Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print September 17, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.019588
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/1/236    most recent
biolreprod.103.019588v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.
Agricola
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.
BIOLOGY OF REPRODUCTION 70, 236–243 (2004)
DOI: 10.1095/biolreprod.103.019588
© 2004 by the Society for the Study of Reproduction, Inc.


Pituitary

Differential Activation of the Luteinizing Hormone ß-Subunit Promoter by Activin and Gonadotropin-Releasing Hormone: A Role for the Mitogen-Activated Protein Kinase Signaling Pathway in LßT2 Gonadotrophs1

Yoko Yamada, Hideyuki Yamamoto2, Toshie Yonehara, Haruhiko Kanasaki, Hiroyuki Nakanishi, Eishichi Miyamoto, and Kohji Miyazaki

Department of Molecular Pharmacology,3 Graduate School of Medical Sciences, Kumamoto University, Kumamoto 860-8556, Japan Department of Obstetrics and Gynecology,4 Shimane University School of Medicine, Izumo 693-8501, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
LH consists of {alpha}- and ß-subunits, and synthesis of the ß-subunit has been reported to be the rate-limiting step in LH production. In this study, we found that activin A increased both the LHß mRNA level and LH content in cells of the gonadotroph cell line, LßT2. We next examined the effects of activin A and GnRH on LHß promoter activity by reporter gene assay and compared the signal transduction pathways. Activin A and GnRH activated the LHß promoter, and the response to a combination of activin A and GnRH was higher than that to activin A or GnRH alone. The effects of activin A and GnRH were specifically inhibited by inhibin-like peptide and antide, a GnRH antagonist, respectively. The activation of the LHß promoter by GnRH was inhibited by PD098059 and U0126, MAP kinase kinase (MEK) inhibitors. In contrast, these protein kinase inhibitors did not inhibit the activin A-induced activation. GnRH, but not activin A, activated MAP kinase in LßT2 cells. Overexpression of constitutively active MEK1 or MEK kinase activated both MAP kinase and the LHß promoter. Furthermore, GnRH, but not activin A, strongly induced SRE-mediated transcription, a known target of the MAP kinase pathway. These results suggest that GnRH activates the LHß promoter via the MAP kinase pathway and that activin A-induced activation of the LHß promoter is independent of the MAP kinase pathway.

activin, anterior pituitary, gonadotropin-releasing hormone, kinases, luteinizing hormone


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
LH and FSH are produced in pituitary gonadotrophs and composed of two noncovalently linked subunits, {alpha} and ß. The {alpha}-subunit, called glycoprotein hormone {alpha}-subunit ({alpha}-GSU), is common to LH and FSH, and the ß-subunit is specific to each hormone. It has been reported that the synthesis of each ß-subunit is the rate-limiting step in LH and FSH production and is regulated by the complex interaction of multiple factors, including activin and GnRH [1, 2].

Activin, a member of the transforming growth factor (TGF)-ß family of growth factors, was originally identified as a factor in ovarian fluid that stimulated the secretion of FSH from pituitary gonadotrophs [2]. Now, activin is known to increase FSHß-subunit synthesis at the transcriptional level [3]. The expression of activin is not limited to the ovary, and it is secreted within the pituitary gland, where it exerts an autocrine/paracrine effect [3]. Experiments with rhesus monkeys [4] and rat primary cultured cells [5] suggested that activin physiologically regulates the production of LH as well as FSH. However, the molecular mechanisms of the regulation of LHß-synthesis by activin have not been examined.

GnRH is a hypothalamic peptide and serves as a critical regulator of the synthesis and secretion of LH and FSH. Several studies on GnRH-induced LH synthesis have been carried out with LßT2 cells [612]. The LßT2 cell line, derived from a pituitary tumor in a transgenic mouse, is a clonal strain of cultured gonadotrophs expressing the genes of the {alpha}- and ß-subunits of LH and the GnRH receptor. LßT2 cells secrete LH in response to GnRH, and GnRH-induced LH secretion is dependent on expression of the LHß gene [6]. It was reported that activation of both Gq and Gs proteins was involved in LHß protein synthesis by GnRH in LßT2 cells [7, 8]. It was also reported that GnRH activated the LHß promoter in the cells [912]. However, the involvement of MAP kinase in GnRH-induced LHß promoter activation is controversial. It was previously reported that protein kinase C-independent activation of c-Jun NH2-terminal kinase (JNK) was involved in the GnRH action [11]. Recently, it was reported that MAP kinase contributed about 50% to GnRH-induced LHß promoter activation [12].

In this study, we found that activin A increased the LHß mRNA level and the intracellular LH content in LßT2 cells. Furthermore, we compared the signal transduction pathways of LHß promoter activation by activin A and GnRH.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials

The following chemicals and reagents were obtained from the indicated sources: fetal calf serum (FCS), HyClone (Logan, UT); des-Gly10, [D-Ala6]-LH-RH Ethylamide (GnRH), inhibin-like peptide (3591 Da), and PD098059, Sigma (St. Louis, MO); recombinant human activin A, R&D Systems Inc. (Minneapolis, MN); calphostin C, Calbiochem Novabiochem (La Jolla, CA); U0126, Cell Signaling Technology (Beverly, MA); antide (N-Ac-D-Nal1-D-Cpa2-D-Pal3-Ser4-Lys[Nic]6-Leu7-Ilys8-Pro9-D-Ala10-NH2), a GnRH antagonist, Bachem (King of Prussia, PA); anti-active MAP kinase antibody (rabbit pTEpY), Promega (Madison, WI); anti-MAP kinase antibody, Zymed Laboratories Inc. (San Francisco, CA); anti-GnRH receptor, Lab Vision Co. (Westinghouse, CA); Dulbecco modified Eagle medium (DMEM), Nissui Pharmaceutical Co. (Tokyo, Japan); and serum response element (SRE) firefly luciferase reporter gene (pSRE-Luc), nuclear factor-kappa B (NF-{kappa}B) firefly luciferase reporter gene (pNF-{kappa}B-Luc), pFC-MEK1, and pFC-MEKK, Stratagene (La Jolla, CA).

Culture of LßT2 Cells

LßT2 cells were kindly provided by Dr. P.L. Mellon (University of California, San Diego, CA). LßT2 cells were cultured in DMEM containing 10% FCS and 50 µg/ml streptomycin and maintained at 37°C in an atmosphere of 95% air-5% CO2 [1315]. Cells from passages 8–12 were used in this study. Two or three days before experiments, 2–4 x 105 cells were plated on a 35-mm Petri dish (Nunc, Roskilde, Denmark). When test reagents were added, LßT2 cells were incubated in DMEM without FCS or with 1% FCS at 37°C for the indicated times with or without the test reagents. When we examined the effects of some inhibitors, the cells were preincubated with each inhibitor for 60 min at 37°C as indicated. We chose the concentrations of antide (100 nM), U0126 (10 µM), PD098059 (50 µM), calphostin C (800 nM), and nifedipine (10 µM) on the basis of previous reports [13, 14, 1618]. The cells were incubated with or without GnRH or activin A in the presence or absence of each inhibitor. After incubation for the indicated times, the medium was quickly aspirated, and the cells were washed once with PBS and immediately frozen in liquid N2.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Total RNA was prepared from LßT2 cells using TRIzol LS Reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer's protocol. Messenger RNA (mRNA) was reverse transcribed into single-stranded cDNA using an oligo (deoxythymidine) primer (Promega Corp., Madison, WI) and Moloney murine leukemia virus reverse transcriptase (GIBCO BRL, Gaithersburg, MD). The reaction mixtures were diluted 20-fold and then subjected to PCR amplification of mouse {alpha}-GSU, LHß, FSHß, or GnRH receptor cDNA. The PCR primers were designed based on the published sequences of {alpha}-GSU [19], LHß (GenBank D00576)[20], FSHß (GenBank U12932)[21], and GnRH receptor [22]. For amplification of the {alpha}-GSU cDNA, we used a sense primer (5'-TTTACGGTTACATCCCTTATA-3') and an antisense primer (5'-TATAAGGGATGTAACCGTAAA-3'). For amplification of the LHß-subunit cDNA, we used a sense primer (5'-GCCGGCCTGTCAACGCAACC-3') and an antisense primer (5'-GAGGGCCACAGGGAAGGAGA-3'). For amplification of the FSHß-subunit cDNA, we used a sense primer (5'-ACCATGATGAAGTTGATCCAG-3') and an antisense primer (5'-TCCTTCATTTCACTGAAGGAG-3'). For amplification of the GnRH receptor cDNA, we used a sense primer (5'-GCTTCCTTCTTGTTGAAGCTG-3') and an antisense primer (5'-GCCTAGGACATAGTAGGGAG-3'). PCR amplification was performed using the Gene Amp PCR system 2400 (Perkin-Elmer Corp., Foster City, CA) for 26, 25, 35, 25, and 18 cycles for {alpha}-GSU, LHß, FSHß, GnRH receptor, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), respectively. The PCR products were separated by electrophoresis on a 1.0% agarose gel, visualized by ethidium bromide staining, and quantified by scanning densitometry using NIH image (version 1.61; NIH, Bethesda, MD) [13]. The amount of PCR product was normalized to that of GAPDH in each sample. Before a quantitative RT-PCR analysis was carried out, the linear range of amplification was established by changing the number of PCR cycles and the amount of total RNA for reverse transcription. In pilot experiments, the amplification curves of {alpha}-GSU, LHß, FSHß, GnRH receptor, and GAPDH cDNAs were linear from 25 to 27 cycles, 24 to 26 cycles, 32 to 35 cycles, 23 to 26 cycles, and 15 to 19 cycles, respectively. In addition, we confirmed a linear relationship between the relative signal of each PCR product and the amount of total RNA, ranging from 0.45 to 1.2 µg (data not shown).

Measurement of the Intracellular LH Content

To measure the intracellular LH content, cells in 35-mm dishes were scraped with 0.5% Triton X-100 in PBS. After sonication (Sonifier 250, Branson, Danbury, CT), insoluble materials were removed by centrifugation at 15 000 x g for 5 min, and the supernatants were used for measurement of LH content. The amount of LH was determined by a double-antibody RIA using the rat [125I]LH assay system (Amersham Pharmacia Biotech, Little Chalfont, UK). The protein concentration in the supernatants was determined by the method of Bradford [23], with BSA as standard. The amount of LH was normalized to protein content.

Reporter Plasmid Construct and Luciferase Assay

Genomic DNA of rat liver was isolated using PUREGENE Genomic DNA Purification Kit (Minneapolis, MN). PCR was carried out to amplify the fragment containing the LHß promoter based on the published sequences (AF020505) [24]. Using the PCR primers, which consisted of a sense primer containing the Bgl II restriction site (5'-ACGCAGATCTCCATCGCAACCGATCGTG-3') and an antisense primer containing the HindIII restriction site (5'-GGCTAAGCTTGATACCTTCCCTACCTTG-3'), we amplified the LHß promoter region (-797 to +5; the transcriptional start site was numbered as 1). The fragment of the LHß promoter region was excised with BglII and HindIII restriction enzymes and inserted into the BglII and HindIII sites of the pGL3-basic luciferase reporter vector (Promega; termed pGL3-LHßp). Both strands of the LHß promoter region were sequenced with RV primer 3 and GL primer 2 (Promega), using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit and ABI PRISM 310 sequencer (Perkin-Elmer). LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg DNA) and pRL-TK (0.1 µg DNA; Promega), which contains Renilla luciferase under the herpes simplex virus thymidine kinase promoter, using 3 µl of FuGENE 6 transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN) in 2 ml standard medium. In some experiments, the cells were cotransfected with the pFC-MEK1 (2.0 µg DNA), pFC-MEKK (1.0 µg DNA), or pCAGGSneo expression vector (a gift from Prof. Miyazaki, Osaka University, Osaka, Japan; mock-transfected cells) in addition to pGL3-LHßp and pRL-TK. When the activity of the promoter containing SRE or NF-{kappa}B was measured, the cells were transfected with pSRE-Luc (1.0 µg DNA) or pNF-kB-Luc (1.0 µg DNA), which has five-tandem repeats of SRE (AGGATGTCCATATTAGGACATCT) or NF-{kappa}B (TGGGGACTTTCC-GC), respectively, upstream of the TATA box of the firefly luciferase gene. After incubation of the cells for 36 h, they were treated with chemicals for each experiment. The activities of firefly luciferase and Renilla luciferase were measured by the Dual Luciferase Reporter Assay System (Promega) with a luminometer (TD-20/20, Promega) according to the manufacturer's protocol. The ratio of the luminescence signal of firefly luciferase to that of Renilla luciferase was determined. We noticed that the level of LHß promoter activation varied among the experiments. The reasons for these differences are not clear at present but may be due to differences in cell passage and cell batch. Therefore, representative results were shown instead of mean ± SEM values of all the repeats of the same experiments.

Preparation of Cell Extracts and Immunoblot Analysis

The procedures for preparation of cell extracts were carried out at 4°C. Frozen cells were scraped and solubilized in 150 µl of a homogenization buffer containing 50 mM Hepes (pH 7.4), 0.1% Triton X-100, 4 mM EGTA, 10 mM EDTA, 15 mM Na4P2O7, 100 mM ß-glycerophosphate, 25 mM NaF, 0.1 mM leupeptin, 75 µM pepstatin A, 1 mM dithiothreitol, 1 mM (p-amidinophenyl) methanesulfonyl fluoride hydrochloride, 1 mM Na3VO4, and 100 nM calyculin A [13, 14]. After sonication, the insoluble materials were removed by centrifugation at 15 000 x g for 10 min. The protein concentration was determined by the method of Bradford [23] with BSA as standard. Cell extracts were treated with SDS sample buffer [25] and boiled for 2 min. Samples containing the same amount of proteins were subjected to SDS-PAGE in 10% acrylamide and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated overnight with the anti-active MAP kinase antibody (1:1000). The membrane was washed three times with blocking solution containing 4.5% nonfat dry milk, 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% Tween-20 and then washed more than four times with Tris-buffered saline with Tween-20 (TTBS) containing 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% Tween-20 at room temperature, followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:5000). Immunoreactive proteins were detected using the enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech) as directed by the instructions provided by the manufacturer. For reprobing, the membrane was submerged in stripping buffer (62.5 mM Tris-HCl [pH 6.7], 100 mM 2-mercaptoethanol, and 2% SDS) and incubated at 50°C for 30 min. The membrane was washed with blocking solution and TTBS as described above and was subjected to immunoblot analysis with anti-MAP kinase antibody (1:1000).

Statistical Evaluation

Values were expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA plus Duncan's multiple range test. P < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effects of Activin A on the LHß mRNA Level and LH Production in LßT2 Cells

It has been reported that FSHß mRNA was increased by the treatment of LßT2 cells with activin A [9, 26]. To investigate whether activin A increased the levels of the mRNAs of LHß and the GnRH receptor, as well as FSHß mRNA, we performed quantitative RT-PCR analysis (Fig. 1, A and B). Treatment of the cells with activin A for 24 h increased LHß mRNA in a dose-dependent manner (Fig. 1A). The increases in FSHß and LHß mRNA levels were detected at a dose of 10 ng/ml. When the cells were treated with 40 ng/ml activin A, the levels of LHß and FSHß mRNAs were significantly increased within 6 h (Fig. 1B). LHß and FSHß mRNA levels were increased to 177.5 ± 12.3% and 791.5 ± 52.4%, respectively, at 6 h. The increase in the GnRH receptor mRNA level by activin A was dose dependent (Fig. 1A). The GnRH receptor mRNA level was increased to 154.5 ± 8.3% at 6 h after treatment with 40 ng/ml activin A and returned to the basal level after 24 h (Fig. 1B). Activin A did not affect the {alpha}-GSU mRNA level (data not shown). We next examined the effects of activin A on the intracellular LH content (Fig. 1C). The intracellular LH content was significantly increased to 153.0 ± 4.2% within 24 h. We noticed that the LH content was increased during the culture without activin A. The LH content was increased to 151.0 ± 4.0% and 234.0 ± 15.0% in the absence and presence of activin A, respectively, at 72 h.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. Effects of activin A on the levels of the mRNAs of LHß, FSHß, and the GnRH receptor (GnRH-R), and the intracellular LH content. A) Dose-response effects of activin A on the levels of mRNAs. LßT2 cells were treated with activin A (0–100 ng/ml) for 24 h. Total RNA (0.8 µg) was reverse transcribed, and PCR was carried out using the primers of LHß, FSHß, and the GnRH receptor. B) Time-course effects of activin A on the levels of mRNAs. LßT2 cells were treated with activin A (40 ng/ml) for 0–24 h. The amount of PCR product was normalized to that of the PCR product of GAPDH in each sample. Each amount of PCR products at 0-h incubation (control) was taken as 100%, and from this value, other values were calculated. Values are the mean ± SEM (four wells per condition in a single experiment). We repeated the same experiments four times with reproducible results, and representative results are shown. **P < 0.01 (vs. control). C) Time-course of effects of activin A on the intracellular LH content. LßT2 cells were treated with activin A (40 ng/ml) for the indicated time intervals. The intracellular LH content at 24-h incubation without activin A (control) was taken as 100%, and from this value, other values were calculated. Values are the mean ± SEM (three wells per condition in a single experiment). We repeated the same experiments four times with reproducible results, and representative results are shown. **P < 0.01; *P < 0.05 (vs. control). The differences between without and with activin A were statistically significant at 48 h and 72 h (P < 0.05)

Activation of the LHß Promoter by Activin A and GnRH

To investigate the effects of activin A and GnRH on the activity of the LHß promoter, we constructed the luciferase reporter gene after the fragment (-797 to +5) of the LHß promoter region (termed pGL3-LHßp). Sequence analysis of the obtained fragment revealed that the nucleotide sequence was over 98% identical to that of the reported sequence [24] (data not shown). When LßT2 cells were transfected with pGL3-LHßp and treated with GnRH and activin A, LHß promoter activity was increased as reported [912] (Fig. 2). LHß promoter activity was increased to 616.4 ± 20.7% and 202.2 ± 5.1% with 10 nM GnRH and 40 ng/ml activin A, respectively. Interestingly, a combination of activin A and GnRH activated the LHß promoter more strongly than GnRH alone, suggesting that activin A activated the LHß promoter by different molecular mechanisms from GnRH (Fig. 2). To confirm that the activation of the LHß promoter by GnRH and activin A was receptor mediated, we examined the effects of antide and inhibin-like peptide. We found that the effect of GnRH was completely inhibited by addition of 100 nM antide, a GnRH antagonist (Fig. 3). Antide alone had no effects on LHß promoter activity, suggesting that the activation of the LHß promoter by GnRH was receptor mediated. Inhibin-like peptide completely inhibited the effect of activin A, whereas no inhibition was observed in the case of the activation by GnRH (Fig. 3). Inhibin-like peptide had a trend toward LHß promoter activation, although the effects were not statistically significant (Fig. 3).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. Activation of the LHß promoter by GnRH and activin A. LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg) and pRL-TK (0.1 µg) for 36 h. The cells were treated without (control) or with 10 nM GnRH or 40 ng/ml activin A, or both, for 8 h. The activity is expressed as a percentage of the control. Values are the mean ± SEM (four wells per condition in a single experiment). **P < 0.01 (vs. control). Differences between GnRH and GnRH plus activin A and between activin A and GnRH plus activin A were statistically significant (P < 0.01). We repeated the same experiments six times with reproducible results, and representative results are shown



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Effects of antide and inhibin-like peptide on LHß promoter activation by GnRH and activin A. LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg) and pRL-TK (0.1 µg) for 36 h. The cells were preincubated without or with 100 nM antide or 100 ng/ml inhibin-like peptide (inhibin) for 4 h and further treated without (control) or with 40 ng/ml activin A or 10 nM GnRH in the presence or absence of antide or inhibin-like peptide for 8 h. The activity is expressed as a percentage of the control. Values are the mean ± SEM (four wells per condition in a single experiment). **P < 0.01 (vs. control). The difference between GnRH and GnRH plus antide was statistically significant (P < 0.01). The difference between activin A and activin A plus inhibin-like peptide was statistically significant (P < 0.01). We repeated the same experiments five times with reproducible results, and representative results are shown

Effects of Protein Kinase Inhibitors and Nifedipine on LHß Promoter Activation

For the next step, we examined the possible involvements of MAP kinase and protein kinase C in activin A- and GnRH-induced activations of the LHß promoter. It was interesting that the stimulatory effect of GnRH was completely abolished by PD098059 and U0126, specific MEK inhibitors (Fig. 4). These results suggested that the MAP kinase pathway was necessary for the transcriptional effects of GnRH. In contrast, neither PD098059 nor U0126 inhibited the activation by activin A. Calphostin C, a specific protein kinase C inhibitor, strongly inhibited GnRH-induced LHß promoter activation (Fig. 5). Nifedipine, an L-type calcium channel blocker, partially inhibited LHß promoter activation by GnRH (Fig. 5), suggesting that calcium influx through the L-type calcium channel had some role in LHß promoter activation. Interestingly, calphostin C strongly inhibited activin A-induced LHß promoter activation (Fig. 5). These results suggested that protein kinase C was involved in the activin A action. In contrast, nifedipine did not inhibit activin A-induced LHß promoter activation (Fig. 5). Calphostin C or nifedipine alone had no effect on LHß promoter activity (Fig. 5).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 4. Effects of MEK inhibitors on LHß promoter activation by GnRH and activin A. LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg) and pRL-TK (0.1 µg) for 36 h. The cells were treated without (control) or with 10 nM GnRH or 40 ng/ml activin A in the presence or absence of 50 µM PD098059 or 10 µM U0126 for 8 h. The activity is expressed as a percentage of the control. Values are the mean ± SEM (three wells per condition in a single experiment). **P < 0.01; *P < 0.05 (vs. control). The difference between GnRH and GnRH plus each inhibitor was statistically significant (P < 0.01). We repeated the same experiments three times with reproducible results, and representative results are shown



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5. Effects of calphostin C and nifedipine on LHß promoter activation by GnRH and activin A. LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg) and pRL-TK (0.1 µg) for 36 h. The cells were preincubated without or with 800 nM calphostin C or 10 µM nifedipine for 60 min and further treated without (control) or with 10 nM GnRH or 40 ng/ml activin A in the presence or absence of each inhibitor for 8 h. The activity is expressed as a percentage of the control. Values are the mean ± SEM (four wells per condition in a single experiment). **P < 0.01; *P < 0.05 (vs. control). The difference between GnRH and GnRH plus calphostin C, between GnRH and GnRH plus nifedipine, or between activin A and activin A plus calphostin C was statistically significant (P < 0.01). We repeated the same experiments six times with reproducible results, and representative results are shown

Activation of MAP Kinase by Activin A and GnRH

We next examined whether activin A and GnRH activated MAP kinase in LßT2 cells (Fig. 6). When the anti-MAP kinase antibody was used for immunoblot analysis, we found that both the 44-kDa ERK1 and the 42-kDa ERK2 occurred in LßT2 cells (Fig. 6B). Immunoblot analysis with anti-active MAP kinase antibody showed that 10 nM GnRH strongly activated MAP kinase within 30 min, while 40 ng/ml activin A did not activate MAP kinase (Fig. 6A). The GnRH-induced activation of MAP kinase was completely inhibited by U0126. When the anti-MAP kinase antibody was used for immunoblot analysis, no significant changes in immunoreactivity were observed with any treatment (Fig. 6B). When we examined the time-course of effects of GnRH and activin A, activation of MAP kinase by 10 nM GnRH reached a maximal peak at 30 min and remained elevated for 3 h (data not shown). In contrast, 40 ng/ml activin A did not activate MAP kinase at any time point examined (data not shown). These results further supported our idea that the MAP kinase pathway was involved in the activation of the LHß promoter by GnRH but not by activin A.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 6. Effects of GnRH and activin A on MAP kinase activation. LßT2 cells were preincubated without or with 10 µM U0126 for 60 min and further treated without (control) or with 10 nM GnRH or 40 ng/ml activin A in the presence or absence of U0126 for 30 min. The cell extracts (18 µg) were subjected to SDS-PAGE, and immunoblot analysis was done with anti-active MAP kinase antibody (A). After the antibody was stripped, immunoblot analysis with anti-MAP kinase antibody (B) was carried out. The positions of ERK1 (P-ERK1 or ERK1) and ERK2 (P-ERK2 or ERK2) are indicated. We repeated the same experiments three times with reproducible results, and representative results are shown

Effects of Overexpression of MEK1 and MEK Kinase on LHß Promoter Activation

For the next step, we asked whether activation of MAP kinase could imitate the effects of GnRH on LHß promoter activation. For this purpose, we transfected the cells with pFC-MEK1 or pFC-MEKK plasmid vector to overexpress constitutively active MEK1 or MEK kinase (MEKK), respectively. Figure 7 shows that overexpression of MEK1 or MEKK resulted in the activation of the LHß promoter compared with mock-transfected cells. Furthermore, U0126 completely inhibited the activation of the LHß promoter by overexpression of MEK1 and MEKK.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7. Effects of overexpression of MEK1 and MEKK on LHß promoter activation. LßT2 cells were cotransfected with pFC-MEK1 (2.0 µg; MEK1), pFC-MEKK (1.0 µg; MEKK), or pCAGGSneo (1.0 µg; MOCK) and with pGL3-LHßp (1.0 µg) and pRL-TK (0.1 µg) in the presence or absence of 10 µM U0126 for 36 h. The value of mock-transfected cells without U0126 was taken as 100%, and from this value, other values were calculated. Values are the mean ± SEM (four wells per condition in a single experiment). **P < 0.01 (vs. mock). The difference between MEK1 and MEK1 plus U0126 (P < 0.05) and that between MEKK and MEKK plus U0126 (P < 0.01) were statistically significant. We repeated the same experiments five times with reproducible results, and representative results are shown

Immunoblot analysis with anti-active MAP kinase antibody indicated that overexpression of MEK1 or MEKK activated MAP kinase (data not shown). Addition of U0126 completely abolished the activation of MAP kinase by MEK1 and MEKK overexpression (data not shown). When the anti-MAP kinase antibody was used for immunoblot analysis, no significant changes in immunoreactivity were observed with any treatment (data not shown). From these results, we concluded that activation of MAP kinase is sufficient for activation of the LHß promoter.

Effects of GnRH and Activin A on SRE-Mediated Transcription

We wondered whether the GnRH-induced activation of MAP kinase was strong enough to increase SRE-mediated transcription, a known target of the MAP kinase pathway [27]. GnRH dramatically activated SRE-mediated transcription (Fig. 8A), suggesting that GnRH activated the MAP kinase pathway strongly enough to activate the promoter containing SRE. As the activation of this promoter by GnRH was much stronger than the LHß promoter, we expected that we might detect the activation of the MAP kinase pathway by activin A using this assay system. In contrast, activin A did not activate SRE-mediated transcription or augment the GnRH action (Fig. 8A). These results further supported our idea that activation of the MAP kinase pathway does not occur by activin A treatment.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 8. Effects of GnRH and activin A on SRE- and NF-{kappa}B-mediated transcription. LßT2 cells were cotransfected with pSRE-Luc (1.0 µg) (A) or pNF-{kappa}B-Luc (1.0 µg) (B) and pRL-TK (0.1 µg) for 36 h. The cells were treated without (control) or with 10 nM GnRH or 40 ng/ml activin A, or both, for 8 h. The activity is expressed as a percentage of the control. Values are the mean ± SEM (three wells per condition in a single experiment). **P < 0.01 (vs. control). The difference between GnRH and GnRH plus activin A was not statistically significant. We repeated the same experiments three times with reproducible results, and representative results are shown

It was surprising that GnRH strongly activated NF-{kappa}B-mediated transcription (Fig. 8B). To our knowledge, this is the first report on the stimulative effect of GnRH on transcriptional activity using the NF-{kappa}B luciferase reporter gene assay system. However, activin A did not activate NF-{kappa}B-mediated transcription (Fig. 8B), suggesting that activin A did not activate the NF-{kappa}B pathway. U0126 strongly inhibited the GnRH-induced activation of both SRE- and NF-{kappa}B-mediated transcription (data not shown).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies on the control of reproductive functions by GnRH and activin A have been performed in vivo in a variety of animal models and in vitro in dispersed pituitary cells [15]. These studies are limited by the heterogeneity of anterior pituitary cell types, only 6%–15% of which are gonadotrophs in adult animals [28]. Therefore, dispersed pituitary cells are not adequate for biochemical studies on the signal transduction pathways of GnRH and activin A. In the present study, we used LßT2 cells because they express the LHß subunit and the receptors for GnRH and activin [6, 9].

It is well established that activin increases the FSHß-subunit at the transcriptional level [3]. However, regulation of LHß-subunit synthesis by activin is not clear at present. Using LßT2 cells, we obtained clear evidence that activin A increased LH content as well as LHß mRNA and LHß promoter activity. The experiments with inhibin-like peptide clearly showed that the activin A action occurs through the activin receptor. As the GnRH-induced activation of the LHß promoter has been reported, we compared the signal transduction pathways of GnRH and activin A. It is obvious that the GnRH-induced activation of LHß promoter was mediated by MAP kinase for the following reasons: 1) PD098059 and U0126 inhibited the LHß promoter activation by GnRH, 2) GnRH treatment resulted in strong activation of MAP kinase, 3) overexpression of constitutively active MEK1 or MEKK imitated the effects of GnRH on LHß promoter activation, and 4) activation of the MAP kinase pathway by GnRH was strong enough to activate SRE-mediated transcription, a known target of the MAP kinase pathway. Previously, it was reported that PD098059 had no effects on the GnRH-induced activation of the LHß promoter [11]. Recently, it was reported that the MAP kinase pathway contributed about 50% to the GnRH-induced activation [12]. Our results indicated that activation of the MAP kinase pathway was required for GnRH-induced activation. The reasons for the differences among these studies are not clear at present. It was reported that MAP kinase was involved in GnRH-induced LHß protein expression [8]. Therefore, the previous reports [8, 12] and our present data strongly suggest that MAP kinase is involved in GnRH-induced LHß synthesis at the transcriptional level.

It has been reported that activation of MAP kinase by GnRH is mediated via protein kinase C in LßT2 cells [7, 11]. The present observation that calphostin C inhibits the activation of the LHß promoter is in good agreement with these reports. It was reported that protein kinase C activated Raf by direct phosphorylation [29], which acts upstream of MAP kinase. Protein kinase C may also act at steps upstream of Raf to activate MAP kinase, but these targets remain to be defined. As GnRH-induced activation of the LHß promoter was not completely blocked by calphostin C, it was possible that calphostin C-insensitive protein kinase C isoenzymes or signal transduction pathways other than the protein kinase C pathway were also involved in the activation of MAP kinase. Recently, it was reported that the LHß promoter was activated by a 6-h treatment of LßT4 cells with GnRH and that GnRH action was mediated by protein kinase C [30]. However, the involvement of the MAP kinase pathway was not detected under those experimental conditions. Differences between the results in the involvement of the MAP kinase pathway are not clear at present but may be due to the differences between LßT4 and LßT2 cells. In previous work, we have reported that MAP kinase activation is a crucial step for the transcriptional regulation of prolactin and growth hormone by the thyrotropin-releasing hormone/protein kinase C pathway and the pituitary adenylate cyclase-activating polypeptide/cyclic AMP pathway in GH3 cells [13, 14].

Treatment of LßT2 cells with GnRH resulted in the activation of JNK [7, 11], and JNK was also reported to be involved in GnRH-induced LHß promoter activation in LßT2 cells [11]. However, our immunoblot analysis with anti-active JNK antibody could not detect activation of JNK by treatment with either GnRH or activin A (data not shown).

It is well known that the Smad family proteins are critical components of the TGF-ß signaling pathways [31, 32]. Receptor-mediated phosphorylation of Smad 2 or Smad 3 induces their association with Smad 4, followed by translocation into the nucleus, where these complexes activate the transcription of specific genes. However, accumulating data suggest that Smad-independent pathways also exist in the TGF-ß signaling pathways [3133]. For instance, TGF-ß activated MAP kinase in an epithelial cell line [33]. Therefore, we considered the possibility that activin A may activate MAP kinase, followed by activation of the LHß promoter in LßT2 cells. However, activin A treatment did not activate MAP kinase, and no effects of PD098059 and U0126 on the activin A action were observed. Furthermore, SRE-mediated transcription was not activated by activin A treatment. These results suggest that the MAP kinase pathway is not involved in transcriptional regulation by activin A. Very recently, it was reported that activin activated MAP kinase in LßT2 cells [34]. The reasons for the difference from our results are not clear at present. It was interesting that calphostin C strongly inhibited activin A-induced LHß promoter activation, suggesting that protein kinase C was involved in the activin A action.

The activation of the LHß promoter by a combination of activin A and GnRH was higher than that by activin A or GnRH alone. As the level of mRNA of the GnRH receptor was increased by activin A treatment, we examined whether activin A increased the GnRH receptor at the protein level under our assay conditions by immunoblot analysis. The treatment of the cells with 40 ng/ml activin A plus 10 nM GnRH did not increase the amount of GnRH receptor protein until 12 h (data not shown). As the cells were treated with activin A for 8 h in a reporter gene assay, it is unlikely that activin A augments the GnRH action through an increase in the GnRH receptor level.


    ACKNOWLEDGMENTS
 
We gratefully acknowledge Dr. P.L. Mellon (University of California) for the gift of LßT2 cells and Dr. K. Nakayama (Shimane Medical University) and Dr. S. Kihara (Kumamoto University) for technical support.


    FOOTNOTES
 
1 This work was supported in part by Grants-in-Aid for Scientific Research and for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture of Japan; by a research grant from the Human Frontier Science Program (H.Y. and E.M.); and by a grant from the Ministry of Health and Welfare (K.M.). Back

2 Correspondence: Hideyuki Yamamoto, Department of Molecular Pharmacology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556, Japan. FAX: 81 96 373 5078; hideyuki{at}gpo.kumamoto-u.ac.jp Back

Received: 20 May 2003.

First decision: 4 June 2003.

Accepted: 9 September 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Evans JJ. Modulation of gonadotropin levels by peptides acting at the anterior pituitary gland. Endocr Rev 1999 20:46-67[Abstract/Free Full Text]
  2. Ling N, Ying SY, Ueno N, Shimasaki S, Esch F, Hotta O, Guillemin R. Pituitary FSH is released by a heterodimer of the ß-subunits from the two forms of inhibin. Nature 1986 321:779-782[CrossRef][Medline]
  3. Speroff L, Glass RH, Kase NG. Regulation of the menstrual cycle. In: Clinical Gynecologic Endocrinology and Infertility, 6th ed. Baltimore, MD: Lippincott Williams & Wilkins; 1999:210–227
  4. Stouffer RL, Woodruff TK, Dahl KD, Hess DL, Mather JP, Molskness TA. Human recombinant activin-A alters pituitary luteinizing hormone and follicle-stimulating hormone secretion, follicular development, and steroidogenesis, during the menstrual cycle in rhesus monkeys. J Clin Endocrinol Metab 1993 77:241-248[Abstract]
  5. Attardi B, Miklos J. Rapid stimulatory effect of activin-A on messenger RNA encoding the follicle-stimulating hormone ß-subunit in rat pituitary cell cultures. Mol Endocrinol 1990 4:721-726[Abstract/Free Full Text]
  6. Turgeon JL, Kimura Y, Waring DW, Mellon PL. Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line. Mol Endocrinol 1996 10:439-450[Abstract/Free Full Text]
  7. Liu F, Austin DA, Mellon PL, Olefsky JM, Webster NJG. GnRH activates ERK1/2 leading to the induction of c-fos and LHß protein expression in LßT2 cells. Mol Endocrinol 2002 16:419-434[Abstract/Free Full Text]
  8. Liu F, Usui I, Evans LG, Austin DA, Mellon PL, Olefsky JM, Webster NJG. Involvement of both Gq/11 and Gs proteins in gonadotropin-releasing hormone receptor-mediated signaling in LßT2 cells. J Biol Chem 2002 277:32099-32108[Abstract/Free Full Text]
  9. Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang HJ, Miller WL, Mellon PL. Cell-specific transcriptional regulation of follicle-stimulating hormone-ß by activin and gonadotropin-releasing hormone in the LßT2 pituitary gonadotrope cell model. Endocrinology 2001 142:2284-2295[Abstract/Free Full Text]
  10. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y. Activation of luteinizing hormone ß gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. J Biol Chem 1999 274:13870-13876[Abstract/Free Full Text]
  11. Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, Tahara M, Hisamoto K, Kurachi H, Murata Y. Activation of the luteinizing hormone ß promoter by gonadotropin-releasing hormone requires c-Jun NH2-terminal protein kinase. J Biol Chem 2000 275:21639-21647[Abstract/Free Full Text]
  12. Harris D, Bonfil D, Chuderland D, Kraus S, Seger R, Naor Z. Activation of MAPK cascades by GnRH: ERK and Jun-N-terminal kinase are involved in basal and GnRH-stimulated activity of the glycoprotein hormone LHß-subunit promoter. Endocrinology 2002 143:1018-1025[Abstract/Free Full Text]
  13. Yonehara T, Kanasaki H, Yamamoto H, Fukunaga K, Miyazaki K, Miyamoto E. Involvement of mitogen-activated protein kinase in cyclic adenosine 3', 5'-monophosphate-induced hormone gene expression in rat pituitary GH3 cells. Endocrinology 2001 142:2811-2819[Abstract/Free Full Text]
  14. Kanasaki H, Fukunaga K, Takahashi K, Miyazaki K, Miyamoto E. Mitogen-activated protein kinase activation by stimulation with thyrotropin-releasing hormone in rat pituitary GH3 cells. Biol Reprod 1999 61:319-325[Abstract/Free Full Text]
  15. Kanasaki H, Fukunaga K, Takahashi K, Miyazaki K, Miyamoto E. Involvement of p38 mitogen-activated protein kinase activation in bromocriptine-induced apoptosis in rat pituitary GH3 cells. Biol Reprod 2000 62:1486-1494[Abstract/Free Full Text]
  16. Okada Y, Murota-Kawano A, Kakar SS, Winters SJ. Evidence that gonadotropin-releasing hormone (GnRH) II stimulates luteinizing hormone and follicle-stimulating hormone secretion from monkey pituitary cultures by activating the GnRH I receptor. Biol Reprod 2003; 69:1356–1361.
  17. Munir I, Fukunaga K, Miyazaki K, Okamura H, Miyamoto E. Mitogen-activated protein kinase activation and regulation of cyclooxygenase 2 expression by platelet-activating factor and hCG in human endometrial adenocarcinoma cell line HEC-1B. J Reprod Fertil 1999 117:49-59[Abstract/Free Full Text]
  18. Uezu A, Fukunaga K, Kasahara J, Miyamoto E. Activation of Ca2+/calmodulin-dependent protein kinase I in cultured rat hippocampal neurons. J Neurochem 2002 82:585-593[CrossRef][Medline]
  19. Gordon DF, Wood WM, Ridgway EC. Organization and nucleotide sequence of the mouse alpha-subunit gene of the pituitary glycoprotein hormones. DNA 1988 7:679-690[Medline]
  20. Lee SL, Sadovsky Y, Swirnoff AH, Polish JA, Goda P, Gavrilina G, Milbrandt J. Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGFI-A (Egr-1). Science 1996 273:1219-1221[Abstract]
  21. Kumar TR, Kelly M, Mortrud M, Low MJ, Matzuk MM. Cloning of the mouse gonadotropin beta-subunit-encoding genes, I. structure of the follicle-stimulating hormone beta-subunit-encoding gene. Gene 1995 166:333-334[CrossRef][Medline]
  22. Tsutsumi M, Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan CA, Dong K, Gillo B, Sealfon SC. Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 1992 6:1163-1169[Abstract/Free Full Text]
  23. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976 72:248-254[CrossRef][Medline]
  24. Kaiser UB, Sabbagh E, Saunders BD, Chin WW. Identification of cis-acting deoxyribonucleic acid elements that mediate gonadotropin-releasing hormone stimulation of the rat luteinizing hormone ß-subunit gene. Endocrinology 1998 139:2443-2451[Abstract/Free Full Text]
  25. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970 227:680-685[CrossRef][Medline]
  26. Graham KE, Nusser KD, Low MJ. LßT2 gonadotroph cells secrete follicle stimulating hormone (FSH) in response to activin A. J Endocrinol 1999 162:R1-R5[Abstract]
  27. Segal RA, Greenberg ME. Intracellular signaling pathways activated by neurotrophic factors. Annu Rev Neurosci 1996 19:463-489[Medline]
  28. Ibrahim SN, Moussa SM, Childs GV. Morphometric studies of rat anterior pituitary cells after gonadectomy: correlation of changes in gonadotropes with the serum levels of gonadotropins. Endocrinology 1986 119:629-637[Abstract/Free Full Text]
  29. Kolch W, Heldecker G, Kochs G, Hummel R, Vahidi H, Mischak H, Finkenzeller G, Marme D, Rapp UR. Protein kinase C alpha activates RAF-1 by direct phosphorylation. Nature 1993 364:249-252[CrossRef][Medline]
  30. Vasilyev VV, Lawson MA, Dipaolo D, Webster NJG, Mellon PL. Different signaling pathways control acute induction versus long-term repression of LHß transcription by GnRH. Endocrinology 2002 143:3414-3426[Abstract/Free Full Text]
  31. Massague J. TGF-ß signal transduction. Annu Rev Biochem 1998 67:753-791[CrossRef][Medline]
  32. Attisano L, Wrana JL. Signal transduction by the TGF-ß superfamily. Science 2002 296:1646-1647[Abstract/Free Full Text]
  33. Hartsough MT, Mulder KM. Transforming growth factor ß activation of p44mapk in proliferating cultures of epithelial cells. J Biol Chem 1995 270:7117-7124[Abstract/Free Full Text]
  34. Dupont J, McNeilly J, Vaiman A, Canepa S, Combarnous Y, Taragnat C. Activin signaling pathways in ovine pituitary and LßT2 gonadotrope cells. Biol Reprod 2003 68:1877-1887[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson
GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems
Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly
Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs
J. Endocrinol., March 1, 2008; 196(3): 497 - 507.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. G. Thackray and P. L. Mellon
Synergistic Induction of Follicle-Stimulating Hormone {beta}-Subunit Gene Expression by Gonadal Steroid Hormone Receptors and Smad Proteins
Endocrinology, March 1, 2008; 149(3): 1091 - 1102.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. Harada, H. Kanasaki, S. Mutiara, A. Oride, and K. Miyazaki
Cyclic Adenosine 3',5'Monophosphate/Protein Kinase A and Mitogen-Activated Protein Kinase 3/1 Pathways Are Involved in Adenylate Cyclase-Activating Polypeptide 1-Induced Common Alpha-Glycoprotein Subunit Gene (Cga) Expression in Mouse Pituitary Gonadotroph LbetaT2 Cells
Biol Reprod, October 1, 2007; 77(4): 707 - 716.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
V. G. Thackray, S. M. McGillivray, and P. L. Mellon
Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating Hormone {beta}-Subunit Gene Expression at the Level of the Gonadotrope
Mol. Endocrinol., September 1, 2006; 20(9): 2062 - 2079.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. de Guise, A. Lacerte, S. Rafiei, R. Reynaud, M. Roy, T. Brue, and J.-J. Lebrun
Activin Inhibits the Human Pit-1 Gene Promoter through the p38 Kinase Pathway in a Smad-Independent Manner
Endocrinology, September 1, 2006; 147(9): 4351 - 4362.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
L. M Bilezikjian, A. L Blount, C. J Donaldson, and W. W Vale
Pituitary actions of ligands of the TGF-{beta} family: activins and inhibins.
Reproduction, August 1, 2006; 132(2): 207 - 215.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Ding, J. Xu, X. Luo, and N. Chegini
Gonadotropin Releasing Hormone and Transforming Growth Factor {beta} Activate Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase and Differentially Regulate Fibronectin, Type I Collagen, and Plasminogen Activator Inhibitor-1 Expression in Leiomyoma and Myometrial Smooth Muscle Cells
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5549 - 5557.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
X. Luo, L. Ding, and N. Chegini
Gonadotropin-releasing hormone and TGF-{beta} activate MAP kinase and differentially regulate fibronectin expression in endometrial epithelial and stromal cells
Am J Physiol Endocrinol Metab, November 1, 2004; 287(5): E991 - E1001.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/1/236    most recent
biolreprod.103.019588v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.
Agricola
Right arrow Articles by Yamada, Y.
Right arrow Articles by Miyazaki, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS