Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print August 6, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.019471
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/6/1979    most recent
biolreprod.103.019471v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.
Agricola
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.
BIOLOGY OF REPRODUCTION 69, 1979–1988 (2003)
DOI: 10.1095/biolreprod.103.019471
© 2003 by the Society for the Study of Reproduction, Inc.


Mechanisms of Hormone Action

Cyclic Adenosine Monophosphate (cAMP) Stimulation of the Kit Ligand Promoter in Sertoli Cells Requires an Sp1-Binding Region, a Canonical TATA Box, and a cAMP-Induced Factor Binding to an Immediately Downstream GC-Rich Element1

Paola Grimaldi2, Federica Capolunghi, Raffaele Geremia, and Pellegrino Rossi

Department of Public Health and Cell Biology, Section of Anatomy, University of Rome Tor Vergata, 00133 Rome, Italy


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of Kit ligand (KL) mRNA is induced in primary prepuberal Sertoli cells by FSH and by other agents that increase cAMP levels. The cAMP effect is exerted at the transcriptional level and appears to be cell type specific, since it is not observed in other KL-expressing primary cells or cell lines. Deletion analysis of the 5'-flanking region of the mouse KL gene shows that the proximal promoter sequence between -88 and +8 from the transcriptional start site is necessary and sufficient to obtain the full cAMP responsiveness of the promoter in primary mouse Sertoli cells. In the -88/+8 promoter region, several cis-acting elements play a role in cAMP response. The -88/-56 sequence is necessary for full induction of the gene, since its removal causes a drastic decrease in cAMP responsiveness; however, cAMP-stimulated expression is still observed with the minimal promoter region between -55 and +8. A more detailed mutational analysis of the minimal promoter region shows that mutations in the canonical TATA box sequence and in an immediately downstream GC-rich element completely abolish cAMP responsiveness. DNA-binding experiments show that transcription factor Sp1 binds to the -88/-56 fragment of the KL proximal promoter in both control and cAMP-stimulated cells, whereas a new cAMP-induced complex is observed when the -55/+8 minimal promoter region is used as probe. The canonical TATA box sequence is essential for formation of the latter complex. We also show that the binding of an unknown nuclear factor (different from Sp1, Egr-1, Rnf6, and AP-2) to a GC-rich element between -19 and +8 increases after cAMP treatment, and this effect seems to be specific of primary Sertoli cells. Thus, cAMP-induced transcription from the KL gene promoter in primary mouse Sertoli cells is mediated by a complex interaction among a Sp1-binding region, factors recognizing the canonical TATA box sequence, and a not yet identified cAMP-induced factor binding a GC-rich sequence just downstream from it.

cAMP, FSH, mechanisms of hormone action, Sertoli cells, spermatogenesis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the adult mouse testis, Kit ligand (KL, also named stem cell factor, steel factor, and mast cell growth factor) is produced by the Sertoli cells [1, 2], whereas its receptor (the transmembrane tyrosine kinase encoded by the c-kit proto-oncogene) is expressed predominantly in differentiating type A spermatogonia, in Leydig cells, and, at a lower level, in type B spermatogonia and in early spermatocytes but not in undifferentiated spermatogonia (i.e., spermatogonial stem cells) or in postmeiotic germ cells [37]. The interaction of KL with its receptor causes the activation of a signal transduction pathway that is required for the proliferation and the survival of mitotic germ cells both in the embryonal gonad [8] and in the postnatal testis [2, 5, 914]. KL might also be involved in the control of meiotic differentiation of male germ cells [15].

In Steel17H mutant mice, a specific alteration in the KL gene causes defects selectively in spermatogenesis but not in other KL-regulated processes, such as hematopoiesis, pigmentation, development of primordial germ cells, and oocyte maturation [16]. Recent evidence supports an essential role of KL activated signaling pathways for normal spermatogenesis, since homozygous mutations in the PI3K docking site of c-kit cause male sterility due to a block of spermatogonial proliferation in prepuberal mice, whereas, again, no major defects are observed in other KL-targeted cells [11, 12].

The role of KL in human spermatogenesis is unknown; although in human testis KL is produced by Sertoli cells [17], its receptor, c-kit, is expressed in spermatogonia [17, 18], and reduced levels of KL in the seminal plasma seem to correlate with reduced sperm cell number [19]. Since KL plays a fundamental role in mouse testis for the proliferation and survival of spermatogonia, studies about the regulation of KL gene expression might be useful for understanding at least some cases of human infertility.

Expression of the mRNA for KL is induced by the pituitary hormone FSH in prepuberal mouse and rat Sertoli cells through an increase of cAMP levels [1, 2, 20]. Paracrine factors secreted in the microenvironment of the seminiferous tubules are also probably important for modulation of KL expression in Sertoli cells, and at least one of these factors that has been identified in rats, growth hormone releasing hormone (GHRh), works through an increase in cAMP levels [21].

Studies on the regulation of KL gene transcription in Sertoli cells have been performed after cloning the 5'-flanking region of the KL gene in three different species, using transfection experiments. In the human KL promoter, a proximal region, extending up to nucleotide -162 from the transcriptional start site, has been shown to mediate the cAMP activation of the gene in the human Sertoli cell line SF7 [22]. In the 5'-flanking region of rat KL gene, a -119/+43 fragment has been demonstrated to be sufficient for promoter activity and for transcriptional activation in response to cAMP and forskolin in primary cultures of rat Sertoli cells [23]. The 5'-flanking region of the mouse KL gene has also been cloned [24], and our preliminary observations indicate that the promoter region spanning from nucleotides -407 to +35 is transcriptionally active in primary cultures of mouse Sertoli cells and is strongly stimulated by FSH or cAMP analogs [25]. Thus, the proximal promoter regions of the KL genes in human, rat, and mouse contain elements that mediate cAMP induction of KL gene in Sertoli cells. The lack of CRE sequences [26] in the proximal 5'-flanking regions of all these genes suggests that cAMP-induced KL expression in Sertoli cells is mediated by transcription factors different from the cAMP response element (CRE) binding protein in all these species.

To gain a better understanding of the mechanisms that regulate the cAMP-stimulated expression of KL gene in primary Sertoli cells, we performed a detailed analysis of the KL promoter functions in these cells. We demonstrate the requirement of several sequences in the proximal 5'-flanking region of the murine KL gene for the full stimulation by cAMP, and we identify some of the factors that mediate the activated transcription from the KL promoter in Sertoli cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA Plasmids

The murine KL promoter nucleotide spanning from -407 to +35 was amplified by PCR using primers forward TGAGGCGAGGTAGGG-AAAAGA and reverse TGTCTGTCACCGGGACCGAGA on the basis of the KL promoter sequence reported by Bedell et al. [24]. Polymerase chain reaction (PCR) product was cloned into SalI/XbaI sites of pCAT basic vector (Promega, Madison, WI) and sequenced using the Sequenase kit (Amersham, Little Chalfont, UK). The -88/+35 deletion mutant was obtained after digestion with AvaI, whereas -55/+35 deletion mutant and all the other substitution mutants were obtained by PCR amplification using the forward primer AGCTGGCGGGCGGGC-GAGAGGGAGC and reverse TGTCTGTCACCGGGACCGAGA. Sequence analysis has been performed for each construct using the Sequenase kit.

Cell Cultures and DNA Transfection

Primary Sertoli cell cultures were prepared from 17-day-old Swiss-CD1 mice (Charles River, Como, Italy) as previously described [27]. Tissue explants were cultured at 32°C in serum free minimum essential medium (MEM) for 3 days and then were treated with hypotonic solution (20 mM Tris-HCl, pH 7.5) to remove remaining germ cells.

Mural granulosa cells were prepared from immature Swiss CD-1 mice. Briefly, 20- to 22-day-old females were intraperitoneally injected with 5 IU of eCG, and 48 h later, ovaries were removed and placed in MEM buffered with 25 mM Hepes, containing 1 mg/ml of BSA and 50 µg/ml of gentamicin. Isolation of mural granulosa cell was performed as previously described [28]. After the isolation procedure, aliquots containing 5 x 105 cells were cultured in 35-mm culture dishes in 1.5–2 ml of MEM supplemented with 5% fetal bovine serum, 0.3 mM sodium pyruvate, and 50 µg/ml of gentamicin for 2 days.

Cell lines 15P-1 [29] and TM4 were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum (Gibco, Invitrogen, Carlsbad, CA) at 32°C. Bone marrow stromal cell line has been cultured as previously reported [8].

Cells were transfected with CaPO4-DNA coprecipitate technique. Briefly, each plate was transfected with 2 µg/ml of plasmid DNA. After 4 h, cells were treated with a hyperosmotic solution (15% glycerol in isotonic solution) and left to recover for 2 h before treatment with stimulatory agents. Animals were maintained and killed in accordance with European Community guidelines.

Determination of CAT Activity

Cells were harvested 48 h after transfection, and the same amount of proteins of each total extract was used for chloramphenicol acetyltransferase (CAT) activity determination as previously reported [27]. Acetylated chloramphenicol was separated from the unconverted substrate by thin layer chromatography and identified by autoradiography. Values of CAT activity were reported as a percentage of conversion of input chloramphenicol in its acetylated forms and referred to 100 µg of total proteins. To correct for variation in transfection efficiency, the results were normalized for ß-galactosidase activity expressed from a cotransfected pSV-ß-gal plasmid (Promega).

Electrophoretic Mobility Shift Assay

Nuclear extracts were prepared as previously described [27]. Briefly, cells were collected after 24 h of treatment with 1 mM (Bu)2cAMP and lysed at 4°C with a buffer containing 10 mM Hepes (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM dithiothreitol (DTT), 10 mM ß-glycerophosphate, 0.1 mM sodium vanadate, and 1/100 (v/v) of a preformed protease inhibitors mixture (P8340; Sigma, St. Louis, MO). Nuclei were isolated by centrifugation and extracted for 30 min at 4°C with extraction buffer containing 490 mM NaCl, 10 mM Hepes (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EGTA, 0.5 mM DTT, 10 mM ß-glycerophosphate, 0.1 mM sodium vanadate, 1/100 (v/v) of protease inhibitors mixture, and 5% glycerol. Nuclear extracts were collected after centrifugation at 100 000 x g for 30 min and concentrated on Centricon-10 membranes after adjustment of NaCl to the final concentration of 60 mM.

Electrophoretic mobility shift assays (EMSA) were performed as previously described [27], using 0.2–0.5-ng labeled DNA in the presence of 1µg of double-stranded poly (dI-dC) (Pharmacia, Pfizer, New York, NY) in 10 µl of final volume with 10–20 µg of nuclear extracts. After 10 min of incubation with nuclear extracts, samples were loaded on 6% nondenaturing polyacrylamide gel in 1x Tris-borate-EDTA. Gels were dried and exposed at -80°C. For competition experiments, a 100-fold molar excess of unlabeled double-stranded oligonucleotides were premixed with the labeled probes before addition of nuclear extracts. Antibodies used for supershift of nucleoprotein complexes and/or inhibition of their formation in gel-shift experiments were all rabbit polyclonal antisera directed against Sp1 (sc-59X; Santa Cruz Biotechnology, Santa Cruz, CA), Egr-1 (sc-110X; Santa Cruz Biotechnology), AP-2 (sc-184X; Santa Cruz Biotechnology), and Rnf6 (a kind gift from F. Cuzin, described by Lopez et al [30]). Treatment with antibodies (2 µg of affinity purified IgGs in each reaction) was performed by preincubating nuclear extracts for 1 h at 4°C before the addition to the labeled probe.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
cAMP Inducible Transcription of the KL Gene in Primary Sertoli Cells

Transcription from the proximal 5'-flanking region of the murine KL gene (from nucleotides -407 to +35), cloned upstream to CAT reporter gene in pCAT basic plasmid and transiently transfected in primary mouse Sertoli cells, was activated by FSH and other agents that increase intracellular cAMP levels, as well as by cAMP analogs, but not by phorbol esters (Fig. 1A). A comparison between the effect of cAMP analogs and other hormones active on Sertoli cells on the transcriptional activity of the KL-CAT reporter construct and on the expression of the endogenous KL gene are shown in Figure 1B. In Table 1, values of KL-CAT activity under different conditions of stimulation are reported. Hormones such as 5{alpha}-dihydrotestosterone (DHT) or 17ß-estradiol induced a modest increase in both KL mRNA expression observed in Northern blot and activity of the KL-CAT reporter construct in transfection experiments, whereas the effect of cAMP analogs was by far more evident in both cases. These results confirm that cAMP is the major regulator of KL gene expression. Moreover, they indicate that the hormonal effects on the increase of endogenous KL mRNA levels are exerted at the transcriptional level.



View larger version (57K):
[in this window]
[in a new window]
 
FIG. 1. Stimulation of transcription from the murine KL promoter by cAMP in primary mouse Sertoli cells. A) Representative (CAT) assay performed on extracts of primary mouse Sertoli cells transiently transfected with plasmid pKL-CAT (-407/+35). Cells were left untreated (C) or were stimulated with the indicated agents for 24 h: 150 ng/ml of FSH; 1 mM (Bu)2cAMP; 0.125 mM isobutyl-methyl-xanthine (IBMX, a cAMP-phosphodiesterase inhibitor); and 0.1 µM phorbol-myristate-acetate (PMA, a PKC activator). B) Upper panel: CAT assays of Sertoli cells transiently transfected with plasmid pKL-CAT (-407/+35). Cells were left untreated (C) or were treated for 24 h with the indicated stimuli: 1 mM (Bu)2cAMP; 10 nM DHT; and 0.2 µM 17ß-estradiol. Middle panel: parallel Northern blot analysis of 15 µg of total RNA isolated from Sertoli cells treated as above. Blots were hybridized to a 32P-labeled KL probe. Similar results were obtained in three separate experiments. Lower panel: ethidium bromide staining of blotted samples shows that RNA loadings were comparable for both amount and integrity. C) Representative CAT assays performed on equal amounts of protein extracts from primary cultures of mouse Sertoli cells, from two mouse Sertoli cell lines (15P-1 and TM4), from a mouse bone marrow stromal cell line, and from primary cultures of mouse granulosa cells. Transfection experiments were performed using plasmid pKL-CAT (-407/+35)


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of different stimuli on CAT activity driven by KL promoter (-407/+35) in primary Sertoli cells

We found that cAMP-induced activation of the KL promoter is specifically observed in primary Sertoli cells. Figure 1C and Table 2 show that transcription from this promoter in two Sertoli cell lines (TM4 and 15P-1), in a bone marrow stromal cell line and in primary cultures of murine granulosa cells, was not significantly stimulated by cAMP, even though all these cell types are known to express endogenous KL.


View this table:
[in this window]
[in a new window]
 
TABLE 2. cAMP regulation of murine KL promoter (-407/+35) activity in different cell types

Identification of Minimal DNA Sequences Involved in cAMP Induction of the KL Promoter in Primary Mouse Sertoli Cells

To identify discrete DNA sequences that mediate the cAMP induction of the murine KL proximal promoter activity in primary mouse Sertoli cells, we performed 5'-end deletions of the promoter region. The removal of the promoter sequences from nucleotides -407 up to nucleotides -88 did not affect the induction by cAMP of the KL promoter, which was still stimulated more than 6-fold, indicating that the region of the promoter from nucleotides -407 to -88 does not contain elements necessary for cAMP response (Fig. 2A). Deletion of a fragment extending up to nucleotide -56 from the transcription start site caused a drastic decrease of cAMP stimulation of more than 50%, although a significant induction by (Bu)2cAMP (approximately 3-fold) was still evident. Both basal and cAMP-induced transcription of the proximal promoter starting from -55 was not influenced by removal of sequences between +9 and +35 (Fig. 3B). These observations suggest that the sequence -88/-56 is important for full induction by (Bu)2cAMP, but the minimal promoter sequence between -55 and +8 accounts for an important fraction of its cAMP responsiveness. As in the case of the full-length promoter, the cAMP induction of the shortest deletion mutant (-55/+8) was not observed in other KL-expressing cells (data not shown), indicating that, within this minimal promoter region, the elements that confer cell type-specific transcriptional response to cAMP are still present. Figure 2B shows the comparison among the proximal promoter regions of mouse, rat, and human KL genes, which share the cAMP responsiveness in Sertoli cells, indicating a strong conservation of the sequences between -88 and -56 and between -31 and +8 (coordinates refer to the mouse promoter).



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. Effect of KL 5'-flanking region deletions on basal and (Bu)2cAMP-stimulated CAT activity. Deletion mutants of KL promoter-reporter constructs were transiently transfected into Sertoli cells. A) Schematic representation of the constructs is shown on the left, and their relative CAT activities are indicated to the right. The results represent the mean ± SD of 10 independent duplicate experiments. The asterisk indicates a statistically significant difference (P < 0.05, determined by ANOVA) of (Bu)2cAMP-stimulated CAT activity of the KL (-55/+35) plasmid vs. the CAT activity of the same plasmid in basal condition and vs. (Bu)2cAMP-stimulated CAT activity of the KL (-407/+35) plasmid. B) Sequence comparison of the proximal 5'-flanking regions of the mouse [24], rat [23], and human [22] KL genes from -90 to +8 (coordinates refer to the mouse sequence). Asterisks identify identical nucleotides in similar position in the three genes



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 3. The TATA box and an immediately downstream GC-rich sequence mediate the cAMP responsiveness of the minimal core promoter of the KL gene. A) Nucleotide sequence of KL 5'-flanking region from position -55 to +8 in which two GC-rich regions (GC1 and GC2) are pointed out. The TATA motif is represented in bold letters. Mutated nucleotides are indicated for each mutant. Dashed lines represent unchanged nucleotides. B) Wild-type (WT) and mutated constructs were transfected in Sertoli cells, which were left untreated or were treated with (Bu)2cAMP for 24 h before CAT assay. CAT activity is expressed as the percentage of conversion of input chloramphenicol to its acetylated form. The results represent the mean ± SD of af least five independent duplicate experiments. In the insert, the average cAMP responsiveness of each construct is reported as fold induction, calculated as the ratio between the values of cAMP-induced CAT activity and values of CAT activity in basal conditions in the same experiment. The asterisks indicate a statistically significant difference (P < 0.05, determined by ANOVA) of cAMP responsiveness of the indicated mutant constructs vs. the WT -55/+8 plasmid

Discrete Mutations in the Minimal KL Promoter Abolish cAMP Responsiveness

To identify potential regulatory elements that control the cAMP-induced activity, we focused on the KL promoter region from -55 to +8 that represented the minimal 5'-flanking region conferring cAMP responsiveness. To abolish this inducibility, we introduced several mutations in two GC-rich sequences localized immediately upstream and downstream from a canonical TATA box, which we named GC1 and GC2, respectively (Fig. 3A). The effect of these mutations on the activity of the reporter CAT gene was then tested in transient transfection experiments (Fig. 3B).

Three different mutations (mut1, mut2, and mut3) introduced in the GC1 sequence had no significant effect on basal and cAMP-stimulated activity of the KL minimal promoter, indicating that mutations in the GC-rich sequence upstream to the TATA box do not affect cAMP inducibility of the KL gene (Fig. 3B). This result is in accordance with the observation that GC1 sequence is not well conserved in human and rat (Fig. 2B). On the contrary, two other different mutations (mut4 and mut5) introduced in the GC2 sequence strongly inhibited cAMP stimulation of CAT activity, thus indicating that this sequence plays an important role in the response to cAMP. Furthermore, the introduction of mutations in both GC1 and GC2 sequences in the same construct (mutD) resulted in an expression pattern of the reporter gene similar to that observed with the GC2 mutants, confirming that the GC2, but not the GC1 sequence, is critical for cAMP responsiveness of the KL promoter (Fig. 3B).

In the murine KL 5'-flanking region, the TATA box shows the canonical sequence TATAAAA, localized between -28 and -21, which is completely conserved in the human and rat KL genes (Fig. 2B). The observations that the cAMP responsiveness of the proximal promoter sequence of the KL gene is affected by mutations in GC2 sequence and that this sequence is localized in the core promoter in a position adjacent to the TATA box prompted us to investigate the possible role played by the TATA box itself in mediating the response to cAMP. To address this question, we replaced the canonical TATA sequence of the KL promoter (TATAAAAA) with the nonconsensus functional TATA sequence of the SV40 early promoter (TATTTATG) in plasmid mutSV40-TATA (Fig. 3A), and we tested the effect of this four-nucleotide mutation on the cAMP inducibility of the -55/+8 promoter region. The core promoter mutation altering the TATA box sequence had a slight effect on basal promoter activity, but it reduced cAMP responsiveness, even though a residual 2-fold induction was still observed (Fig. 3B). Finally, tandem mutations in both TATA and GC2 sequences in plasmid mut5-SV40-TATA caused, as expected, a total abolishment of cAMP stimulation, which became comparable to the background inducibility observed with the promoter-empty vector pCATbasic (Fig. 3B).

A decreased (even though not abolished) response to cAMP was observed also when the same mutations in the GC2 or in the TATA sequences were introduced in the -407/+35 plasmid (data not shown), confirming a role of these elements in cAMP responsiveness also when the -88/-56 region of the proximal promoter is kept intact. Together these results suggest that, in addition to the important role of the -88/-56 region of the proximal promoter, the TATA and the GC2 elements in the minimal core promoter are also required for full cAMP responsiveness of the KL gene.

Transcription Factor Sp1 Interacts With the -88/-56 Fragment of the KL Promoter

To determine whether the cAMP regulation of the KL promoter activity was associated with changes in DNA binding activity of Sertoli cell nuclear factors, we performed EMSA using as a probe the -88/-56 sequence in the presence of nuclear extracts obtained from primary Sertoli cells untreated or treated with cAMP for 24 h. Using this probe, the formation of a DNA-protein complex of similar intensity and mobility was observed with extracts from both control and cAMP-stimulated cells (Fig. 4A). Specificity of the nucleoprotein complexes was shown by inhibition of their formation by competition with 100-fold molar excess of the same unlabeled probe. Analysis of the -88/-56 fragment (Fig. 2B) with the PATCH program (http://www.gene-regulation.com/pub/programs.html#patch) showed the presence of a sequence (GAAGGAGGCG-TGTCC) containing a strong candidate Sp1-binding site. Indeed, treatment with anti-Sp1 antibodies caused a clear supershift of the nucleoprotein complexes (Fig. 4A). Notwithstanding the presence of a potential binding site for Rnf6 (30), i.e., a direct repeat of the sequence GAGGC (Fig. 2B), treatment with anti-Rnf6 antibodies had no effect on the mobility or the intensity of the observed bands. The anti-Rnf6 antibodies were proven to be functional by their ability to supershift other DNA-protein complexes obtained with nuclear extracts from TM4 cells (Fig. 6B).



View larger version (66K):
[in this window]
[in a new window]
 
FIG. 4. Binding of nuclear factors to the -88/+56 and -55/+8 fragments of the murine KL gene in control and cAMP-stimulated Sertoli cells. A) Representative EMSA experiment performed with the wild-type -88/-56 sequence of the KL promoter as a probe and 10 µg of nuclear extracts from untreated or (Bu)2cAMP-treated Sertoli cells in the presence or absence of the indicated molar excess of competitor double-stranded oligonucleotides or antibodies. The arrow indicates the Sp1-containing specific nucleoprotein complex formed with extracts from both control and cAMP-stimulated cells. Similar results were obtained in four independent experiments. B) Representative EMSA experiment performed with the wild-type -55/+8 sequence of the KL promoter as a probe and 20 µg of nuclear extracts from untreated and (Bu)2cAMP-treated Sertoli cells in the presence or absence of the indicated molar excess of competitor DNA fragments. The arrow indicates the specific nucleoprotein complex induced by cAMP treatment. Similar results were obtained in three independent experiments



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 6. cAMP-induced binding of nuclear factors to the GC2 element is specifically observed in primary Sertoli cells and requires new protein synthesis. A) The [32P]-labeled GC2 oligonucleotide was incubated with control or (Bu)2cAMP-treated nuclear extracts from primary Sertoli cells, 15P-1 cells, TM4 cells, spermatocytes, and spermatids and subjected to EMSA. A total of 15 µg of nuclear extracts of each cell type has been used. Similar results were obtained in four separate experiments. B) Effect of preincubation of nuclear extracts from TM4 cells with anti-Rnf6 antibodies in an EMSA experiment with the GC2 probe. C) Time course of cAMP induction of GC2-binding factors in primary Sertoli cells and effect of cycloheximide (40 µM) treatment. A total of 20 µg of nuclear extracts was loaded in each lane. Similar results were obtained in three separate experiments

cAMP-Induced DNA Binding of Nuclear Factors to the -55/+8 Fragment of the KL Promoter in Sertoli Cells

When the minimal cAMP-responsive region (-55/+8) was used as a probe, a nucleoprotein complex was routinely formed with nuclear extracts from cAMP-stimulated Sertoli cells, whereas a fainter band of faster mobility was formed with extracts from control cells (Fig. 4B). To analyze the role of TATA box sequence in the formation of the cAMP-induced DNA-protein complex at the -55/+8 region, we performed competitions in EMSA experiments. As shown in Fig. 4B, the slowest migrating cAMP-induced complex could be displaced by a 100-fold molar excess of the same unlabeled sequence (-55+8) but not of the same sequence carrying the SV40 TATA sequence (mutSV40-TATA), indicating that the canonical TATA box plays a crucial role in the formation of the cAMP-induced complex, as well as in transcriptional activation of the promoter (Fig. 3B).

To better delineate the binding activity of nuclear proteins from Sertoli cells to the GC1 and GC2 sequences (Fig. 3A) in the absence of the TATA box, we performed EMSA experiments using as probes oligonucleotides corresponding to these isolated sequences. As shown in Figure 5A, when we used the GC1 sequence (-55/-32) as a probe, we did not observe any DNA-protein complex formation in the presence of nuclear extracts from both cAMP-treated and untreated Sertoli cells. On the other hand, when the GC2 sequence (-19/+8) was used as a probe, a faint nucleoprotein complex was observed with extracts from untreated cells, and a strong increase of this complex was evident with nuclear extracts from cAMP-stimulated cells (Fig. 5B). Formation of the nucleoprotein complexes observed with the GC2 probe could be inhibited by a 100-fold molar excess of the same unlabeled oligonucleotide. However, it was not inhibited by a similar excess of two oligonucleotides in which this sequence was mutated as in the cAMP unresponsive mut4 and mut5 described in Figure 3A (Fig. 5C). These DNA binding data are in perfect agreement with the results of transfection experiments and indicate that Sertoli cell nuclear factors do not recognize the GC1 sequence located upstream to the TATA box, but they bind the GC2 sequence downstream from it. Moreover, they indicate that binding of these factors is increased after cAMP stimulation and that binding requires an intact GGCGGCG sequence (present between -15 and -9). The GC2 fragment contains potential binding sites for transcription factors recognizing GC-rich sequences, such as Sp1, AP-2, Egr-1, and Rnf6. However, antibodies against all these factors had no effect on the intensity and/or the mobility of the cAMP-induced complex (Fig. 5D). To test the efficiency of these antibodies, we added them to Sertoli cell nuclear extracts incubated with probes containing consensus binding sites for AP-2, Egr-1, and Sp1 (Fig. 5E). The efficacy of anti-Rnf6 antibody will be shown in the next paragraph of this section (Fig. 6B). The band observed with the AP-2 probe (Fig. 5E, top panel) was not modified by addition of anti-AP-2 antibody. Western blot analysis confirmed the absence of AP-2 isoforms {alpha}, ß, and {gamma} in Sertoli cell nuclear extracts, whereas the same antibody readily recognized AP-2{alpha} in extracts from HeLa cells (data not shown). The anti-Egr1 antibody inhibited formation of the nucleoprotein complex formed with the Egr-1 probe (Fig. 5E, middle panel), whereas the anti-Sp1 antibody supershifted the nucleoprotein complex formed by the Sp1 probe (Fig. 5E, bottom panel), as previously observed with the -88/-56 KL probe (Fig. 4A). These results indicate that cAMP induces the binding of an unknown nuclear protein to the GC2 sequence in primary mouse Sertoli cells, which contributes to the cAMP responsiveness of the KL promoter.



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 5. Binding of unknown nuclear factors to the isolated GC2 sequence is induced by (Bu)2cAMP treatment in Sertoli cells. A) Representative EMSA experiments performed using as probe an oligonucleotide corresponding to the GC1 sequence (-55/-32). A total of 20 µg of nuclear extracts from control or (Bu)2cAMP-treated Sertoli cells were incubated with 0.2 pM of the probe. Similar results were obtained in three independent experiments. B) Same as above, but using as a probe the GC2 sequence of the KL minimal core promoter (-19/+8). An arrow indicates the specific cAMP-induced nucleoprotein complex formed by the GC2 probe. Similar results were obtained in 10 independent experiments. C) Same as in B, but using as competitors either the wild-type GC2 oligonucleotide or the same oligonucleotide carrying mutations identical to the one present in mut4 or mut5 (shown in Fig. 3A). Arrow as in B. Similar results were obtained in three independent experiments. D) EMSA experiments with the GC2 probe using several antibodies directed against transcription factors binding GC-rich sequences. Arrow as in B. Similar results were obtained in three independent experiments. E) Top panel: EMSA experiments using as probe an oligonucleotide corresponding to an AP-2 consensus probe (sequence: GATCGAACTGACCGT) and nuclear extracts from Sertoli cells preincubated in the presence or absence of anti AP-2 antibodies. Middle panel: EMSA experiments using as probe an oligonucleotide corresponding to an Egr-1 consensus probe (sequence: GGATCCAA) and the same extracts preincubated in the presence or absence of anti Egr-1 antibodies. Bottom panel: EMSA experiments using as probe an oligonucleotide corresponding to a Sp1 consensus probe (sequence: AATCGATCGAGC) and the same extracts preincubated in the presence or absence of anti Sp1 antibodies

Cell Type-Specific cAMP-Induced Binding of Nuclear Factors to the GC2 Element Requires New Protein Synthesis

To demonstrate the specificity of cAMP induction of the GC2-binding nuclear factor in primary Sertoli cells, nuclear extracts from Sertoli-derived cell lines and from germ cells were used in EMSA experiments. Figure 6A shows that nuclear factors present in extracts from 15P-1 and TM4 Sertoli cell lines bound the GC2 sequence of the KL promoter, forming DNA-protein complexes of different mobilities, but these complexes were not induced by cAMP, demonstrating that the cAMP inducibility of the GC2-binding factor is specific to primary Sertoli cells. A DNA-protein complex was also observed with nuclear extracts from spermatocytes but not from spermatids. In addition, we found that Rnf6 antibodies were able to supershift nucleoprotein complexes formed by interaction of the GC2 probe with nuclear extracts from TM4 cells (Fig. 6B), in contrast to what was observed with extracts from primary Sertoli cells (Fig. 5D). The formation of the cAMP-induced complex with (Bu)2cAMP-treated Sertoli cell nuclear extracts required a prolonged stimulation of cell monolayers: 1 h was not sufficient to induce the GC2-complex, which started to be detected after 3 h of stimulation and increased at 24 h (Fig. 6C). Moreover, incubation of (Bu)2cAMP-stimulated cells with cycloheximide completely inhibited formation of the GC2-nuclear protein complex, indicating that formation of this nucleoprotein complex depends on de novo protein synthesis (Fig. 6C).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The cAMP pathway represents one of the dominant signal transduction cascades in Sertoli cell that is activated by FSH and that converges in the regulation of expression of different genes [31]. Many of these genes do not contain CRE elements, and we now show that, at least in the case of the KL gene, the core promoter plays a crucial role in cAMP-activated transcription in primary mouse Sertoli cells.

We observed that other hormones, such as androgens and estrogens, had some stimulatory effect on the expression of the KL gene in primary mouse Sertoli cells, but activation of the cAMP-dependent pathway was by far more efficient. The strong cAMP effect on KL gene expression was specifically observed in primary Sertoli cells, since it was not found in primary granulosa cells or in KL-expressing cell lines derived from bone marrow stromal cells or from Sertoli cells themselves.

Deletion analysis of the mouse KL 5'-flanking region indicates that the transcriptional response to cAMP is confined to sequences of the proximal promoter between -88 and +8. The effect of cAMP on the proximal promoter of the KL gene was similar to the one that we previously observed on the proximal promoter of the human urokinase-type plasminogen activator (h-uPA) gene, and it was relatively specific, since we did not observe activation of reporter gene activity driven by proximal promoters sequences from other eukaryotic or viral promoters that we tested in primary Sertoli cells [27].

Further deletion analysis reveals that several cis-acting elements between -88 and +8 are required for maximal inducibility by cAMP of the proximal KL promoter. The sequence between -88 and -56 contains elements that are important for full induction of the gene and whose removal causes a 50% decrease in cAMP-stimulated transcription. However, a significant cAMP responsiveness is still observed with a minimal core promoter element spanning from -55 to +8.

Even though we did not perform a detailed mutational analysis of the -88/-56 sequence, we identified Sp1 as one of the factors that binds to this region both in basal and cAMP-stimulated conditions. Since the -88/-56 sequence is important for full cAMP stimulation of KL promoter, it is possible that cAMP-dependent pathways, although not affecting Sp1 binding to this KL promoter region, might affect somehow the positive interaction of Sp1 with nuclear factors binding to other downstream promoter elements. Indeed, Sp1 has been involved in cAMP-activated transcription of several promoters [32], and it has been proposed as a possible direct target of protein kinase A (PKA) [33]. Moreover, Sp1 has been recently shown to bind to the regulatory regions of the FSH-responsive Dmrt1 gene in primary mouse Sertoli cells, even though cAMP-dependent transcription of this promoter was not characterized [34]. However, due to the almost ubiquitous expression of Sp1, it is unlikely that it is, by itself, responsible for the cell type specificity of cAMP-activated transcription of the KL gene in primary mouse Sertoli cells.

Indeed, the cell type-specific cAMP responsiveness is conserved within the minimal core promoter region, spanning from -55 to +8, which is still stimulated more than 3-fold. Sequence analysis of the -55/+8 promoter region shows the presence of two GC-rich sequences (GC1 and GC2) located upstream and downstream from the TATA box, respectively. The GC1 sequence is not involved in activation of KL gene expression by cAMP, because mutations in this sequence did not cause loss of cAMP responsiveness, and nuclear factors from both untreated or cAMP-treated Sertoli cells did not bind this sequence in gel shift experiments. On the other hand, the GC2 region plays an important role in the cAMP responsiveness, because mutations in this sequence strongly impaired cAMP stimulation. Moreover, nuclear factors from primary Sertoli cells bound to the GC2 sequence and an increase of binding activity of these nuclear proteins were observed after treatment with cAMP. Interestingly, although nuclear extracts from Sertoli cell lines, TM4 and 15P-1, and from spermatocytes recognized and bound the GC2 sequence, nucleoprotein complexes of different mobilities were formed, and no difference in the DNA binding were observed after cAMP treatment.

We do not know the nature of the cAMP-induced factor binding to the GC2 sequence in primary Sertoli cells, and we cannot exclude that it might be already present in basal conditions in other KL-expressing cells. Although overlapping binding sites for transcription factors Sp1 and Egr1 are present in this area, we exclude a possible involvement of these transcription factors in cAMP-stimulated KL gene expression, as suggested by the use of specific antibodies in DNA-binding experiments. Recently, in the promoter region of another FSH-regulated gene expressed in Sertoli cells, inhibin {alpha}, a related sequence has been found, and Rnf6 was identified as factor binding to this promoter element, even though its possible cAMP dependence was not characterized [30]. We now show that Rnf6 is not the factor binding to the GC2 element or to other proximal promoter elements of the KL gene in primary mouse Sertoli cells, even though Rnf6 binds the GC2 sequence in nuclear extracts from TM4 cells.

Transcription factors of the AP-2 family have also been involved in cAMP-regulated transcription of several genes [35]. A potential AP-2-binding site is present in the GC2 element, but antibodies that recognize multiple members of the AP-2 family did not recognize the nucleoprotein complexes formed with either the GC2 probe or a consensus AP-2 probe, and no AP-2 isoforms were detectable in immunoblot analysis of both control and cAMP-treated Sertoli cell extracts.

A sequence similar to the GC2 element of the KL gene has been identified also in the 5'-flanking region of a rat gene encoding a cAMP-specific phosphodiesterase, whose expression was also induced by FSH in Sertoli cells, but the nuclear factors recognizing this sequence have not been characterized [36]. Moreover, the GC2 sequence of the KL gene is similar to a cAMP-responsive region identified in the 5'-flanking region of the h-uPA gene; they both share a GGCGGCGC sequence, which was shown to be essential for the binding to the h-uPA promoter of unidentified cAMP-induced factors, different from Sp1, Egr-1, and AP-2, in nuclear extracts from primary Sertoli cells [27, 37, 38]. Furthermore, the mechanism of induction of these unknown factors by cAMP seems to be the same in both the KL promoter and the h-uPA promoter, since it requires a prolonged stimulation. We now also show that new protein synthesis is required for the cAMP-induced binding of these factors to the GC2 element. Interestingly, wide genome analysis of FSH-activated gene expression in primary rat Sertoli cells has identified KL as a relatively late responsive gene [39].

Substitution of the canonical TATA box sequence in the KL promoter with another functional TATA box (different from the consensus TATAAAA) caused a strong reduction in transcriptional activation. Moreover, cAMP-induced binding of nuclear factors at the minimal core promoter (-55/+8) was not competed by a mutant promoter in which only the TATA box was altered. We also found that an excess of the isolated GC2 sequence did not inhibit efficiently formation of these complexes (data not shown). This observation suggests that, in addition to inducing binding of unidentified nuclear factors at the downstream GC2 element, cAMP also increases the formation of specific preinitiation complexes or, alternatively, that the cAMP-induced GC2-binding factors act to recruit these preinitiation complexes, whose stability requires a canonical TATA sequence. A role of specific TATA box sequences in regulation of transcriptional induction has been reported for promoters of different genes: the myoglobin gene, in which a canonical TATA sequence is essential for the interaction with an upstream muscle-specific enhancer [40]; the peripherin gene, in which the TATA box is essential for nerve growth factor (NGF) induction [41]; the CYP11A1 gene, in which the TATA box is important for cAMP stimulation [42]; and the human c-fos oncogene, in which the substitution of the TATA box abolishes E1A inducibility [43]. Interestingly, in our previous studies on cAMP regulation of the h-uPA promoter in mouse Sertoli cells, we found that the identified cAMP-responsive GC-rich sequence (similar to the GC2 element) was not able to confer cAMP responsiveness to the SV40 promoter when cloned upstream to it [27], but it was able to confer cAMP responsiveness to a promoter containing a different TATA box sequence [37]. Recently, the relevance of TATA sequence in the cAMP responsiveness of CRE-containing promoters has been demonstrated [44]. Similarly, we demonstrate that an efficient cAMP stimulation of KL promoter, which does not contain a CRE element, is observed only in the presence of a canonical TATA sequence. The effect of the TATA substitution on cAMP response of the KL promoter could be explained by an alteration of the interaction between a component of TFIID (TBP and/or TAFIIs) and the GC2-binding factor, which could act as a cell type-specific activator [45, 46].

In conclusion, our results indicate that, within the proximal KL promoter, the region between -88 and -56, binding transcription factor Sp1, factors binding to the TATA box, and a not yet identified cAMP-induced factor (binding to the immediately downstream GC2 element) cooperate to provide cell type-specific cAMP-induced transcription in primary mouse Sertoli cells.


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Antonella Camaioni for preparation of primary cultures of granulosa cells and Dr. Susanna Dolci for helpful suggestions given to this study. We also thank Professor Francois Cuzin (INSERM, Nice, France) for the generous gift of anti-Rnf6 antibodies.


    FOOTNOTES
 
1 This work was funded by grants from the Agenzia Spaziale Italiana (ASI) and by MIUR Cofin 2002. Back

2 Correspondence: Paola Grimaldi, Department of Public Health and Cell Biology, University of Rome tor Vergata, Via Montpellier, 1, 00133, Rome, Italy. FAX: 39 06 72596268; grimaldi{at}uniroma2.it Back

Received: 16 May 2003.

First decision: 11 June 2003.

Accepted: 28 July 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rossi P, Albanesi C, Grimaldi P, Geremia R. Expression of the mRNA for the ligand of c-kit in mouse Sertoli cells. Biochem Biophys Res Commun 1991 176:910-914[CrossRef][Medline]
  2. Rossi P, Dolci S, Albanesi C, Grimaldi P, Ricca R, Geremia R. FSH induction of Steel Factor (SLF) mRNA in mouse Sertolí cells and stimulation of DNA synthesis in spermatogonía by soluble SLF. Dev Biol 1993 155:68-74[CrossRef][Medline]
  3. Manova K, Nocka K, Besmer P, Bachvarova RF. Gonadal expression of c-kit encoded at the W locus of the mouse. Development 1990 110:1057-1069[Abstract/Free Full Text]
  4. Sorrentino V, Giorgi M, Geremia R, Besmer P, Rossi P. Expression of the c-kit protooncogene in the murine male germ cells. Oncogene 1991 6:149-151[Medline]
  5. Yoshinaga K, Nishikawa S, Ogawa M, Hayashi S, Kunisada T, Fujimoto T, Nishikawa S-I. Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 1991 113:689-699[Abstract]
  6. Schrans-Stassen BH, van de Kant HJ, de Rooij DG, van Pelt AM. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia. Endocrinology 1999 140:5894-5900[Abstract/Free Full Text]
  7. Ohta H, Yomogida K, Dohmae K, Nishimune Y. Regulation of proliferation and differentiation in spermatogonial stem cells: the role of c-kit and its ligand KL. Development 2000 127:2125-2131[Abstract]
  8. Dolci S, Williams DE, Ernst MK, Resnick JL, Brannan CI, Lock LF, Lyman SD, Boswell HS, Donovan PJ. Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 1991 352:809-811[CrossRef][Medline]
  9. Packer AI, Besmer P, Bachvarova RF. KL mediates survival of type A spermatogonia and dividing spermatocytes in postnatal mouse testes. Mol Reprod Dev 1995 42:303-310[CrossRef][Medline]
  10. Hakovirta H, Yan W, Kaleva M, Zhang F, Vanttinen K, Morris PL, Soder M, Parvinen M, Toppari J. Function of stem cell factor as a survival factor of spermatogonia and localization of messenger ribonucleic acid in the rat seminiferous epithelium. Endocrinology 1999 140:1492-1498[Abstract/Free Full Text]
  11. Kissel H, Timokhina I, Hardy MP, Rothschild G, Tajima Y, Soares V, Angeles M, Whitlow SR, Manova K, Besmer P. Point mutation in kit receptor tyrosine kinase reveals essential roles for kit signaling in spermatogenesis and oogenesis without affecting other kit responses. EMBO J 2000 19:1312-1326[CrossRef][Medline]
  12. Blume-Jensen P, Jiang G, Hyman R, Lee KF, O'Gorman S, Hunter T. Kit/stem cell factor receptor-induced activation of phosphatidylinositol 3'-kinase is essential for male fertility. Nat Genet 2000 24:157-162[CrossRef][Medline]
  13. Feng LX, Ravindranath N, Dym M. Stem cell factor/c-kit up-regulates cyclin D3 and promotes cell cycle progression via the phosphoinositide 3-kinase/p70 S6 kinase pathway in spermatogonia. J Biol Chem 2000 275:25572-25576[Abstract/Free Full Text]
  14. Dolci S, Pellegrini M, Di Agostino S, Geremia R, Rossi P. Signaling through extracellular signal-regulated kinase is required for spermatogonial proliferative response to stem cell factor. J Biol Chem 2001 276:40225-40233[Abstract/Free Full Text]
  15. Vincent S, Segretain D, Nishikawa S, Nishikawa SI, Sage J, Cuzin F, Rassoulzadegan M. Stage-specific expression of the Kit receptor and its ligand (KL) during male gametogenesis in the mouse: a Kit-KL interaction critical for meiosis. Development 1998 125:4585-4593[Abstract]
  16. Brannan CI, Bedell MA, Resnick JL, Eppig JJ, Handel MA, Williams DE, Lyman SD, Donovan PJ, Jenkins NA, Copeland NG. Developmental abnormalities in Steel17H mice result from a splicing defect in the steel factor cytoplasmic tail. Genes Dev 1992 6:1832-1842[Abstract/Free Full Text]
  17. Sandlow JI, Feng HL, Cohen MB, Sandra A. Expression of c-KIT and its ligand, stem cell factor, in normal and subfertile human testicular tissue. J Androl 1996 17:403-408[Abstract/Free Full Text]
  18. Natali PG, Nicotra MR, Sures I, Santoro E, Bigotti A, Ullrich A. Expression of c-kit receptor in normal and transformed human nonlymphoid tissues. Cancer Res 1992 52:6139-6143[Abstract/Free Full Text]
  19. Fujisawa M, Kanzaki M, Okuda Y, Okada H, Arakawa S, Kamidono S. Stem cell factor in human seminal plasma as a marker for spermatogenesis. Urology 1998 51:460-463[CrossRef][Medline]
  20. Yan W, Linderborg J, Suominen J, Toppari J. Stage-specific regulation of stem cell factor gene expression in the rat seminiferous epithelium. Endocrinology 1999 140:1499-1504[Abstract/Free Full Text]
  21. Srivastava CH, Breyer PR, Rothrock JK, Peredo MJ, Pescovitz OH. A new target for growth hormone releasing-hormone action in rat: the Sertoli cell. Endocrinology 1993 133:1478-1481[Abstract/Free Full Text]
  22. Taylor WE, Najmabadi H, Strathearn M, Jou N-T, Liebling M, Rajavashisth T, Chanani N, Phung L, Bhasin S. Human stem cell factor promoter deoxyribonucleic acid sequence and regulation by cyclic 3', 5'-adenosine monophosphate in a Sertoli cell line. Endocrinology 1996 137:5407-5414[Abstract]
  23. Jiang C, Hall SJ, Boekelheide K. Cloning and characterization of the 5' flanking region of the stem cell factor gene in rat Sertoli cell. Gene 1997 185:285-290[CrossRef][Medline]
  24. Bedell MA, Copeland NG, Jenkins NA. Multiple pathways for Steel regulation suggested by genomic and sequence analysis of the murine Steel gene. Genetics 1996 142:937-934
  25. Grimaldi P, Rossi P, Dolci S, Ripamonti CB, Geremia R. Molecular genetics of male infertility: stem cell factor/c-kit system. Am J Reprod Immunol 2002 48:27-33
  26. Meyer TE, Habener JF. Cyclic adenosine 3',5'-monophosphate response element binding protein (CREB) and related transcription-activating deoxyribonucleic acid-binding proteins. Endocr Rev 1993 14:269-290[Abstract/Free Full Text]
  27. Grimaldi P, Piscitelli D, Albanesi C, Blasi F, Geremia R, Rossi P. Identification of 3',5'-cyclic adenosine monophosphate-inducible nuclear factors binding to the human urokinase promoter in mouse Sertoli cells. Mol Endocrinol 1993 7:1217-1225[Abstract/Free Full Text]
  28. Salustri A, Yanagishita M, Underhill CB, Laurent TC, Hascall V. Localization and synthesis of hyaluronic acid in the cumulus cells and mural granulosa cells of the preovulatory follicle. Dev Biol 1992 151:541-551[CrossRef][Medline]
  29. Rassoulzadegan M, Pasquis-Fluklinger V, Bertino B, Sage J, Jasin M, Miyagawa K, van Heyningen V, Besmer P, Cuzin F. Transmeiotic differentiation of male germ cells in culture. Cell 1993 75:997-1006[CrossRef][Medline]
  30. Lopez P, Vidal F, Martin L, Lopez-Fernandez LA, Rual JF, Rosen BS, Cuzin F, Rassoulzadegan M. Gene control in germinal differentiation: Rnf6, a transcription regulatory protein in the mouse Sertoli cell. Mol Cell Biol 2002 22:3488-3496[Abstract/Free Full Text]
  31. Simoni M, Gromoll J, Nieschlag E. The follicle-stimulating hormone receptor: biochemistry, molecular biology, physiology, and pathophysiology. Endocr Rev 1997 18:739-773[Abstract/Free Full Text]
  32. Ahlgren R, Suske G, Waterman MR, Lund J. Role of Sp1 in cAMP-dependent transcriptional regulation of the bovine CYP11A gene. J Biol Chem 1999 274:19422-19428[Abstract/Free Full Text]
  33. Rohlff C, Ahmad S, Borellini F, Lei J, Glazer RI. Modulation of transcription factor Sp1 by cAMP-dependent protein kinase. J Biol Chem 1997 272:21137-21141[Abstract/Free Full Text]
  34. Lei N, Heckert LL. Sp1 and Egr-1 regulate transcription of the Dmrt1 gene in Sertoli cells. Biol Reprod 2002 66:675-684[Abstract/Free Full Text]
  35. Imagawa M, Chiu R, Karin M. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 1987 51:251-260[CrossRef][Medline]
  36. Vicini E, Conti M. Characterization of an intronic promoter of a cyclic adenosine 3',5'-monophosphate (cAMP)-specific phosphodiesterase gene that confers hormone and cAMP inducibility. Mol Endocrinol 1997 7:839-850
  37. Grimaldi P, Geremia R, Albanesi C, Rossi P. The same sequence mediates activation of the human urokinase promoter by cAMP in mouse Sertoli cells and by SV40 large T antigen in COS cells. Mol Cell Endocrinol 1996 117:167-173[CrossRef][Medline]
  38. Rossi P, Grimaldi P, Blasi F, Geremia R, Verde P. Follicle-stimulating hormone and cyclic AMP induce transcription from the human urokinase promoter in primary cultures of mouse Sertoli cells. Mol Endocrinol 1990 4:940-946[Abstract/Free Full Text]
  39. McLean DJ, Friel PJ, Pouchnik D, Griswold MD. Oligonucleotide microarray analysis of gene expression in follicle-stimulating hormone-treated rat Sertoli cells. Mol Endocrinol 2002 16:2780-2792[Abstract/Free Full Text]
  40. Wefald FC, Devlin BH, Williams RS. Functional heterogeneity of mammalian TATA-box sequences revealed by interaction with a cell-specific enhancer. Nature 1990 344:260-262[CrossRef][Medline]
  41. Desmarais D, Royal A. The TATA motif is a target for efficient transcriptional activation and nerve growth factor induction of the peripherin gene. J Biol Chem 1996 271:24976-24981[Abstract/Free Full Text]
  42. Guo IC, Chung B. Cell-type specificity of human CYP11A1 TATA box. J Steroid Biochem Mol Biol 1999 69:329-334[CrossRef][Medline]
  43. Simon Mc, Rooney RJ, Fisch TM, Heintz N, Nevins JR. E1A-dependent trans-activation of the c-fos promoter requires the TATAA sequence. Proc Natl Acad Sci U S A 1990 87:513-517[Abstract/Free Full Text]
  44. Conkright MD, Guzman E, Flechner L, Su AI, Hogenesch JB, Montminy M. Genome-wide analysis of CREB target genes reveals a core promoter requirement for cAMP responsiveness. Mol Cell 2003 11:1101-1108[CrossRef][Medline]
  45. Albright SR, Tjian R. TAFs revisited: more data reveal new twists and confirm old ideas. Gene 2000 242:1-13[CrossRef][Medline]
  46. Green MR. TBP-associated factors (TAFIIs): multiple, selective transcriptional mediators in common complexes. Trends Biochem Sci 2000 25:59-63[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Shiina, T. Matsumoto, T. Sato, K. Igarashi, J. Miyamoto, S. Takemasa, M. Sakari, I. Takada, T. Nakamura, D. Metzger, et al.
From the Cover: Premature ovarian failure in androgen receptor-deficient mice
PNAS, January 3, 2006; 103(1): 224 - 229.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. M. H. Doyle, D. L. Russell, V. Sriraman, and J. S. Richards
Coordinate Transcription of the ADAMTS-1 Gene by Luteinizing Hormone and Progesterone Receptor
Mol. Endocrinol., October 1, 2004; 18(10): 2463 - 2478.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
69/6/1979    most recent
biolreprod.103.019471v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.
Agricola
Right arrow Articles by Grimaldi, P.
Right arrow Articles by Rossi, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS