Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print June 11, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.015628
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/4/1432    most recent
biolreprod.103.015628v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.
Agricola
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.
BIOLOGY OF REPRODUCTION 69, 1432–1437 (2003)
DOI: 10.1095/biolreprod.103.015628
© 2003 by the Society for the Study of Reproduction, Inc.


Pregnancy

Changes in the Expression of Calcitonin Receptor-Like Receptor, Receptor Activity-Modifying Protein (RAMP) 1, RAMP2, and RAMP3 in Rat Uterus During Pregnancy, Labor, and by Steroid Hormone Treatments1

C. Thota3, P.R.R. Gangula3, Y.L. Dong3, and C. Yallampalli2,3,4

Departments of Obstetrics & Gynecology3 Anatomy & Neuroscience,4 The University of Texas Medical Branch, Galveston, Texas 77555


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Calcitonin gene-related peptide (CGRP) and its related peptide, adrenomedullin (AM), are potent smooth muscle relaxants in a variety of tissues. The CGRP has been reported to play an important role in maintaining uterine relaxation during pregnancy. We have previously reported that CGRP-induced uterine relaxation was gestationally regulated. Calcitonin receptor-like receptor (CRLR), a seven-domain transmembrane protein functions as CGRP-A receptor, in association with receptor activity-modifying protein (RAMP) 1, a single-domain transmembrane protein, whereas CRLR and RAMP2 or RAMP3 constitute a receptor for AM. In the present investigation, we examined the mRNA expression of CRLR, RAMP1, RAMP2, and RAMP3 in rat uterus (n = 8) by reverse transcriptional analysis and polymerase chain reaction to assess the changes in the expression of CGRP-A- and AM-receptor components during pregnancy and labor and by steroid hormone treatments in adult ovariectomized rats. The changes in mRNA are expressed relative to the 18S mRNA in the uterus of rats at various stages: nonpregnant, pregnant on Day 18, spontaneous labor at term, Day 2 postpartum, and in pregnant rats on treatment with RU486. Ovariectomized rats treated for 3 days twice daily s.c. with estradiol-17ß (2.5 µg/injection), progesterone (2 mg/injection), and the combination of estradiol-17ß and progesterone (same doses as above) were also examined for the expression of various receptor components. Results showed that mRNA expression of the receptor components was significantly higher (P < 0.001 for CRLR, P < 0.01 for RAMP1, P < 0.05 for RAMP2, and P < 0.01 for RAMP3) in pregnant compared to nonpregnant rats. Except for RAMP3, expression of all the other three genes decreased significantly (P < 0.05) during labor. A progesterone antagonist, RU486 significantly decreased (P < 0.01 for CRLR, P < 0.05 for RAMP1, RAMP2, and RAMP3) all the receptor components during pregnancy. In adult ovariectomized rats, progesterone caused significant increases in CRLR (P < 0.001), RAMP1 (P < 0.05), and RAMP2 (P < 0.01). Levels of RAMP3 were unaffected by the progesterone treatment. Estradiol-17ß treatment decreased all of the four receptor components significantly (P < 0.01 for CRLR, P < 0.05 for RAMP1, RAMP2, and RAMP3). Our results demonstrate that both CGRP and AM may play a role in uterine quiescence during pregnancy and that their receptor components are regulated by the steroid hormones.

neuropeptides, parturition, pregnancy, steroid hormones, uterus


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Regulation of myometrial contractions is of paramount importance in the maintenance of pregnancy and in the process of labor and parturition. The uterus remains quiescent during gestation. At term, a series of biochemical and physiological changes in the uterus cause increased contractions, leading to parturition. The switch from a state of relative quiescence during pregnancy to a muscle that is spontaneously active at term results from many changes in the uterus, including the coordinated expression of contraction-associated proteins. These proteins include oxytocin [14], endothelin [5, 6], and prostaglandin (PG) FP [7] receptors that cause increased uterine contractions and connexin 43 that facilitates coordinated muscle contractions at the end of pregnancy [8]. In addition, increases in PGF2{alpha} synthesis also stimulate myometrial contractions and alter hormone synthesis at term [9]. In the pregnant rat, many of these changes appear to result from an increase in the estrogen:progesterone ratio at term. However, the significance of the factors that are involved in the maintenance of uterine quiescence during pregnancy before term is not well understood. These factors include nitric oxide (NO) and calcitonin gene-related peptide (CGRP). We and others have reported that NO is generated in the uterus and that both the production of NO and the relaxation sensitivity of uterus to NO are elevated during pregnancy and decreased at term [1012].

The CGRP is a potent vasodilator [13]. Myometrial contractions are inhibited by CGRP in rats [14], humans [15], and mice [16], and these inhibitory effects of CGRP are substantially higher during pregnancy [14, 15]. At term during labor, the uterine relaxation sensitivity to CGRP is reduced, indicating a role for CGRP in maintaining uterine quiescence during pregnancy [14, 15]. In addition, serum CGRP levels were reported to increase during pregnancy and by sex steroid hormone treatment in female rats [17]. Changes in the myometrial relaxation sensitivity to CGRP appear to result from variations in its binding sites [14, 18]. Uterine CGRP-binding sites were elevated by progesterone and decreased by antiprogesterone [18], suggesting that the decline in CGRP-binding sites at term in rats may be related to the elevated estradiol:progesterone ratio. However, characterization of CGRP receptors and their changes in the uterus during pregnancy and labor are not well understood.

According to recent reports [19, 20], CGRP appears to mediate its effects by two receptors, CGRP-A and CGRP-B. The CGRP-B receptor [18, 21] was found to increase during pregnancy and to decrease at term labor [18] in rat uterus. The CGRP-A receptor consists of calcitonin receptor-like receptor (CRLR) and receptor activity-modifying protein (RAMP) 1 [22]. On the other hand, CRLR, together with either RAMP2 or RAMP3, would function as a receptor for adrenomedullin (AM) [22]. In addition to CGRP, plasma levels of AM (a 52-amino acid, hypotensive peptide) were also reported to be elevated during pregnancy [23]. Furthermore, AM has been reported to inhibit galanin-induced contractions of rat uterus [24], suggesting its involvement in the relaxation of uterus during pregnancy. However, changes in CRLR, RAMP1, RAMP2, and RAMP3 in the rat uterus during pregnancy and parturition are not known. Therefore, the present study was designed to assess the changes in the mRNA expression of both CGRP-A- and AM-receptor components in the uterus during pregnancy and labor and by steroid hormone treatments in adult ovariectomized (ovx) rats.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Treatments

Adult nonpregnant (body wt, 200–210 g) and time-mated pregnant Sprague-Dawley rats were purchased from Harlan Sprague Dawley (Houston, TX) and maintained on a 12L:12D photoperiod. Animals received an ad libitum supply of rat chow and water. Time-mated rats were killed on Day 18, during labor (one to three pups delivered), and on Day 2 postpartum. In addition, one group of nonpregnant rats at the diestrous stage was also killed. A group of pregnant rats on Day 18 were injected s.c. with a single dose of a progesterone antagonist, RU486 (10 mg/rat; Biomol, Plymouth Meeting, PA), and killed at 24 h after injection. Vehicle for steroid treatments (sesame oil; Sigma Chemical Co., St. Louis, MO) was injected (0.2 ml) into control animals.

In another set of experiments, virgin female adult rats underwent bilateral ovariectomy under general anesthesia using ketamine (45 mg/kg; Fort Dodge Laboratory, Fort Dodge, IA) and xylazine (5 mg/kg; Burns Veterinary Supply, New York, NY). Seven days later, the ovx rats received one of four different treatments for 3 days: 1) estradiol-17ß (2.5 µg/injection, twice daily s.c.); 2) progesterone (2 mg/injection, twice daily s.c.); 3) estradiol-17ß + progesterone (same dose and frequency as above); and 4) vehicle (sesame oil). All animals were killed in a CO2 inhalation chamber; the uteri were removed, cleaned, frozen immediately in liquid nitrogen, and stored at -70°C until used. All procedures were approved by the Animal Care and Use Committee of the University of Texas Medical Branch.

Isolation of Total RNA and Reverse Transcription

Total RNA was isolated from full-thickness uterine tissues using TRIzol (Life Technologies, Grand Island, NY). The quality and the quantity of the RNA were assessed at A 260/280, and all samples showed absorbency ratios ranging between 1.6 and 2.0. For reverse transcription (RT), 2 µg of total RNA were mixed with 3.0 nmol of random primer (Invitrogen, Carlsbad, CA), 200 µM dNTP solution (Sigma), and 10 U of AMV reverse transcriptase (Promega, Madison, WI) in the presence of 5 U of RNase inhibitor (Invitrogen) and placed in a thermal cycler for one cycle at 28°C for 15 min, 42°C for 30 min, 99°C for 5 min, and 4°C for 5 min.

Polymerase Chain Reaction

Polymerase chain reaction (PCR) of the cDNA was initiated by the published primers for CRLR and RAMP1 [22]. Primers for RAMP2 and RAMP3 were designed using their respective gene sequences from the GenBank database. Primer sequences are as follows: CRLR: forward, 5' TGCTCTGTGAAGGCATTTAC 3', and reverse, 5' CAGAATTGCTTGAACCTCTC 3'; RAMP1: forward, 5' GAGACGCTGTGGGTGACTG 3', and reverse, 5' TCGGCTACTCTGGACTCCTG 3'; RAMP2: forward, 5' GCTGTTACTGCTGCTGTTGC 3', and reverse, 5' GTCTGCCTCGTACTCCAAGC 3'; and RAMP3: forward, 5' CTTCTCCCTCTGTTGCTGCT 3', and reverse, 5' GTCCTGTCCACAGTGCAGTT 3'. Primers for 18S were obtained from Ambion, Inc. (Austin, TX). The PCRs were performed using 2.5 µl of cDNA. Complementary DNA was mixed with a PCR mixture containing 2.5 mM MgCl2, 1x PCR buffer, 200 µM dNTPs mix, and 300 nM forward and reverse primers for CRLR and RAMP1. For 18S, 2 µl of primer pair were used according to the supplier's specifications. The PCRs for CRLR, RAMP1, RAMP2, RAMP3, and 18S were carried out in a GeneAmp PCR system 9700 (Perkin-Elmer, Norwalk, CT) with the following conditions: An initial denaturation step at 95°C for 5 min was followed by 35 cycles of 30 sec at 95°C, 90 sec at 60°C, and 30 sec at 72°C. Reaction conditions for PCR of RAMP2 and RAMP3 were similar except that the annealing temperature was 63°C. All the reactions were terminated by a 7-min long elongation step at 72°C. Total cycle number was chosen for each gene from the linear portion of their respective curve.

Electrophoresis and Gel Imaging

The PCR products were visualized on 1.6% agarose gels containing 0.5 µg/ml of ethidium bromide and run for 1.5 h at 100 V in 0.5x Tris-borate-EDTA buffer. The DNA signals on the gel were imaged under ultraviolet light using a Polaroid camera (Photodyne, Inc., New Berlin, WI), and density-gradient measurements were performed using the FluorChem digital imaging system (Alpha Innotech Corporation, San Leandro, CA). The levels of expression of CRLR, RAMP1, RAMP2, and RAMP3 were calculated as a ratio to their respective 18S values. The identity of the amplified sequences was verified by sequencing the gel-extracted PCR product. All receptor components showed 100% homology with their respective published sequences (data not shown). Negative controls were run in PCR using total RNA in place of cDNA, and no signal was detectable when run on agarose gel (data not shown).

Statistical Analysis

Results are shown as the mean ± SEM of eight determinations. Statistical significance was determined by the Student t-test. A P value of less than 0.05 was considered to be statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Changes in CRLR, RAMP1, RAMP2, and RAMP3 in Rat Uterus During Pregnancy and Parturition

Expression of CRLR, RAMP1, RAMP2, and RAMP3 mRNA in the rat uterus was determined by RT-PCR analysis, and the level of mRNA for these component proteins was determined relative to 18S mRNA in the uterus from each animal. Comparisons were made in the mRNA expression among groups of rats on Day 18 of gestation, during spontaneous labor at term, and on Day 2 postpartum and among nonpregnant rats. The CRLR mRNA in the rat uterus (Fig. 1) showed a significant increase (P < 0.001) during pregnancy compared to the nonpregnant levels. These levels declined significantly (P < 0.01) at term labor and on Day 2 postpartum compared to the pregnant levels. Expression of RAMP1 mRNA in the uterus was also significantly higher in pregnant (P < 0.01) compared to nonpregnant and in-labor rats. The RAMP2 mRNA levels in the uterus were significantly higher (P < 0.05) in pregnant compared to nonpregnant rats (Fig. 1). The levels of RAMP2 mRNA declined (P < 0.05) during labor compared to pregnant levels. The RAMP3 mRNA expression was significantly higher (P < 0.01) in pregnant compared to nonpregnant rat uterus (Fig. 1); however, the RAMP3 mRNA levels at labor were similar to the pregnant levels.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 1. Expression of CRLR, RAMP1, RAMP2, and RAMP3 in the uterus of nonpregnant (NP), pregnant (PREG), delivery (DEL), and Postpartum Day 2 (PP) rats. Uterine tissues were collected from rats that were nonpregnant and in diestrus or pregnant on Day 18, during delivery, and on Day 2 postpartum. Representative samples (top) are shown for the uterine mRNA expression of (A) CRLR, (B) RAMP1, (C) RAMP2, and (D) RAMP3 analyzed by RT-PCR technique using appropriate primers. Messenger RNA for 18S in the respective samples was also analyzed. The DNA size markers (M; 100 base pairs [bp]) are shown in the left lane. Also shown (bottom) is the mean ± SEM of the ratios between individual PCR products and respective 18S mRNA densitometric values from eight rats per group. Groups with different letters at the top of the bars vary significantly (P < 0.05–0.001). CRLR: P < 0.001 for a vs. b, P < 0.001 for a vs. c, and P < 0.01 for b vs. c; RAMP1: P < 0.01 for a vs. b, P < 0.05 for a vs. c, and P < 0.01 for b vs. c; RAMP2: P < 0.001 for a vs. b, P < 0.05 for a vs. c, and P < 0.05 for b vs. c; RAMP3: P < 0.01 for a vs. b and P < 0.05 for a vs. c

Effect of RU486 on Uterine CRLR, RAMP1, RAMP2, and RAMP3 mRNA in Pregnant Rats

To assess the role of endogenous progesterone during pregnancy in the maintenance of mRNA for CRLR, RAMP1, RAMP2, and RAMP3, RU486 was injected s.c. on Day 18 of gestation. The levels of mRNA observed in the rat uterus were significantly lower for CRLR (P < 0.01) and for RAMP1, RAMP2, and RAMP3 (P < 0.05) at 24 h after RU486 treatment compared to the vehicle-treated controls (Fig. 2).



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2. Effect of antiprogesterone, RU486, on the expression of CRLR, RAMP1, RAMP2, and RAMP3 in the uterus of pregnant rats. Uterine tissues were collected from Day 18 pregnant rats at 24 h after treatment with vehicle or RU486. Representative samples (top) are shown for the uterine mRNA expression of (A) CRLR, (B) RAMP1, (C) RAMP2, and (D) RAMP3 analyzed by RT-PCR technique using appropriate primers. Messenger RNA for 18S in the respective samples was also analyzed. The DNA size markers (M; 100 base pairs [bp]) are shown in the left lane. Also shown (bottom) is the mean ± SEM of the ratios between individual PCR products and respective 18S mRNA densitometric values from eight rats per group. Asterisks indicate significant differences (*P < 0.05, **P < 0.01) from the Day 18 pregnant (vehicle) group

Effect of Steroid Hormones on Concentrations of mRNA for CRLR, RAMP1, RAMP2, and RAMP3 in the Uterus of Nonpregnant Rats

To assess the pregnancy-independent effects of sex steroid hormones on uterine mRNA levels for CRLR, RAMP1, RAMP2, and RAMP3, adult ovx rats were treated with progesterone, estrogen, or estrogen in combination with progesterone. Progesterone treatment in adult ovx rats caused significant elevation in mRNA expression for CRLR (P < 0.01) and for RAMP1 and RAMP2 (P < 0.01), but not for RAMP3 (Fig. 3). Estradiol-17ß treatment, on the other hand, caused inhibition in the expression of mRNA for CRLR (P < 0.01) and for RAMP1, RAMP2, and RAMP3 (P < 0.05). The estradiol-17ß-induced decline in mRNA expression of CRLR, RAMP1, RAMP2, and RAMP3 in the ovx rats was also significant (P < 0.05) compared to the expression in progesterone- or in progesterone- and estradiol-17ß-treated rats.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 3. Effects of estradiol-17ß and progesterone on the expression of CRLR, RAMP1, RAMP2, and RAMP3 in ovx rats. Uterine tissues were collected from ovx rats at 72 h after treatment with either sesame oil (vehicle) alone or with estradiol-17ß (E2), progesterone (P4), or E2 + P4. Representative samples (top) are shown for the uterine mRNA expression of (A) CRLR, (B) RAMP1, (C) RAMP2, and (D) RAMP3 analyzed by RT-PCR technique using appropriate primers. Messenger RNA for 18S in the respective samples was also analyzed. The DNA size markers (M; 100 base pairs [bp]) are shown in the left lane. Also shown (bottom) is the mean ± SEM of the ratios between individual PCR products and respective 18S mRNA densitometric values from eight rats per group. Groups with different letters at the top of the bars vary significantly (P < 0.05–0.001). CRLR: P < 0.001 for a vs. b, P < 0.01 for a vs. c, and P < 0.05 for b vs. c; RAMP1: P < 0.05 for a vs. b, P < 0.05 for a vs. c, and P < 0.05 for b vs. c; RAMP2: P < 0.05 for a vs. b, P < 0.05 for a vs. c, and P < 0.05 for b vs. c; RAMP3: P < 0.05 for a vs. b


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present studies demonstrated that the expression of mRNA for CRLR and RAMP1 increases during pregnancy and in adult ovx rats treated with progesterone. Both CRLR and RAMP1 mRNA levels decreased at term compared to pregnant levels and in pregnant rats treated with a progesterone antagonist, RU486. The present studies also showed that estradiol-17ß treatment in ovx rats decreased the mRNA expression of both CRLR and RAMP1. Expression of mRNA for RAMP2 and RAMP3 also increased during pregnancy in the rat uterus. Levels of RAMP2 mRNA during pregnancy declined with the onset of labor, whereas RAMP3 mRNA levels remained elevated. Progesterone treatment in adult ovx rats increased RAMP2, but not RAMP3, mRNA expression. Treatment with RU486 caused decreases in both RAMP2 and RAMP3 mRNA expression in pregnant rats. The levels of CRLR, the core component of both CGRP-A and AM receptors, as well as the levels of RAMP1 and RAMP2, are elevated during pregnancy and decreased with labor. We suggest that in addition to CGRP, AM may regulate uterine relaxation during pregnancy. These data, together with the previous studies [14, 18], suggest that both CGRP and AM may play a role in the maintenance of uterine quiescence during pregnancy and that a decrease in progesterone and an increase in estrogen levels at term in rats could regulate these functions.

Expression of the CGRP-A-receptor components, CRLR and RAMP1, in rat uterus was increased during pregnancy and decreased at labor in the present study. These increases paralleled the reported changes in CGRP-induced inhibitor effects on uterine contractility [14]. Binding of [125I]CGRP also increased during pregnancy and decreased at term labor, suggesting that the functional receptors for CGRP are increased during pregnancy and decreased at term labor [18]. Decline in the CGRP receptor-related inhibitory effects of CGRP on contractility [14] coincides with the upregulation of stimulatory factors of uterine contraction [6, 8, 9] at term. Expression of CRLR and RAMP1 mRNA was increased during pregnancy and decreased during spontaneous labor at term as well as during RU486-induced preterm labor, suggesting that both the components of CGRP-A receptor, CRLR and RAMP1, are regulated during pregnancy and labor. Dynamic changes in the estrogen:progesterone ratio occur at term in pregnant rats. Increases in estrogen with decreases in progesterone may trigger the decline in CGRP-A receptors, thus facilitating labor and delivery of the fetus.

Progesterone treatment caused significant increases in CRLR and RAMP1 expression, whereas estrogen treatment decreased CRLR and RAMP1 mRNA expression, in adult ovx rats in the present studies. Binding of [125I]CGRP also increased in ovx rats treated with progesterone [18], suggesting that progesterone may be responsible for the upregulation of CGRP-receptor expression during pregnancy. Decreases in CRLR and RAMP1 mRNA levels with estrogen in the present study further supports the hypothesis that elevated estrogen with a fall in progesterone levels at term may induce substantial decreases in CGRP-A-receptor concentration in the uterus of pregnant rats. Therefore, CGRP-A receptors appear to play an important role in maintaining quiescence of uterus during pregnancy, when their expression is elevated, and by decreasing CGRP-induced inhibition of uterine contractility at term, when their expression is decreased.

Previous studies using monoclonal antibody to affinity-purified CGRP-receptor protein (CGRP-B) from porcine cerebellum [25], which is unrelated to CRLR [19, 20, 26], showed that CGRP-B receptors in the rat uterus increase during pregnancy and decrease at term [18]. Progesterone treatment of adult ovx rats caused an increase in these receptors in the uterus, whereas estrogen had no significant effects. These changes in CGRP-B receptors in the uterus of pregnant and progesterone-treated adult ovx rats are similar to the changes in CGRP-A-receptor mRNA levels observed in the present investigation. Increase in CGRP-A (present study) and -B [18] receptors observed in pregnant and in progesterone-treated adult ovx rats suggests that progesterone upregulates both these receptors during pregnancy and, therefore, that progesterone could be responsible for maintenance of CGRP-related uterine quiescence during pregnancy. Additionally, an increase in estrogen at term could induce a fall in CGRP-A receptors in the uterus and, thus, attenuate CGRP-related uterine relaxation and facilitate labor and delivery.

In association with either RAMP2 or RAMP3, CRLR forms an AM receptor [22]. In the present study, both RAMP2 and RAMP3 mRNA levels were increased during pregnancy. Whereas RAMP2 expression decreased at labor, RAMP3 expression was not different from the pregnant level. Treatment with RU486 in pregnant rats decreased the expression of both RAMP2 and RAMP3 mRNA. Although progesterone treatment was without significant effect on RAMP3, it increased RAMP2 expression in ovx rats. Because CRLR can form AM receptors with either RAMP2 or RAMP3, we suggest that AM could also play a role in maintaining uterine relaxation during pregnancy. In support of a role for AM in uterine relaxation, the plasma levels of AM were also reported to increase during pregnancy [23]. Specific and pharmacologically distinct binding sites were reported for both AM and CGRP in rat uterus [24]. The density of these AM-binding sites in the uterus were found to be approximately 10-fold higher in the pregnant compared with the nonpregnant rats, indicating pregnancy-related regulation of AM receptor. Galanin-induced uterine contractions were inhibited by both CGRP and AM [24], suggesting their involvement in uterine relaxation during pregnancy. However, in the same study, effects of both CGRP and AM are reported to be abolished by pretreatment of rat uterine tissue with CGRP8–37, suggesting that the contractile effects of both peptides are mediated by a related receptor or receptor component(s). Because CRLR is the common component of both CGRP-A and AM receptors, CRLR may play a significant role in uterine relaxation during pregnancy. The RAMP1 and RAMP2 mRNA levels in the uterus were also elevated both during pregnancy and with progesterone treatment and were decreased with term and RU486-induced preterm labor, further supporting roles for both CGRP and AM in the regulation of uterine contractility. The present studies further suggest that progesterone-related increases in both CGRP-A and AM receptors in the rat uterus may be involved in maintaining uterine quiescence during pregnancy. Decreases in progesterone and increases in estrogen levels at term could downregulate these receptors in the uterus and, thus, facilitate initiation of labor and delivery.

Although the present study clearly demonstrates the pregnancy- and parturition-related changes in mRNA for CRLR and RAMPs in rat uterus, it is unclear if these changes in mRNA reflect in the protein levels and in their location in the uterus. Our previous report indicated that myometrium appeared to be the primary site for abundant CGRP-binding sites [18]. However, further studies are required to fully assess the changes in proteins for various receptor components and their location in the uterus.

In summary, both CGRP-A- and AM-receptor components in the rat uterus are elevated during pregnancy and are decreased at term and RU486-induced preterm labor. Progesterone increased, whereas estrogen inhibited, the levels of these receptors, indicating regulation by steroid hormones. Therefore, changes in both CGRP-A- and AM-receptor levels in the uterus may play a role in maintaining uterine quiescence during pregnancy.


    ACKNOWLEDGMENTS
 
We thank Ms. Kimberly Mitchell for typing this manuscript.


    FOOTNOTES
 
1 Supported, in part, by NIH through grants HL-72650, HL-58144, and HD-40828. Back

2 Correspondence: Chandrasekhar Yallampalli, The University of Texas Medical Branch, Department of Obstetrics & Gynecology, 301 University Boulevard, Galveston, Texas 77555-1062. FAX: 409 747 0475; chyallam{at}utmb.edu Back

Received: 17 January 2003.

First decision: 10 February 2003.

Accepted: 23 May 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fuchs AR. Plasma membrane receptors regulating myometrial contractility and their hormonal modulation. Semin Perinatol 1995 19:15-30[CrossRef][Medline]
  2. Kimura T. Regulation of the human oxytocin receptor in the uterus: a molecular approach. Hum Reprod Update 1998 4:615-624[Abstract/Free Full Text]
  3. Chibbar R, Wong S, Miller FD, Mitchell BF. Estrogen stimulates oxytocin gene expression in human chorio-decidua. J Clin Endocrinol Metab 1995 80:567-572[Abstract]
  4. Wathes DC, Borwick SC, Timmons PM, Leung ST, Thornton S. Oxytocin receptor expression in human term and preterm gestational tissues prior to and following the onset of labor. J Endocrinol 1999 161:143-151[Abstract]
  5. Yallampalli C, Garfield RE. Uterine contractile responses to endothelin (ET-1) and ET receptors are elevated during labor. Biol Reprod 1994 51:640-645[Abstract]
  6. Sakamoto S, Aso T, Masuda H, Goto M, Tameoki S, Azuma H. Gestational changes in endothelin-1-induced receptors and myometrial contractions in rat. Mol Hum Reprod 1999 5:270-276[Abstract/Free Full Text]
  7. Dong YL, Yallampalli C. Pregnancy and exogenous steroid treatments modulate the expression of relaxant EP2 and contractile FP receptors in the rat uterus. Biol Reprod 2000 62:533-539[Abstract/Free Full Text]
  8. Garfield RE, Ali M, Yallampalli C, Izumi H. Role of gap junctions and nitric oxide in control of myometrial contractility. Semin Perinatol 1995 19:41-51[CrossRef][Medline]
  9. Motta AB, Franchi AM, Gimeno AL, Gimeno MA. Influence of oxytocin on the synthesis of prostaglandins by uterus from rats in different stages of the estrous cycle. Prostaglandins Leukot Essent Fatty Acids 1994 51:133-139[CrossRef][Medline]
  10. Natuzzi ES, Ursell PC, Harrison M, Buscher C, Riemer RK. Nitric oxide synthase activity in the pregnant uterus decreases at parturition. Biochem Res Commun 1993 194:1-8
  11. Dong YL, Gangula PRR, Yallampalli C. Nitric oxide synthase isoforms in rat uterus: differential regulation during pregnancy and labor. J Reprod Fertil 1996 107:249-254[Abstract/Free Full Text]
  12. Yallampalli C, Dong YL, Gangula PRR, Fang L. Role and regulation of nitric oxide in the uterus during pregnancy and parturition. J Soc Gynecol Invest 1998 5:58-67[CrossRef][Medline]
  13. Brain SD, Williams TJ, Tippins HR, Morris JR, MacIntyre I. Calcitonin gene-related peptide is a potent vasodilator. Nature 1985 313:54-56[CrossRef][Medline]
  14. Dong YL, Gangula PRR, Fang L, Wimalawansa SJ, Yallampalli C. Uterine relaxation responses to calcitonin gene-related peptide and calcitonin gene-related peptide receptors decreased during labor in rats. Am J Obstet Gynecol 1998 179:497-506[CrossRef][Medline]
  15. Dong YL, Fang L, Kondapaka S, Gangula PR, Wimalawansa SJ, Yallampalli C. Involvement of calcitonin gene-related peptide in the modulation of human myometrial contractility during pregnancy. J Clin Invest 1999 104:559-565[Medline]
  16. Naghashpour M, Dahl G. Relaxation of myometrium by calcitonin gene-related peptide is independent of nitric oxide synthase activity in mouse uterus. Biol Reprod 2000 63:1421-1427[Abstract/Free Full Text]
  17. Gangula PR, Wimalawansa SJ, Yallampalli C. Pregnancy and sex steroid hormones enhance circulating calcitonin gene-related peptide concentrations in rats. Hum Reprod 2000 15:949-953[Abstract/Free Full Text]
  18. Yallampalli C, Gangula PRR, Kondapaka S, Fang L, Wimalawansa SJ. Regulation of calcitonin gene-related peptide receptors in the rat uterus during pregnancy, labor and by progesterone. Biol Reprod 1999 61:1023-1030[Abstract/Free Full Text]
  19. Yallampalli C, Chauhan M, Thota CS, Kondapaka SB, Wimalawansa SJ. Calcitonin gene-related peptide in pregnancy and its emerging receptor heterogeneity. Trends Endocrinol Metab 2002 13:263-269[CrossRef][Medline]
  20. Chauhan M, Thota CS, Kondapaka S, Wimalawansa SJ, Yallampalli C. Evidence for the existence of a new receptor for CGRP, which is not CRLR. Peptides 2003 24:65-71[CrossRef][Medline]
  21. Wimalawansa SJ. Amylin, calcitonin gene-related peptide, calcitonin, and adrenomedullin: a peptide superfamily. Crit Rev Neurobiol 1997 11:167-239[Medline]
  22. McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, Solari R, Lee MG, Foord SM. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 1998 393:333-339[CrossRef][Medline]
  23. Jerat S, Kaufman S. Effect of pregnancy and steroid hormones on plasma adrenomedullin levels in rat. Can J Physiol Pharmacol 1998 76:463-466[CrossRef][Medline]
  24. Upton PD, Austin C, Taylor GM, Nandha KA, Clark AJ, Ghatei MA, Bloom SR, Smith DM. Expression of adrenomedullin (ADM) and its binding sites in the rat uterus: increased number of binding sites and ADM messenger ribonucleic acid in 20-day pregnant rats compared with nonpregnant rats. Endocrinology 1997 138:2508-2514[Abstract/Free Full Text]
  25. Morara S, Wimalawansa SJ, Rosina A. Monoclonal antibodies reveal expression of the CGRP receptor in Purkinje cells, interneurons and astrocytes of rat cerebellar cortex. Neuroreport 1998 9:3755-3759[Medline]
  26. Fluhmann B, Lauber M, Lichtensteiger W, Fischer JA, Born W. Tissue-specific mRNA expression of a calcitonin receptor-like receptor during fetal and postnatal development. Brain Res 1997 774:184-192[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
M. Chauhan, G. R. Ross, U. Yallampalli, and C. Yallampalli
Adrenomedullin-2, a Novel Calcitonin/Calcitonin-Gene-Related Peptide Family Peptide, Relaxes Rat Mesenteric Artery: Influence of Pregnancy
Endocrinology, April 1, 2007; 148(4): 1727 - 1735.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
E. Marinoni, C. Zacharopoulou, A. Di Rocco, C. Letizia, M. Moscarini, and R. Di Iorio
Effect of Betamethasone In Vivo on Placental Adrenomedullin in Human Pregnancy
Reproductive Sciences, September 1, 2006; 13(6): 418 - 424.
[Abstract] [PDF]


Home page
Hum ReprodHome page
Q. Xu, N. Ohara, W. Chen, J. Liu, H. Sasaki, A. Morikawa, R. Sitruk-Ware, E. D.B. Johansson, and T. Maruo
Progesterone receptor modulator CDB-2914 down-regulates vascular endothelial growth factor, adrenomedullin and their receptors and modulates progesterone receptor content in cultured human uterine leiomyoma cells
Hum. Reprod., September 1, 2006; 21(9): 2408 - 2416.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Zhang, I. M. Dickerson, and A. F. Russo
Calcitonin Gene-Related Peptide Receptor Activation by Receptor Activity-Modifying Protein-1 Gene Transfer to Vascular Smooth Muscle Cells
Endocrinology, April 1, 2006; 147(4): 1932 - 1940.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
H Watanabe, E Takahashi, M Kobayashi, M Goto, A Krust, P Chambon, and T Iguchi
The estrogen-responsive adrenomedullin and receptor-modifying protein 3 gene identified by DNA microarray analysis are directly regulated by estrogen receptor
J. Mol. Endocrinol., February 1, 2006; 36(1): 81 - 89.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. R. Ross, M. Chauhan, P. R. Gangula, L. Reed, C. Thota, and C. Yallampalli
Female Sex Steroids Increase Adrenomedullin-Induced Vasodilation by Increasing the Expression of Adrenomedullin2 Receptor Components in Rat Mesenteric Artery
Endocrinology, January 1, 2006; 147(1): 389 - 396.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Thota and C. Yallampalli
Progesterone Upregulates Calcitonin Gene-Related Peptide and Adrenomedullin Receptor Components and Cyclic Adenosine 3'5'-Monophosphate Generation in Eker Rat Uterine Smooth Muscle Cell Line
Biol Reprod, February 1, 2005; 72(2): 416 - 422.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/4/1432    most recent
biolreprod.103.015628v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.
Agricola
Right arrow Articles by Thota, C.
Right arrow Articles by Yallampalli, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS