis following transplantation of mouse 8-cell stage nuclei to enucleated 1-cell embryos. Dev Biol 1994 163:341-350[CrossRef][Medline]
  43. Kang YK, Koo DB, Park JS, Choi YH, Lee KK, Han YM. Influence of oocyte nuclei on demethylation of donor genome in cloned bovine embryos. FEBS Lett 2001 499:55-58[CrossRef][Medline]
  44. Rideout WM III, Eggan K, Jaenisch R. Nuclear cloning and epigenetic reprogramming of the genome. Science 2001 293:1093-1098[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Hum Mol GenetHome page
A. L. Fortier, F. L. Lopes, N. Darricarrere, J. Martel, and J. M. Trasler
Superovulation alters the expression of imprinted genes in the midgestation mouse placenta
Hum. Mol. Genet., June 1, 2008; 17(11): 1653 - 1665.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. M. Giraldo, D. A. Hylan, C. B. Ballard, M. N. Purpera, T. D. Vaught, J. W. Lynn, R. A. Godke, and K. R. Bondioli
Effect of Epigenetic Modifications of Donor Somatic Cells on the Subsequent Chromatin Remodeling of Cloned Bovine Embryos
Biol Reprod, May 1, 2008; 78(5): 832 - 840.
[Abstract] [Full Text] [PDF]

Home page