Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print September 17, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.020016
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/1/160    most recent
biolreprod.103.020016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.
Agricola
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.
BIOLOGY OF REPRODUCTION 70, 160–167 (2004)
DOI: 10.1095/biolreprod.103.020016
© 2004 by the Society for the Study of Reproduction, Inc.


Embryo

Marsupial Anti-Müllerian Hormone Gene Structure, Regulatory Elements, and Expression1

Andrew J. Pask, Deanne J. Whitworth, Chai-An Mao3, Ke-Jun Wei, Natasha Sankovic, Jennifer A. M. Graves, Geoffrey Shaw, Marilyn B. Renfree, and Richard R. Behringer2

Department of Zoology,4 University of Melbourne, Victoria 3010, Australia Department of Molecular Genetics,5 University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Comparative Genomics Research Group,6 Research School of Biological Sciences, Australian National University, Canberra ACT 2601, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During male sexual development in reptiles, birds, and mammals, anti-Müllerian hormone (AMH) induces the regression of the Müllerian ducts that normally form the primordia of the female reproductive tract. Whereas Müllerian duct regression occurs during fetal development in eutherian mammals, in marsupial mammals this process occurs after birth. To investigate AMH in a marsupial, we isolated an orthologue from the tammar wallaby (Macropus eugenii) and characterized its expression in the testes and ovaries during development. The wallaby AMH gene is highly conserved with the eutherian orthologues that have been studied, particularly within the encoded C-terminal mature domain. The N-terminus of marsupial AMH is divergent and larger than that of eutherian species. It is located on chromosome 3/4, consistent with its autosomal localization in other species. The wallaby 5' regulatory region, like eutherian AMH genes, contains binding sites for SF1, SOX9, and GATA factors but also contains a putative SRY-binding site. AMH expression in the developing testis begins at the time of seminiferous cord formation at 2 days post partum, and Müllerian duct regression begins shortly afterward. In the developing testis, AMH is localized in the cytoplasm of the Sertoli cells but is lost by adulthood. In the developing ovary, there is no detectable AMH expression, but in adults it is produced by the granulosa cells of primary and secondary follicles. It is not detectable in atretic follicles. Collectively, these studies suggest that AMH expression has been conserved during mammalian evolution and is intimately linked to upstream sex determination mechanisms.

early development, granulosa cells, ovary, Sertoli cells, testis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Anti-Müllerian hormone/Müllerian inhibiting substance (AMH/MIS) plays a key role in the formation of the urogenital system of reptiles, birds, and mammals. In fetal mammals, embryos of both sexes possess two pairs of genital ducts. In males, the Wolffian or mesonephric ducts give rise to the epididymides, vas deferentia, and seminal vesicles, whereas in females the Müllerian or paramesonephric ducts give rise to the oviducts, uterus, and upper portion of the vagina [1]. For normal male development, the Müllerian ducts must regress. In contrast, females must retain their Müllerian ducts; Wolffian ducts degenerate in the absence of testicular androgens.

The regression of the Müllerian ducts is induced by AMH/MIS, a member of the transforming growth factor-ß superfamily of growth and differentiation factors [2]. During male development, Sertoli cells of the testis secrete AMH, which signals through its type II receptor expressed in mesenchymal cells adjacent to the Müllerian duct epithelium to induce its regression [3, 4]. In mouse and rat male fetuses, AMH expression reaches peak levels during the period of Müllerian duct regression [5, 6]. However, expression continues after Müllerian duct regression is complete but at reduced levels, declining to very low levels after puberty [69]. In contrast, the ovary does not synthesize AMH during fetal stages, creating a permissive environment for female reproductive tract differentiation. It is localized to the granulosa cells of preantral and small and large antral follicles but is not detected in primordial follicles, atretic follicles, and corpora lutea [6, 1015]. AMH has been shown to have inhibitory effects on granulosa cell proliferation [16, 17], aromatase activity, and the expression of the luteinizing hormone receptor [18, 19]. It has also been demonstrated that AMH is an indirect regulator of primordial follicle recruitment via a decrease in FSH and an increase in inhibin [20].

The AMH promoter region of eutherian mammals is highly conserved and contains binding sites for SF1, GATA, and SOX9. In the mouse these factors regulate Amh transcription [2129]. The SF3A2 gene (splicing factor 3a, subunit 2; also known as Sap62; spliceosome-associated protein, 62-kd) lies immediately upstream of AMH in mouse, human [30], and rat (http://ratmap.gen.gu.se). In the mouse, the Sf3a2 termination codon is located within approximately 300 bp of the Amh start codon. In contrast, there is no SF3A2 in the chicken within 1 kb upstream of the AMH start codon [31]. Apparently, promiscuous expression of Amh has been noted in the mouse, occurring as read-through transcription from the Sf3a2 gene. The close proximity of the SF3A2 gene to AMH could affect its temporal and spatial expression pattern in mouse, rat, and human [30].

Marsupial and eutherian mammals diverged from a common ancestor around 100 million years ago [32]. Marsupials have a unique mode of reproduction relative to eutherian mammals, giving birth to highly immature, or altricial, young that complete much of their development after birth. In the tammar wallaby (Macropus eugenii), the first signs of sexual differentiation in the male gonad occurs around 1 day before birth when presumptive Sertoli cells show a greater cytoplasmic:nuclear ratio than the somatic cells of the female gonad [3335]. From this time until day 2 pp (post partum), Sertoli cells differentiate and align into seminiferous cords; Leydig cells differentiate in the interstitium and testicular levels of testosterone increase [3436]. The onset of ovarian differentiation is not apparent until approximately 8 days after birth [35, 37, 38]. In the wallaby, the regression of the Müllerian ducts occurs between 6 and 7 and 20 days pp [35, 39], and AMH bioassayable activity is detectable in early pouch life from days 2 through 80 pp [40, 41]. Thus, in contrast to eutherian mammals, the sexual differentiation of the gonads and genital ducts in marsupial mammals occurs after birth and over a relatively prolonged period.

The aim of this study was to isolate and characterize the complete AMH gene from the tammar wallaby, an Australian macropodic marsupial of the kangaroo family. The temporal and spatial expression profiles of AMH in the gonads of the male pouch young were determined relative to testicular differentiation and the onset of Müllerian duct regression. The pattern of AMH protein expression was determined in the adult ovary during follicular development. We also sequenced the wallaby AMH promoter to investigate the presence of the SF1, SOX9, and GATA transcription factor–binding sites and SF23A.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Tissue Collection

Tammar wallabies (M. eugenii) were maintained in our breeding colony in grassy, outdoor enclosures in Melbourne, Australia. Lucerne cubes, grass, and water were provided ad libitum and supplemented with fresh vegetables. During the breeding season, adult females were checked daily for births (day 0, and pouch young of both sexes and various ages were collected for tissue samples. In cases in which the day of birth was uncertain, the age of the pouch young was determined by head length measurements [42]. The sex phenotype was determined by the presence or absence of scrotal and mammary primordia [38, 43] or genetic sexing [44]. At least three samples of each sex were collected for every 2 days between the day of birth and day 10 as well as adults. All experimental procedures conformed to Australian National Health and Medical Research Council (1990) guidelines for humane animal care and were approved by the University of Melbourne Animal Experimentation Ethics Committees. Animals were held under permits from the Department of Natural Resources, Victoria, and Parks and Wildlife, South Australia.

Cloning of the Tammar Wallaby AMH Gene

We used published polymerase chain reaction (PCR) primers [45] to amplify a 235-bp fragment of the AMH gene from tammar wallaby male genomic DNA. Cycle parameters were: 95°C 5 min; 95°C 1 min, 42°C 1 min, 72°C 1 min, 5 cycles; 95°C 1 min, 55°C 1 min, 72°C 1 min, 30 cycles; 72°C 5 min. The wallaby-specific AMH PCR product was radioactively labeled and used to screen approximately 1.2 x 106 pfu of a lambda EMBL III (Stratagene, La Jolla, CA) wallaby genomic DNA library prepared from liver DNA using standard procedures. Radiolabeled DNA probes were synthesized by random labeling T7 Quick Prime kit (Pharmacia Australia, Rydalmere, NSW) with [32P]-deoxycytidine triphosphate. Plaque lifts and hybridization procedures were performed according to standard protocols. Three AMH clones with overlapping restriction patterns were identified and their identity confirmed by DNA sequencing.

Exon 1 of the wallaby gene was not present in any of the three AMH-containing phage clones. Therefore, we constructed and screened a tammar wallaby bacterial artificial chromosome (BAC) genomic library. Total genomic tammar DNA was prepared from adult white blood cells. DNA was prepared for ligation into the HindIII restriction sites of the pRazorBAC vector. The average insert size was 108 kb. BACs were arranged in a grid in triplicate onto nylon membranes for screening. Approximately 55 000 clones were obtained, corresponding to approximately a 2.2 times coverage of the genome (based on 2.7 x 109 genome size estimate).

BAC filters were prehybridized in 100 ml of Church buffer containing 1% BSA and 100 µl of 10 mg/ml salmon sperm DNA overnight at 65°C. The filters were then hybridized for 20 h at 65°C with the wallaby AMH probe described above. Filters were then washed at low stringency (2 x saline sodium citrate [SSC]/0.1% SDS) at 65°C for 20 min and then at medium stringency (1 x SSC/0.1%SDS) at 65°C and exposed to X-OMAT (Kodak, Melbourne, Australia) film for several days. Wallaby-specific AMH primers within exon 5 were used for PCR to verify putative AMH-containing BAC clones. A single PCR-positive AMH BAC clone was isolated.

A fragment of wallaby AMH exon 1 was isolated using cross-species primers for reverse transcription (RT)-PCR on day 4 pp pouch young testis RNA. The primers were 5' CCTGAGGGTGGTGGGGGYYCT 3' and 5' AGCGGGTATGGTGTGGAGTCA 3'. Subsequently, forward and reverse wallaby-specific AMH exon 1 primers were used to determine the entire sequence of exon 1 using the wallaby AMH BAC as a genomic DNA sequencing template. Long template PCR from wallaby AMH exon 1 to exon 2 determined the size of intron 1 to be 3.3 kb.

Fluorescence in Situ Hybridization

The tammar wallaby karyotype includes a total of 16 chromosomes, including 7 pairs of autosomes and a pair of sex chromosomes. Each of the chromosome pairs are morphologically distinct with the exception of pairs 3 and 4 which cannot be differentiated. The chromosomal location of AMH was determined by fluorescence in situ hybridization (FISH) of wallaby fibroblasts as described previously [46], using a wallaby AMH phage genomic clone.

Reverse Transcription-Polymerase Chain Reaction

RNA was isolated from pouch young gonads, mesonephros, and liver and adult ovary and testis, according to the protocol given in Koopman et al. [47]. Intron-spanning RT-PCR primers for wallaby AMH located in exons 1 and 2 were: forward, 5' CCTGAGGGTGGTGGGGGGTCT 3' and reverse, 5' CCAGACGAAAGAGCAGAACCT 3'. Wallaby phosphoglycerate kinase (PGK) primers were used as a control for RNA integrity: forward, 5' GAAACTGACCTTGGACAAGGTG 3' and reverse, 5' TGTTCCCAGAAGCATCTTTGCC 3' [48]. RT-PCR conditions were: 94°C 1 min; 94°C 30 sec, 65°C 1 min, 72°C 1 min, 30 cycles. Samples were analyzed on a 0.8% agarose gel.

Immunohistochemistry

Tissues were fixed in 4% paraformaldehyde overnight at 4°C, rinsed several times in 1 x PBS, and embedded in paraffin. Immunohistochemistry for AMH was performed using the Tyramide Signal amplification kit (NEN-DuPont, Sydney, Australia,) according to the manufacturer's instructions. The primary antibody was either a rabbit polyclonal against recombinant human AMH, used at a concentration of 5 µg/ml (a generous gift of Dr. Nathalie Josso) or C-20 goat polyclonal raised against human AMH, used at 10 µg/ml (Santa Cruz Biotechnology Inc., Santa Cruz, CA). The secondary antibody was an anti-rabbit or anti-goat IgG conjugated to peroxidase (Amersham Pharmacia), used at a 1:1000 dilution, respectively. Immunostaining was visualized with diamino-benzidine, and sections were counterstained with hematoxylin.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Characterization of the Wallaby AMH Gene

The wallaby AMH gene (GenBank Accession no. AY346371) encoded a predicted protein of 634 amino acids (Fig. 1).



View larger version (119K):
[in this window]
[in a new window]
 
FIG. 1. Amino acid sequence alignment of wallaby AMH protein with other species. Shaded boxes denote regions of amino acid similarity. Homologous amino acids between all species are indicated with solid black arrowheads. The black box indicates the proteolytic cleavage site, and the bioactive C-terminus is underlined. GenBank sequence accession numbers: wallaby, AY346371; chicken, X89248, U61754; mouse, X63240; rat, S98336; cow, M13151; pig, U80853; human, K03474

The entire wallaby AMH protein has an overall amino acid similarity with human AMH of 70%, cow 69%, pig 68%, rat 68%, mouse 68%, chicken 70%, and alligator 69% (Fig. 2A). Amino acid similarity between mammalian species was lowest in the N-terminal domain, with significantly higher similarity (>90%) in the proteolytically cleaved mature C-terminus (Fig. 2A). There was least identity in exon 1. The predicted proteolytic cleavage site between the N-terminus and the mature C-terminus (527-LR/SA-530) was located between amino acids 528 and 529 encoded within exon 5. The entire wallaby AMH amino acid sequence was used to construct a phylogenetic tree constructed using the ClustalW method [49]. The results show that wallaby AMH clusters with the AMH proteins of eutherian mammals, whereas chicken forms a separate branch (Fig. 2B).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Wallaby AMH protein sequence and phylogenetic analysis A) Percentage amino acid similarity between wallaby AMH and AMH from various species. Amino acid similarity is calculated for the entire protein and the mature C-terminal domain. B) Phylogenetic tree showing the relationship of wallaby AMH to the AMH of other species. Numbers indicate bootstrap values

Wallaby AMH, like all other AMH genes that have been characterized, was encoded by 5 exons (Fig. 3A). The exon/intron structure of the wallaby AMH gene located between exons 2 and 5 was highly conserved with other species. Structural divergence was found in the sizes of exon 1 and intron 1 of wallaby AMH in comparison with eutherian mammals. Notably, intron 1 of the wallaby AMH gene was much larger (>3 kb) than intron 1 (~350 bp) of eutherian mammals, and exon 1 encoded 46 additional amino acids.



View larger version (63K):
[in this window]
[in a new window]
 
FIG. 3. Wallaby AMH gene structure and promoter sequence comparisons. A) Genomic organization of wallaby AMH. Exons (numbered), gray boxes; introns, solid lines. The location of the SF3A2 exon 4 in both human and mouse is indicated. The dashed line represents marsupial intron 1, which is 3.3 kb in size. B) Alignment of the AMH gene promoter region of eutherian mammals with that of the wallaby. Putative protein-binding domains are shaded

The region upstream of exon 1 of wallaby AMH had SF1-, SOX9-, and GATA-binding sites, and their spatial distribution relative to each other was conserved with respect to eutherian mammals (Fig. 3B). Interestingly, a putative SRY-binding site (attgACAAtgca) was also identified immediately adjacent to the proximal SF1-binding site. The putative SRY-binding site was 100% conserved within the SRY core-binding domain and 88% conserved within the flanking sequence, as predicted by MatInspector V2.2 (http://transfac.gbf.de/cgi-bin/matSearch/matsearch.pl).

To determine whether wallaby SF3A2 was upstream of AMH, we sequenced 1.8 kb upstream of the wallaby AMH translation start codon and were unable to identify any significant open reading frames sharing homology to the mouse or human Sf3a2/SF3A2 genes (Fig. 3A and data not shown). Several attempts were also made to PCR amplify SF3A2 using degenerate primers designed from conserved regions of the human, mouse, and rat sequences, but no wallaby sequences were amplified.

A wallaby genomic phage clone containing AMH exons 2–5 was used to localize AMH to wallaby fibroblast metaphase chromosome spreads. The wallaby AMH genomic phage clone hybridized to the distal end of the long arm of chromosome 3/4 (Fig. 4).



View larger version (103K):
[in this window]
[in a new window]
 
FIG. 4. Chromosomal localization of the wallaby AMH gene by FISH. Hybridization signals (pink) for wallaby AMH are localized to the distal end of the long arm of chromosome 3/4

AMH RNA Expression and AMH Protein Localization in the Wallaby

RT-PCR was used to assess the temporal pattern of AMH expression in the testes and ovaries of wallaby pouch young and adults. AMH expression was detected in newborn pouch young testes but not in newborn pouch young ovaries (Fig. 5). Similar results were obtained for days 4 and 8 pp pouch young gonads in which expression was detected in testes but not in ovaries (Fig. 5). In contrast to the lack of AMH expression found in pouch young ovaries, AMH transcripts were readily detected in adult ovaries (Fig. 5). AMH expression was not detected in fetal liver or mesonephros at day 25 of gestation or after birth on day 3 pp (data not shown). In adults, AMH was detected in the ovary and less intensively in the testis. AMH immunostaining was detected only in Sertoli cells of newborn wallaby testes that had begun to differentiate and organize seminiferous cords (Fig. 6A and 6B). By day 2 pp, seminiferous cords had formed in all wallaby testes and all had AMH immunostaining (data not shown). AMH expression was also detected in all testes from day 2 to day 10 (Fig. 6C and data not shown). No AMH immunostaining was observed in the testes of adult wallaby males during the breeding season (Fig. 6E).Wallaby ovaries between the ages of day 0 and day 10 pp were negative for AMH immunostaining (Fig. 6D and data not shown). In the adult ovary, primordial follicles in which the granulosa cells were flat were negative for AMH staining (data not shown). However, transitional and primary follicles with granulosa cells that had become cuboidal stained weakly for AMH (Fig. 6F). Preantral follicles stained more strongly for AMH (Fig. 6G). Early antral follicles also expressed AMH (Fig. 6H). Strong staining was detected in the mural and cumulus granulosa cells of secondary follicles and large antral follicles (Fig. 6I). In atretic follicles, some granulosa cells remained AMH immunopositive, but the majority of granulosa cells were AMH negative (Fig. 6J).



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. Wallaby AMH mRNA expression in pouch young gonads. An AMH product at the expected size of 605 bp was amplified from day 0 and days 4 and 8 pouch young testis and adult ovary and testis cDNA. The faint band observed in adult testis is thought to represent basal levels of transcription because AMH is not detectable by immunocytochemistry. Lane C shows a negative control in which template DNA was omitted. PGK1 primers were used to control for the integrity of the RNA used (data not shown)



View larger version (100K):
[in this window]
[in a new window]
 
FIG. 6. Immunolocalization of AMH in pouch young and adult gonads. A) Testis from a male on the day of birth showing strong immunostaining for AMH in the Sertoli cells of the developing seminiferous cords. The white dashed line outlines one of the forming cords. B) Testis from a different male on the day of birth. Note that seminiferous cords have yet to form and the testis has yet to begin producing AMH. C) Testis from a 10 day pp pouch young showing cord formation and strong immunostaining for AMH within the seminiferous tubules. D) AMH immunostaining is not present in ovaries from 10 day pp pouch young. E) AMH protein is not detected in the adult testis. F) Primary or transitional follicles in which the granulosa cell nuclei are becoming cuboidal in shape stain weakly for AMH. G) All preantral follicles are immunostained for AMH (this is a biovular follicle). H) In early antral follicles, AMH is present in the granulosa cells closest to the oocyte that are destined to become the cumulus cells as well as in the mural granulosa cells. I) All mural and cumulus granulosa cells of antral follicles synthesize AMH. J) Atretic follicles cease producing AMH. Scale bars = 100 µm in AE and HJ and 50 µm in F and G


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The wallaby AMH gene is encoded by 5 exons, as are all other AMH genes that have been characterized, including chick, mouse, rat, and human [6, 31, 50]. This five-exon structure appears to be a genetic signature for all AMH genes. The genomic structure between exons 2 and 5 is highly conserved between all species examined. However, the wallaby AMH gene diverges from those of eutherian mammals because of the greater size of exon 1 and intron 1. The wallaby AMH is 58 amino acids longer than the largest eutherian mammal AMH protein (cow, 576 amino acids) but similar in length to that of chicken AMH, which encodes a protein of 644 amino acids. The additional N-terminal sequence does not appear to be essential for Müllerian duct regression because the regression activity of the hormone is confined to the C-terminus [51]. Interestingly, the genomic structure of chicken AMH also diverges from eutherian mammals because of a larger exon 1 [31]. This may be associated with the apparent absence of the SF3A2 locus in wallaby and chicken that lies just upstream of eutherian mammal AMH genes (see below). A partial DNA sequence encoding a portion of the mature C-terminal region of AMH has previously been reported for another Australian marsupial, the brushtail possum (Trichosurus vulpecula) [52]. The brushtail possum AMH C-terminal region shares 93% sequence identity with the corresponding wallaby AMH C-terminus. Analysis of the possum partial AMH sequence shows that it is more similar to wallaby AMH than eutherian AMH proteins, creating a cluster of related marsupial AMH proteins.

The transcriptional regulation of the Amh gene has been studied extensively in vitro and in vivo. These studies have shown that Amh expression is regulated by binding sites for various transcription factors, including SF1, SOX9, and GATA, located just upstream of the transcription start site [2129]. The spatial relationships of these transcription factor–binding sites is also highly conserved. The 5' region of the wallaby AMH gene contains the same transcription factor–binding sites seen in eutherians, suggesting that wallaby AMH transcription is likely to be regulated by the same factors. In addition, the wallaby AMH regulatory region also has a putative SRY-binding site. If functional, this SRY-binding site could provide additional regulatory input for Sertoli cell-specific AMH transcription in the wallaby testis. Our previous studies have shown that SOX9 and SF1 are all expressed in the marsupial testis from at least day 1 pp and so are likely to regulate AMH transcription in the wallaby [44, 46, 53]. These findings suggest that during mammalian evolution AMH expression has been intimately linked to upstream sex determination mechanisms and that these mechanisms have remained intact despite marsupials undergoing sexual differentiation after birth.

The SF3A2 gene resides immediately upstream of mouse, rat, and human AMH genes [30] (UniGene Cluster Rn.41492 Rattus norvegicus). In the mouse and rat, the Sf3a2 termination codon is only 434 bp and 432 bp upstream of the Amh translation start codon, respectively, whereas in human the equivalent region is 789 bp [30] (UniGene Cluster Rn.41492 R. norvegicus). Sf3a2 is ubiquitously expressed, and RT-PCR analysis in the mouse showed that a significant amount of transcripts fail to polyadenylate, leading to read-through transcription into Amh. However, in the wallaby, we were unable to identify a SF3A2 orthologue within 1.8 kb of the AMH gene start codon. Therefore, if marsupials possess a SF3A2 orthologue, it is significantly farther upstream of the AMH locus than in eutherian mammals or located downstream or resides on a different chromosome altogether. A similar situation was found in the chicken, in which no homology to SF3A2 was detected within the 1.05 kb upstream of the AMH start codon [31]. Interestingly, the structures of both wallaby and chicken AMH genes diverge from eutherian AMH genes within exon 1 and intron 1. Because exon 1 is the most divergent and therefore least likely to be critical for function, its arrangement may not reflect any functional difference between these groups. Alternatively, it is possible that the presence of SF3A2 immediately upstream of the AMH loci has constrained their genomic structure within eutherian mammals.

AMH bioactivity in the male wallaby is first detected from at least 2 days pp [40], and the earliest signs of Müllerian duct regression begin around days 6–7 pp [39]. The difference in timing of these two events most likely reflects the time taken for Amh mRNA to be transcribed, translated into protein, and accumulated in sufficient quantities to initiate Müllerian duct regression. We detected AMH transcripts by RT-PCR in the testes of newborn wallaby pouch young and in pouch young up to day 10 pp using immunocytochemistry. At later stages there appears to be a marked down-regulation beginning at day 59, and AMH is no longer present by day 88 by which time the Müllerian ducts have completely regressed (G. Wijayanti, M.B. Renfree, G. Shaw, and N. Josso, unpublished observations). In ultrastructural studies the Sertoli cells differentiate and normally aggregate into seminiferous cords at around day 2 pp but, because of subtle variances in gestation length, in about 1 in 10 males this process has occurred by the time of birth [33]. In eutherian mammals the onset of AMH synthesis is correlated with the formation of seminiferous cords [2, 5, 5457]. However, AMH production is dependent on Sertoli cells and not on cord formation because disaggregated Sertoli cells that do not form cords continue to produce AMH [58]. At the time that Sertoli cells in the rat form cords, they acquire well-developed rough endoplasmic reticulum [59]. Similarly, tammar wallaby Sertoli cells have well-developed rough endoplasmic reticulum at the time that they form cords (M.B. Renfree and D.J. Whitworth, unpublished observations). A similar pattern of expression has been reported for the male brushtail possum in which AMH mRNA was localized by in situ hybridization to the Sertoli cells of the developing testis by the time of sexual differentiation and down-regulated in the adult testis [52]. This is consistent with expression in eutherian mammals in which the testis continues to produce AMH until puberty when the germ cells initiate spermatogenesis [69, 60].

In the developing female wallaby, there was no AMH detected at any stage using immunocytochemistry. In eutherian females, AMH is not expressed during fetal development but soon after birth becomes detectable in granulosa cells of developing follicles in the ovary. The ovary of the newborn marsupial at a stage of development is similar to that of a eutherian fetal ovary (i.e., folliculogenesis has not begun). Therefore, our finding that AMH transcripts and AMH protein are not expressed in the ovary of wallaby pouch young is consistent with findings in eutherian mammals. Surprisingly, a low level of AMH transcripts was detected by in situ hybridization in day 2 pp ovaries of the brushtail possum [52]. If these AMH transcripts are truly present, they must not produce sufficient amounts of AMH protein to induce Müllerian duct regression in female brushtail possums. The AMH expression found in the mural and cumulus granulosa cells of antral follicles in the wallaby ovary is similar to that observed in eutherian mammals [6, 1015] and the brushtail possum [52], except that wallaby AMH was also detected in small primary/transitional follicles. Similarly, AMH is detected in primary follicles of the brushtail possum [52]

AMH in the tammar wallaby is therefore highly conserved and as in all other mammals has an autosomal location, and its promoter region contains GATA-, SOX9-, SFI- and SRY-binding sites. Unlike eutherians, there is no SF3A2 gene within 1 kb of the AMH start codon. The gene is larger than that of other mammals, but its expression pattern in male and female wallabies is similar to them. Our results confirm that AMH expression has been conserved during the evolution of therian mammals and is intimately linked to upstream sex determination mechanisms in both marsupials and eutheria.


    ACKNOWLEDGMENTS
 
We thank Drs. Nathalie Josso for the kind use of her AMH antibody, Jenny Harry for help with the initial stages of this project, Wayne Bawden for assistance in the construction of the wallaby BAC library, and Soazik Jamin for helpful comments on the manuscript.


    FOOTNOTES
 
1 Supported by a grant from the National Institutes of Health (NIH) HD30284 to R.R.B. and the National Health and Medical Research Council of Australia (NHMRC) grant 940658 to M.B.R. and G.S.; A.J.P. was supported by a C.J. Martin Research Fellowship from the NHMRC; DNA sequencing was supported by NIH Cancer Center Support grant CA16672; A.J.P. and D.J.W. contributed equally to this work; M.B.R. and R.R.B. are co-senior authors. Back

2 Correspondence: Richard R. Behringer, Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030. FAX: 713 794 4394; rrb{at}mdanderson.org Back

3 Current address: Pfizer Kalamazoo Laboratories, Pfizer Inc., Kalamazoo, MI 49007 Back

Received: 5 June 2003.

First decision: 23 June 2003.

Accepted: 11 September 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Byskov AG, Høyer PE. Embryology of mammalian gonads and ducts. In: Knobil E, Neill JD (eds.). The Physiology of Reproduction, 2nd ed. New York: Raven Press; 1994:487–540
  2. Josso N, Cate RL, Picard J-Y, Vigier B, di Clemente N, Wilson C, Imbeaud S, Pepinsky RB, Guerrier D, Boussin L, Legeai L, Carré-Eusebe D. Anti-Müllerian hormone: the Jost factor. Rec Prog Horm Res 1993 48:1-59
  3. Baarends WM, van Helmond MJL, Post M, van der Schoot PJCM, Hoogerbrugge JW, de Winter JP, Uilenbroek JTJ, Karels B, Wilming LG, Meijers JHC, Themmen APN, Grootegoed JA. A novel member of the transmembrane serine/threonine kinase receptor family is specifically expressed in the gonads and in mesenchymal cells adjacent to the Müllerian duct. Development 1994 120:189-197[Abstract]
  4. Di Clemente N, Wilson C, Faure E, Bouissin L, Carmillo P, Tizard R, Picard J-Y, Vigier B, Josso N, Cate R. Cloning expression and alternative splicing of the receptor for anti-Müllerian hormone. Mol Endocrinol 1994 8:1006-1020[Abstract]
  5. Tran D, Meusy-Dessolle N, Josso N. Anti-Müllerian hormone is a functional marker of foetal Sertoli cells. Nature 1977 269:411-412[CrossRef][Medline]
  6. Morrish BC, Sinclair AH. Vertebrate sex determination: many means to an end. Reproduction 2002 124:447-457[Abstract]
  7. Tran D, Meusy-Dessolle N, Josso N. Waning of anti-Müllerian activity: an early sign of Sertoli cell maturation in the developing pig. Biol Reprod 1981 24:923-931[Abstract]
  8. Baker ML, Hutson JM. Serum levels of Müllerian inhibiting substance in boys throughout puberty and in the first two years of life. J Clin Endocrinol Metab 1993 76:245-247[Abstract]
  9. Rey R, Lordereau-Richard I, Carel JC, Barbet P, Cate RL, Roger M, Chaussain JL, Josso N. Anti-Müllerian hormone and testosterone serum levels are inversely related during normal and precocious pubertal development. J Clin Endocrinol Metab 1993 77:1220-1226[Abstract]
  10. Vigier B, Picard J-Y, Tran D, Legai L, Josso N. Production of anti-Müllerian hormone: another homology between Sertoli and granulosa cells. Endocrinology 1984 114:1315-1320[Abstract]
  11. Takahashi M, Hayashi M, Manganaro TF, Donahoe PK. The ontogeny of Müllerian inhibiting substance in granulosa cells of the bovine ovarian follicle. Biol Reprod 1986 35:447-453[Abstract]
  12. Bézard J, Vigier B, Tran D, Manteou P, Josso N. Immunocytochemical study of anti-Müllerian hormone in sheep ovarian follicles during fetal and post-natal development. J Reprod Fertil 1987 80:509-516[Abstract]
  13. Ueno S, Takahashi M, Manganaro TF, Ragin RC, Donahoe PK. Cellular localization of Müllerian inhibiting substance in the developing rat ovary. Endocrinology 1989 124:1000-1006[Abstract]
  14. Hirobe S, He W-W, Lee MM, Donahoe PK. Müllerian inhibiting substance messenger ribonucleic acid expression in granulosa and Sertoli cells coincides with their mitotic activity. Endocrinology 1992 131:854-862[Abstract]
  15. Hirobe S, He W-W, Gustafson ML, MacLaughlin DT, Donahoe PK. Müllerian inhibiting substance gene expression in the cycling rat ovary correlates with recruited or Graafian follicle selection. Biol Reprod 1994 50:1238-1243[Abstract]
  16. Kim JH, Seibel MM, MacLaughlin DT, Donahoe PK, Ransil BJ, Hametz PA, Richards CJ. The inhibitory effects of Müllerian-inhibiting substance on epidermal growth factor induced proliferation and progesterone production of human granulosa-luteal cells. J Clin Endocrinol Metab 1992 75:911-917[Abstract]
  17. Seifer DB, MacLaughlin DT, Penzias AS, Behrman HR, Asmundson L, Donahoe PK, Haning RV, Flynn SD. Gonadotropin-releasing hormone agonist-induced differences in granulosa cell cycle kinetics are associated with alterations in follicular fluid Müllerian-inhibiting substance and androgen content. J Clin Endocrinol Metab 1993 76:711-714[Abstract]
  18. di Clemente N, Goxe B, Remy JJ, Cate RL, Josso N, Vigier B, Salesse R, Effect of AMH upon aromatase activity and LH receptors of granulosa cells of rat and porcine immature ovaries. Endocrine 1994 2:553-558
  19. Josso N, Racine C, di Clemente N, Rey R, Xavier F. The role of anti-Müllerian hormone in gonadal development. Mol Cell Endocrinol 1998 145:3-7[CrossRef][Medline]
  20. Durlinger ALL, Kramer P, Karels B, de Jong FH, Uilenbroek JTJ, Grootegoed JA, Themmen APN. Control of primordial follicle recruitment by anti-Müllerian hormone in the mouse ovary. Endocrinology 1999 140:5789-5796[Abstract/Free Full Text]
  21. Haqq C, Lee MM, Tizard R, Wysk M, DeMarinis J, Donahoe PK, Cate RL. Isolation of the rat gene for Müllerian inhibiting substance. Genomics 1992 12:665-669[CrossRef][Medline]
  22. Shen WH, Moore CC, Ikeda Y, Parker KL, Ingraham HA. Nuclear receptor steroidogenic factor 1 regulates the Müllerian inhibiting substance gene: a link to the sex determination cascade. Cell 1994 77:651-661[CrossRef][Medline]
  23. Giuili G, Shen W-H, Ingraham HA. The nuclear receptor SF-1 mediates sexually dimorphic expression of Müllerian inhibiting substance in vivo. Development 1997 124:1799-1807[Abstract]
  24. De Santa Barbara P, Moniot B, Poulat F, Boizet B, Berta P. Steroidogenic factor-1 regulates transcription of the human anti-Müllerian hormone receptor. J Biol Chem 1998 273:29654-29660[Abstract/Free Full Text]
  25. Viger RS, Mertineit C, Trasler JM, Nemer M. Transcription factor GATA-4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Müllerian inhibiting substance promoter. Development 1998 125:2665-2675[Abstract]
  26. Arango NA, Lovell-Badge R, Behringer RR. Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development. Cell 1999 99:409-419[CrossRef][Medline]
  27. Tremblay JJ, Viger R.S. Transcription factor GATA-4 enhances Müllerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 1999 13:1388-401[Abstract/Free Full Text]
  28. Watanabe K, Clarke TR, Lane AH, Wang X, Donahoe PK. Endogenous expression of Müllerian inhibiting substance in early postnatal rat Sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites. Proc Natl Acad Sci U S A 2000 97:1624-1629[Abstract/Free Full Text]
  29. Beau C, Rauch M, Joulin V, Jegou B, Guerrier D. GATA-1 is a potential repressor of anti-Müllerian hormone expression during the establishment of puberty in the mouse. Mol Reprod Dev 2000 56:124-138[CrossRef][Medline]
  30. Dresser DW, Hacker A, Lovell-Badge R, Guerrier D. The genes for a spliceosome protein (SAP62) and the anti-Müllerian hormone (AMH) are contiguous. Hum Mol Genet 1995 4:1613-1618[Abstract/Free Full Text]
  31. Oreal E, Pieau C, Mattei M-G, Josso N, Picard J-Y, Carre-Eusebe D, Magre S. Early expression of AMH in chicken embryonic gonads precedes testicular SOX9 expression. Dev Dyn 1998 212:522-532[CrossRef][Medline]
  32. Springer MS, Westerman M, Kirsch JAW. Relationships among orders and families of marsupials based on the 12S ribosomal DNA sequences and the timing of the marsupial radiation. J Mammal Evol 1994 2:85-115[CrossRef]
  33. Renfree MB. Sexual dimorphisms in the gonads and reproductive tracts of marsupial mammals. In: Short RV, Balaban E (eds.). The Differences Between the Sexes. Cambridge, UK: Cambridge University Press; 1994:433–448
  34. Renfree MB, Harry JL, Shaw G. The marsupial male: a role model for sexual development. Philos Trans R Soc Lond B Biol Sci 1995 350:243-251[Medline]
  35. Renfree MB, O W-S, Short RV, Shaw G. Sexual differentiation of the urogenital system of the fetal and neonatal tammar wallaby, Macropus eugenii. Anat Embryol 1996 194:111-134[Medline]
  36. Renfree MB, Wilson JD, Short RV, Shaw G, George FW. Steroid hormone content of the gonads of the tammar wallaby during sexual differentiation. Biol Reprod 1992 47:644-647[Abstract]
  37. Alcorn GT, Robinson ES. Germ cell development in female pouch young of the tammar wallaby (Macropus eugenii). J Reprod Fertil 1983 67:319-325[Abstract]
  38. Renfree MB, Short RV. Sex determination in marsupials: evidence for a marsupial eutherian dichotomy. Phil Trans R Soc Lond B Biol Sci 1988 322:41-53[Medline]
  39. Whitworth DJ, Shaw G, Renfree MB. Müllerian duct regression in a marsupial the tammar wallaby. Anat Embryol 1997 196:39-46[CrossRef][Medline]
  40. Hutson JM, Shaw G, O WS, Short RV, Renfree MB. The ontogeny of Mullerian inhibiting substance production and testicular differentiation, migration and descent in the pouch young of a marsupial. Development 1988 104:549-556[Abstract/Free Full Text]
  41. Whitworth DJ. Müllerian inhibiting substance and early sexual differentiation in a marsupial (Macropus eugenii). Melbourne, Australia: University of Melbourne; 1996. Dissertation.
  42. Poole WE, Simms NG, Wood JT, Lubulwa M. Tables for age determination of the Kangaroo Island wallaby (tammar) Macropus eugenii from body measurements. CSIRO Division of Wildlife and Ecology Technical Memorandum; 1991; Melbourne, Australia. No. 32.
  43. O W-S, Short RV, Renfree MB, Shaw G. Primary genetic control of somatic sexual differentiation in a mammal. Nature 1988 331:716-717[CrossRef][Medline]
  44. Harry JL, Koopman P, Brennan FE, Graves JAM, Renfree MB. Widespread expression of the testis determining gene SRY in a marsupial. Nat Genet 1995 11:347-349[CrossRef][Medline]
  45. Neeper M, Lowe R, Galuska S, Hofmann KJ, Smith RG, Elbrecht A. Molecular cloning of an avian anti-Müllerian hormone homologue. Gene 1996 176:203-209[CrossRef][Medline]
  46. Whitworth DJ, Pask AJ, Shaw G, Graves JAM, Behringer RR, Renfree MB. Characterisation of steroidogenic factor 1 during sexual differentiation in a marsupial. Gene 2001 277:209-219[CrossRef][Medline]
  47. Koopman P, Gubbay J, Collignon J, Lovell-Badge R. Zfy gene expression patterns are not compatible with a primary role in mouse sex determination. Nature 1989 342:940-942[CrossRef][Medline]
  48. Zehavi-Feferman R, Cooper DW. PCR derived cDNA clones for X-linked phosphoglycerate kinase-1 in a marsupial the tammar wallaby (Macropus eugenii). Biochem Biophys Res Commun 1992 187:26-31[CrossRef][Medline]
  49. Thompson JD, Higgins DG, Gibson TJ. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994 22:4673-4680[Abstract/Free Full Text]
  50. Cate RL, Mattaliano RJ, Hession C, Tizard R, Farber NM, Cheung A, Ninfa EG, Frey AZ, Gash DJ, Chow EP, Fisher RA, Bertonis JM, Torres G, Wallner BP, Ramachandran KL, Ragin RC, Manganaro TF, MacLaughlin DT, Donahoe PK. Isolation of the bovine and human genes for Müllerian inhibiting substance and expression of the human gene in animal cells. Cell 1986 45:685-698[CrossRef][Medline]
  51. Wilson CA, di Clemente N, Ehrenfels C, Peplinsky RB, Josso N, Vigier B, Cate RL. Müllerian inhibiting substance requires its N-terminal domain for maintenance of biological activity, a novel finding within the transforming growth factor-ß superfamily. Mol. Endocrinol 1993 7:247-257[Abstract]
  52. Juengel JL, Whale LJ, Wylde KA, Greenwood P, McNatty KP, Eckery DC. Expression of anti-mullerian hormone mRNA during gonadal and follicular development in the brushtailed possum (Trichosurus vulpecula). Reprod Fertil Dev 2002 14:345-353[CrossRef][Medline]
  53. Pask AJ, Harry JL, Graves JA, O'Neill RJ, Layfield SL, Shaw G, Renfree MB. SOX9 has both conserved and novel roles in marsupial sexual differentiation. Genesis 2002 33:131-139[CrossRef][Medline]
  54. Tran D, Picard J-Y, Campargue J, Josso N. Immunocytochemical detection of anti-Müllerian hormone in Sertoli cells of various mammalian species including human. J Histochem Cytochem 1987 35:733-743[Abstract]
  55. Tran D, Josso N. Localization of anti-Müllerian hormone in the rough endoplasmic reticulum of the developing bovine Sertoli cell using immunocytochemistry with a monoclonal antibody. Endocrinology 1982 111:1562-1567[Medline]
  56. Massagué J. The transforming growth factor-ß family. Annu Rev Cell Biol 1990 6:597-641[CrossRef][Medline]
  57. Josso N, Lamarre I, Picard J-Y, Berta P, Davies N, Morichon N, Peschanski M, Jeny R. Anti-Müllerian hormone in early human development. Hum Dev 1993 33:91-99
  58. Magre S, Jost A. Dissociation between testicular organogenesis and endocrine cytodifferentiation of Sertoli cells. Proc Natl Acad Sci U S A 1984 81:7831-7834[Abstract/Free Full Text]
  59. Magre S, Jost A. Sertoli cells and testicular differentiation in the rat fetus. J Electron Miscrosc Tech 1991 19:172-188
  60. Kuroda T, Lee MM, Haqq CM, Powell DM, Manganaro TF, Donahoe PK. Mullerian inhibiting substance ontogeny and its modulation by follicle-stimulating hormone in the rat testes. Endocrinology 1990 127:1825-1832[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
G. Shaw, J. Fenelon, M. Sichlau, R. J. Auchus, J. D. Wilson, and M. B. Renfree
Role of the Alternate Pathway of Dihydrotestosterone Formation in Virilization of the Wolffian Ducts of the Tammar Wallaby, Macropus eugenii
Endocrinology, May 1, 2006; 147(5): 2368 - 2373.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/1/160    most recent
biolreprod.103.020016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.
Agricola
Right arrow Articles by Pask, A. J.
Right arrow Articles by Behringer, R. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS