|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary |
Department of Molecular Pharmacology,3 Graduate School of Medical Sciences, Kumamoto University, Kumamoto 860-8556, Japan
Department of Obstetrics and Gynecology,4 Shimane University School of Medicine, Izumo 693-8501, Japan
| ABSTRACT |
|---|
|
|
|---|
- and ß-subunits, and synthesis of the ß-subunit has been reported to be the rate-limiting step in LH production. In this study, we found that activin A increased both the LHß mRNA level and LH content in cells of the gonadotroph cell line, LßT2. We next examined the effects of activin A and GnRH on LHß promoter activity by reporter gene assay and compared the signal transduction pathways. Activin A and GnRH activated the LHß promoter, and the response to a combination of activin A and GnRH was higher than that to activin A or GnRH alone. The effects of activin A and GnRH were specifically inhibited by inhibin-like peptide and antide, a GnRH antagonist, respectively. The activation of the LHß promoter by GnRH was inhibited by PD098059 and U0126, MAP kinase kinase (MEK) inhibitors. In contrast, these protein kinase inhibitors did not inhibit the activin A-induced activation. GnRH, but not activin A, activated MAP kinase in LßT2 cells. Overexpression of constitutively active MEK1 or MEK kinase activated both MAP kinase and the LHß promoter. Furthermore, GnRH, but not activin A, strongly induced SRE-mediated transcription, a known target of the MAP kinase pathway. These results suggest that GnRH activates the LHß promoter via the MAP kinase pathway and that activin A-induced activation of the LHß promoter is independent of the MAP kinase pathway.
activin, anterior pituitary, gonadotropin-releasing hormone, kinases, luteinizing hormone
| INTRODUCTION |
|---|
|
|
|---|
and ß. The
-subunit, called glycoprotein hormone
-subunit (
-GSU), is common to LH and FSH, and the ß-subunit is specific to each hormone. It has been reported that the synthesis of each ß-subunit is the rate-limiting step in LH and FSH production and is regulated by the complex interaction of multiple factors, including activin and GnRH [1, 2]. Activin, a member of the transforming growth factor (TGF)-ß family of growth factors, was originally identified as a factor in ovarian fluid that stimulated the secretion of FSH from pituitary gonadotrophs [2]. Now, activin is known to increase FSHß-subunit synthesis at the transcriptional level [3]. The expression of activin is not limited to the ovary, and it is secreted within the pituitary gland, where it exerts an autocrine/paracrine effect [3]. Experiments with rhesus monkeys [4] and rat primary cultured cells [5] suggested that activin physiologically regulates the production of LH as well as FSH. However, the molecular mechanisms of the regulation of LHß-synthesis by activin have not been examined.
GnRH is a hypothalamic peptide and serves as a critical regulator of the synthesis and secretion of LH and FSH. Several studies on GnRH-induced LH synthesis have been carried out with LßT2 cells [612]. The LßT2 cell line, derived from a pituitary tumor in a transgenic mouse, is a clonal strain of cultured gonadotrophs expressing the genes of the
- and ß-subunits of LH and the GnRH receptor. LßT2 cells secrete LH in response to GnRH, and GnRH-induced LH secretion is dependent on expression of the LHß gene [6]. It was reported that activation of both Gq and Gs proteins was involved in LHß protein synthesis by GnRH in LßT2 cells [7, 8]. It was also reported that GnRH activated the LHß promoter in the cells [912]. However, the involvement of MAP kinase in GnRH-induced LHß promoter activation is controversial. It was previously reported that protein kinase C-independent activation of c-Jun NH2-terminal kinase (JNK) was involved in the GnRH action [11]. Recently, it was reported that MAP kinase contributed about 50% to GnRH-induced LHß promoter activation [12].
In this study, we found that activin A increased the LHß mRNA level and the intracellular LH content in LßT2 cells. Furthermore, we compared the signal transduction pathways of LHß promoter activation by activin A and GnRH.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following chemicals and reagents were obtained from the indicated sources: fetal calf serum (FCS), HyClone (Logan, UT); des-Gly10, [D-Ala6]-LH-RH Ethylamide (GnRH), inhibin-like peptide (3591 Da), and PD098059, Sigma (St. Louis, MO); recombinant human activin A, R&D Systems Inc. (Minneapolis, MN); calphostin C, Calbiochem Novabiochem (La Jolla, CA); U0126, Cell Signaling Technology (Beverly, MA); antide (N-Ac-D-Nal1-D-Cpa2-D-Pal3-Ser4-Lys[Nic]6-Leu7-Ilys8-Pro9-D-Ala10-NH2), a GnRH antagonist, Bachem (King of Prussia, PA); anti-active MAP kinase antibody (rabbit pTEpY), Promega (Madison, WI); anti-MAP kinase antibody, Zymed Laboratories Inc. (San Francisco, CA); anti-GnRH receptor, Lab Vision Co. (Westinghouse, CA); Dulbecco modified Eagle medium (DMEM), Nissui Pharmaceutical Co. (Tokyo, Japan); and serum response element (SRE) firefly luciferase reporter gene (pSRE-Luc), nuclear factor-kappa B (NF-
B) firefly luciferase reporter gene (pNF-
B-Luc), pFC-MEK1, and pFC-MEKK, Stratagene (La Jolla, CA).
Culture of LßT2 Cells
LßT2 cells were kindly provided by Dr. P.L. Mellon (University of California, San Diego, CA). LßT2 cells were cultured in DMEM containing 10% FCS and 50 µg/ml streptomycin and maintained at 37°C in an atmosphere of 95% air-5% CO2 [1315]. Cells from passages 812 were used in this study. Two or three days before experiments, 24 x 105 cells were plated on a 35-mm Petri dish (Nunc, Roskilde, Denmark). When test reagents were added, LßT2 cells were incubated in DMEM without FCS or with 1% FCS at 37°C for the indicated times with or without the test reagents. When we examined the effects of some inhibitors, the cells were preincubated with each inhibitor for 60 min at 37°C as indicated. We chose the concentrations of antide (100 nM), U0126 (10 µM), PD098059 (50 µM), calphostin C (800 nM), and nifedipine (10 µM) on the basis of previous reports [13, 14, 1618]. The cells were incubated with or without GnRH or activin A in the presence or absence of each inhibitor. After incubation for the indicated times, the medium was quickly aspirated, and the cells were washed once with PBS and immediately frozen in liquid N2.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was prepared from LßT2 cells using TRIzol LS Reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer's protocol. Messenger RNA (mRNA) was reverse transcribed into single-stranded cDNA using an oligo (deoxythymidine) primer (Promega Corp., Madison, WI) and Moloney murine leukemia virus reverse transcriptase (GIBCO BRL, Gaithersburg, MD). The reaction mixtures were diluted 20-fold and then subjected to PCR amplification of mouse
-GSU, LHß, FSHß, or GnRH receptor cDNA. The PCR primers were designed based on the published sequences of
-GSU [19], LHß (GenBank D00576)[20], FSHß (GenBank U12932)[21], and GnRH receptor [22]. For amplification of the
-GSU cDNA, we used a sense primer (5'-TTTACGGTTACATCCCTTATA-3') and an antisense primer (5'-TATAAGGGATGTAACCGTAAA-3'). For amplification of the LHß-subunit cDNA, we used a sense primer (5'-GCCGGCCTGTCAACGCAACC-3') and an antisense primer (5'-GAGGGCCACAGGGAAGGAGA-3'). For amplification of the FSHß-subunit cDNA, we used a sense primer (5'-ACCATGATGAAGTTGATCCAG-3') and an antisense primer (5'-TCCTTCATTTCACTGAAGGAG-3'). For amplification of the GnRH receptor cDNA, we used a sense primer (5'-GCTTCCTTCTTGTTGAAGCTG-3') and an antisense primer (5'-GCCTAGGACATAGTAGGGAG-3'). PCR amplification was performed using the Gene Amp PCR system 2400 (Perkin-Elmer Corp., Foster City, CA) for 26, 25, 35, 25, and 18 cycles for
-GSU, LHß, FSHß, GnRH receptor, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), respectively. The PCR products were separated by electrophoresis on a 1.0% agarose gel, visualized by ethidium bromide staining, and quantified by scanning densitometry using NIH image (version 1.61; NIH, Bethesda, MD) [13]. The amount of PCR product was normalized to that of GAPDH in each sample. Before a quantitative RT-PCR analysis was carried out, the linear range of amplification was established by changing the number of PCR cycles and the amount of total RNA for reverse transcription. In pilot experiments, the amplification curves of
-GSU, LHß, FSHß, GnRH receptor, and GAPDH cDNAs were linear from 25 to 27 cycles, 24 to 26 cycles, 32 to 35 cycles, 23 to 26 cycles, and 15 to 19 cycles, respectively. In addition, we confirmed a linear relationship between the relative signal of each PCR product and the amount of total RNA, ranging from 0.45 to 1.2 µg (data not shown).
Measurement of the Intracellular LH Content
To measure the intracellular LH content, cells in 35-mm dishes were scraped with 0.5% Triton X-100 in PBS. After sonication (Sonifier 250, Branson, Danbury, CT), insoluble materials were removed by centrifugation at 15 000 x g for 5 min, and the supernatants were used for measurement of LH content. The amount of LH was determined by a double-antibody RIA using the rat [125I]LH assay system (Amersham Pharmacia Biotech, Little Chalfont, UK). The protein concentration in the supernatants was determined by the method of Bradford [23], with BSA as standard. The amount of LH was normalized to protein content.
Reporter Plasmid Construct and Luciferase Assay
Genomic DNA of rat liver was isolated using PUREGENE Genomic DNA Purification Kit (Minneapolis, MN). PCR was carried out to amplify the fragment containing the LHß promoter based on the published sequences (AF020505) [24]. Using the PCR primers, which consisted of a sense primer containing the Bgl II restriction site (5'-ACGCAGATCTCCATCGCAACCGATCGTG-3') and an antisense primer containing the HindIII restriction site (5'-GGCTAAGCTTGATACCTTCCCTACCTTG-3'), we amplified the LHß promoter region (-797 to +5; the transcriptional start site was numbered as 1). The fragment of the LHß promoter region was excised with BglII and HindIII restriction enzymes and inserted into the BglII and HindIII sites of the pGL3-basic luciferase reporter vector (Promega; termed pGL3-LHßp). Both strands of the LHß promoter region were sequenced with RV primer 3 and GL primer 2 (Promega), using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit and ABI PRISM 310 sequencer (Perkin-Elmer). LßT2 cells were cotransfected with pGL3-LHßp (1.0 µg DNA) and pRL-TK (0.1 µg DNA; Promega), which contains Renilla luciferase under the herpes simplex virus thymidine kinase promoter, using 3 µl of FuGENE 6 transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN) in 2 ml standard medium. In some experiments, the cells were cotransfected with the pFC-MEK1 (2.0 µg DNA), pFC-MEKK (1.0 µg DNA), or pCAGGSneo expression vector (a gift from Prof. Miyazaki, Osaka University, Osaka, Japan; mock-transfected cells) in addition to pGL3-LHßp and pRL-TK. When the activity of the promoter containing SRE or NF-
B was measured, the cells were transfected with pSRE-Luc (1.0 µg DNA) or pNF-kB-Luc (1.0 µg DNA), which has five-tandem repeats of SRE (AGGATGTCCATATTAGGACATCT) or NF-
B (TGGGGACTTTCC-GC), respectively, upstream of the TATA box of the firefly luciferase gene. After incubation of the cells for 36 h, they were treated with chemicals for each experiment. The activities of firefly luciferase and Renilla luciferase were measured by the Dual Luciferase Reporter Assay System (Promega) with a luminometer (TD-20/20, Promega) according to the manufacturer's protocol. The ratio of the luminescence signal of firefly luciferase to that of Renilla luciferase was determined. We noticed that the level of LHß promoter activation varied among the experiments. The reasons for these differences are not clear at present but may be due to differences in cell passage and cell batch. Therefore, representative results were shown instead of mean ± SEM values of all the repeats of the same experiments.
Preparation of Cell Extracts and Immunoblot Analysis
The procedures for preparation of cell extracts were carried out at 4°C. Frozen cells were scraped and solubilized in 150 µl of a homogenization buffer containing 50 mM Hepes (pH 7.4), 0.1% Triton X-100, 4 mM EGTA, 10 mM EDTA, 15 mM Na4P2O7, 100 mM ß-glycerophosphate, 25 mM NaF, 0.1 mM leupeptin, 75 µM pepstatin A, 1 mM dithiothreitol, 1 mM (p-amidinophenyl) methanesulfonyl fluoride hydrochloride, 1 mM Na3VO4, and 100 nM calyculin A [13, 14]. After sonication, the insoluble materials were removed by centrifugation at 15 000 x g for 10 min. The protein concentration was determined by the method of Bradford [23] with BSA as standard. Cell extracts were treated with SDS sample buffer [25] and boiled for 2 min. Samples containing the same amount of proteins were subjected to SDS-PAGE in 10% acrylamide and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated overnight with the anti-active MAP kinase antibody (1:1000). The membrane was washed three times with blocking solution containing 4.5% nonfat dry milk, 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% Tween-20 and then washed more than four times with Tris-buffered saline with Tween-20 (TTBS) containing 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% Tween-20 at room temperature, followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:5000). Immunoreactive proteins were detected using the enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech) as directed by the instructions provided by the manufacturer. For reprobing, the membrane was submerged in stripping buffer (62.5 mM Tris-HCl [pH 6.7], 100 mM 2-mercaptoethanol, and 2% SDS) and incubated at 50°C for 30 min. The membrane was washed with blocking solution and TTBS as described above and was subjected to immunoblot analysis with anti-MAP kinase antibody (1:1000).
Statistical Evaluation
Values were expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA plus Duncan's multiple range test. P < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
It has been reported that FSHß mRNA was increased by the treatment of LßT2 cells with activin A [9, 26]. To investigate whether activin A increased the levels of the mRNAs of LHß and the GnRH receptor, as well as FSHß mRNA, we performed quantitative RT-PCR analysis (Fig. 1, A and B). Treatment of the cells with activin A for 24 h increased LHß mRNA in a dose-dependent manner (Fig. 1A). The increases in FSHß and LHß mRNA levels were detected at a dose of 10 ng/ml. When the cells were treated with 40 ng/ml activin A, the levels of LHß and FSHß mRNAs were significantly increased within 6 h (Fig. 1B). LHß and FSHß mRNA levels were increased to 177.5 ± 12.3% and 791.5 ± 52.4%, respectively, at 6 h. The increase in the GnRH receptor mRNA level by activin A was dose dependent (Fig. 1A). The GnRH receptor mRNA level was increased to 154.5 ± 8.3% at 6 h after treatment with 40 ng/ml activin A and returned to the basal level after 24 h (Fig. 1B). Activin A did not affect the
-GSU mRNA level (data not shown). We next examined the effects of activin A on the intracellular LH content (Fig. 1C). The intracellular LH content was significantly increased to 153.0 ± 4.2% within 24 h. We noticed that the LH content was increased during the culture without activin A. The LH content was increased to 151.0 ± 4.0% and 234.0 ± 15.0% in the absence and presence of activin A, respectively, at 72 h.
|
Activation of the LHß Promoter by Activin A and GnRH
To investigate the effects of activin A and GnRH on the activity of the LHß promoter, we constructed the luciferase reporter gene after the fragment (-797 to +5) of the LHß promoter region (termed pGL3-LHßp). Sequence analysis of the obtained fragment revealed that the nucleotide sequence was over 98% identical to that of the reported sequence [24] (data not shown). When LßT2 cells were transfected with pGL3-LHßp and treated with GnRH and activin A, LHß promoter activity was increased as reported [912] (Fig. 2). LHß promoter activity was increased to 616.4 ± 20.7% and 202.2 ± 5.1% with 10 nM GnRH and 40 ng/ml activin A, respectively. Interestingly, a combination of activin A and GnRH activated the LHß promoter more strongly than GnRH alone, suggesting that activin A activated the LHß promoter by different molecular mechanisms from GnRH (Fig. 2). To confirm that the activation of the LHß promoter by GnRH and activin A was receptor mediated, we examined the effects of antide and inhibin-like peptide. We found that the effect of GnRH was completely inhibited by addition of 100 nM antide, a GnRH antagonist (Fig. 3). Antide alone had no effects on LHß promoter activity, suggesting that the activation of the LHß promoter by GnRH was receptor mediated. Inhibin-like peptide completely inhibited the effect of activin A, whereas no inhibition was observed in the case of the activation by GnRH (Fig. 3). Inhibin-like peptide had a trend toward LHß promoter activation, although the effects were not statistically significant (Fig. 3).
|
|
Effects of Protein Kinase Inhibitors and Nifedipine on LHß Promoter Activation
For the next step, we examined the possible involvements of MAP kinase and protein kinase C in activin A- and GnRH-induced activations of the LHß promoter. It was interesting that the stimulatory effect of GnRH was completely abolished by PD098059 and U0126, specific MEK inhibitors (Fig. 4). These results suggested that the MAP kinase pathway was necessary for the transcriptional effects of GnRH. In contrast, neither PD098059 nor U0126 inhibited the activation by activin A. Calphostin C, a specific protein kinase C inhibitor, strongly inhibited GnRH-induced LHß promoter activation (Fig. 5). Nifedipine, an L-type calcium channel blocker, partially inhibited LHß promoter activation by GnRH (Fig. 5), suggesting that calcium influx through the L-type calcium channel had some role in LHß promoter activation. Interestingly, calphostin C strongly inhibited activin A-induced LHß promoter activation (Fig. 5). These results suggested that protein kinase C was involved in the activin A action. In contrast, nifedipine did not inhibit activin A-induced LHß promoter activation (Fig. 5). Calphostin C or nifedipine alone had no effect on LHß promoter activity (Fig. 5).
|
|
Activation of MAP Kinase by Activin A and GnRH
We next examined whether activin A and GnRH activated MAP kinase in LßT2 cells (Fig. 6). When the anti-MAP kinase antibody was used for immunoblot analysis, we found that both the 44-kDa ERK1 and the 42-kDa ERK2 occurred in LßT2 cells (Fig. 6B). Immunoblot analysis with anti-active MAP kinase antibody showed that 10 nM GnRH strongly activated MAP kinase within 30 min, while 40 ng/ml activin A did not activate MAP kinase (Fig. 6A). The GnRH-induced activation of MAP kinase was completely inhibited by U0126. When the anti-MAP kinase antibody was used for immunoblot analysis, no significant changes in immunoreactivity were observed with any treatment (Fig. 6B). When we examined the time-course of effects of GnRH and activin A, activation of MAP kinase by 10 nM GnRH reached a maximal peak at 30 min and remained elevated for 3 h (data not shown). In contrast, 40 ng/ml activin A did not activate MAP kinase at any time point examined (data not shown). These results further supported our idea that the MAP kinase pathway was involved in the activation of the LHß promoter by GnRH but not by activin A.
|
Effects of Overexpression of MEK1 and MEK Kinase on LHß Promoter Activation
For the next step, we asked whether activation of MAP kinase could imitate the effects of GnRH on LHß promoter activation. For this purpose, we transfected the cells with pFC-MEK1 or pFC-MEKK plasmid vector to overexpress constitutively active MEK1 or MEK kinase (MEKK), respectively. Figure 7 shows that overexpression of MEK1 or MEKK resulted in the activation of the LHß promoter compared with mock-transfected cells. Furthermore, U0126 completely inhibited the activation of the LHß promoter by overexpression of MEK1 and MEKK.
|
Immunoblot analysis with anti-active MAP kinase antibody indicated that overexpression of MEK1 or MEKK activated MAP kinase (data not shown). Addition of U0126 completely abolished the activation of MAP kinase by MEK1 and MEKK overexpression (data not shown). When the anti-MAP kinase antibody was used for immunoblot analysis, no significant changes in immunoreactivity were observed with any treatment (data not shown). From these results, we concluded that activation of MAP kinase is sufficient for activation of the LHß promoter.
Effects of GnRH and Activin A on SRE-Mediated Transcription
We wondered whether the GnRH-induced activation of MAP kinase was strong enough to increase SRE-mediated transcription, a known target of the MAP kinase pathway [27]. GnRH dramatically activated SRE-mediated transcription (Fig. 8A), suggesting that GnRH activated the MAP kinase pathway strongly enough to activate the promoter containing SRE. As the activation of this promoter by GnRH was much stronger than the LHß promoter, we expected that we might detect the activation of the MAP kinase pathway by activin A using this assay system. In contrast, activin A did not activate SRE-mediated transcription or augment the GnRH action (Fig. 8A). These results further supported our idea that activation of the MAP kinase pathway does not occur by activin A treatment.
|
It was surprising that GnRH strongly activated NF-
B-mediated transcription (Fig. 8B). To our knowledge, this is the first report on the stimulative effect of GnRH on transcriptional activity using the NF-
B luciferase reporter gene assay system. However, activin A did not activate NF-
B-mediated transcription (Fig. 8B), suggesting that activin A did not activate the NF-
B pathway. U0126 strongly inhibited the GnRH-induced activation of both SRE- and NF-
B-mediated transcription (data not shown).
| DISCUSSION |
|---|
|
|
|---|
It is well established that activin increases the FSHß-subunit at the transcriptional level [3]. However, regulation of LHß-subunit synthesis by activin is not clear at present. Using LßT2 cells, we obtained clear evidence that activin A increased LH content as well as LHß mRNA and LHß promoter activity. The experiments with inhibin-like peptide clearly showed that the activin A action occurs through the activin receptor. As the GnRH-induced activation of the LHß promoter has been reported, we compared the signal transduction pathways of GnRH and activin A. It is obvious that the GnRH-induced activation of LHß promoter was mediated by MAP kinase for the following reasons: 1) PD098059 and U0126 inhibited the LHß promoter activation by GnRH, 2) GnRH treatment resulted in strong activation of MAP kinase, 3) overexpression of constitutively active MEK1 or MEKK imitated the effects of GnRH on LHß promoter activation, and 4) activation of the MAP kinase pathway by GnRH was strong enough to activate SRE-mediated transcription, a known target of the MAP kinase pathway. Previously, it was reported that PD098059 had no effects on the GnRH-induced activation of the LHß promoter [11]. Recently, it was reported that the MAP kinase pathway contributed about 50% to the GnRH-induced activation [12]. Our results indicated that activation of the MAP kinase pathway was required for GnRH-induced activation. The reasons for the differences among these studies are not clear at present. It was reported that MAP kinase was involved in GnRH-induced LHß protein expression [8]. Therefore, the previous reports [8, 12] and our present data strongly suggest that MAP kinase is involved in GnRH-induced LHß synthesis at the transcriptional level.
It has been reported that activation of MAP kinase by GnRH is mediated via protein kinase C in LßT2 cells [7, 11]. The present observation that calphostin C inhibits the activation of the LHß promoter is in good agreement with these reports. It was reported that protein kinase C activated Raf by direct phosphorylation [29], which acts upstream of MAP kinase. Protein kinase C may also act at steps upstream of Raf to activate MAP kinase, but these targets remain to be defined. As GnRH-induced activation of the LHß promoter was not completely blocked by calphostin C, it was possible that calphostin C-insensitive protein kinase C isoenzymes or signal transduction pathways other than the protein kinase C pathway were also involved in the activation of MAP kinase. Recently, it was reported that the LHß promoter was activated by a 6-h treatment of LßT4 cells with GnRH and that GnRH action was mediated by protein kinase C [30]. However, the involvement of the MAP kinase pathway was not detected under those experimental conditions. Differences between the results in the involvement of the MAP kinase pathway are not clear at present but may be due to the differences between LßT4 and LßT2 cells. In previous work, we have reported that MAP kinase activation is a crucial step for the transcriptional regulation of prolactin and growth hormone by the thyrotropin-releasing hormone/protein kinase C pathway and the pituitary adenylate cyclase-activating polypeptide/cyclic AMP pathway in GH3 cells [13, 14].
Treatment of LßT2 cells with GnRH resulted in the activation of JNK [7, 11], and JNK was also reported to be involved in GnRH-induced LHß promoter activation in LßT2 cells [11]. However, our immunoblot analysis with anti-active JNK antibody could not detect activation of JNK by treatment with either GnRH or activin A (data not shown).
It is well known that the Smad family proteins are critical components of the TGF-ß signaling pathways [31, 32]. Receptor-mediated phosphorylation of Smad 2 or Smad 3 induces their association with Smad 4, followed by translocation into the nucleus, where these complexes activate the transcription of specific genes. However, accumulating data suggest that Smad-independent pathways also exist in the TGF-ß signaling pathways [3133]. For instance, TGF-ß activated MAP kinase in an epithelial cell line [33]. Therefore, we considered the possibility that activin A may activate MAP kinase, followed by activation of the LHß promoter in LßT2 cells. However, activin A treatment did not activate MAP kinase, and no effects of PD098059 and U0126 on the activin A action were observed. Furthermore, SRE-mediated transcription was not activated by activin A treatment. These results suggest that the MAP kinase pathway is not involved in transcriptional regulation by activin A. Very recently, it was reported that activin activated MAP kinase in LßT2 cells [34]. The reasons for the difference from our results are not clear at present. It was interesting that calphostin C strongly inhibited activin A-induced LHß promoter activation, suggesting that protein kinase C was involved in the activin A action.
The activation of the LHß promoter by a combination of activin A and GnRH was higher than that by activin A or GnRH alone. As the level of mRNA of the GnRH receptor was increased by activin A treatment, we examined whether activin A increased the GnRH receptor at the protein level under our assay conditions by immunoblot analysis. The treatment of the cells with 40 ng/ml activin A plus 10 nM GnRH did not increase the amount of GnRH receptor protein until 12 h (data not shown). As the cells were treated with activin A for 8 h in a reporter gene assay, it is unlikely that activin A augments the GnRH action through an increase in the GnRH receptor level.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Hideyuki Yamamoto, Department of Molecular Pharmacology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556, Japan. FAX: 81 96 373 5078; hideyuki{at}gpo.kumamoto-u.ac.jp ![]()
Received: 20 May 2003.
First decision: 4 June 2003.
Accepted: 9 September 2003.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs J. Endocrinol., March 1, 2008; 196(3): 497 - 507. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. Thackray and P. L. Mellon Synergistic Induction of Follicle-Stimulating Hormone {beta}-Subunit Gene Expression by Gonadal Steroid Hormone Receptors and Smad Proteins Endocrinology, March 1, 2008; 149(3): 1091 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Harada, H. Kanasaki, S. Mutiara, A. Oride, and K. Miyazaki Cyclic Adenosine 3',5'Monophosphate/Protein Kinase A and Mitogen-Activated Protein Kinase 3/1 Pathways Are Involved in Adenylate Cyclase-Activating Polypeptide 1-Induced Common Alpha-Glycoprotein Subunit Gene (Cga) Expression in Mouse Pituitary Gonadotroph LbetaT2 Cells Biol Reprod, October 1, 2007; 77(4): 707 - 716. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. Thackray, S. M. McGillivray, and P. L. Mellon Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating Hormone {beta}-Subunit Gene Expression at the Level of the Gonadotrope Mol. Endocrinol., September 1, 2006; 20(9): 2062 - 2079. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. de Guise, A. Lacerte, S. Rafiei, R. Reynaud, M. Roy, T. Brue, and J.-J. Lebrun Activin Inhibits the Human Pit-1 Gene Promoter through the p38 Kinase Pathway in a Smad-Independent Manner Endocrinology, September 1, 2006; 147(9): 4351 - 4362. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M Bilezikjian, A. L Blount, C. J Donaldson, and W. W Vale Pituitary actions of ligands of the TGF-{beta} family: activins and inhibins. Reproduction, August 1, 2006; 132(2): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ding, J. Xu, X. Luo, and N. Chegini Gonadotropin Releasing Hormone and Transforming Growth Factor {beta} Activate Mitogen-Activated Protein Kinase/Extracellularly Regulated Kinase and Differentially Regulate Fibronectin, Type I Collagen, and Plasminogen Activator Inhibitor-1 Expression in Leiomyoma and Myometrial Smooth Muscle Cells J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5549 - 5557. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Luo, L. Ding, and N. Chegini Gonadotropin-releasing hormone and TGF-{beta} activate MAP kinase and differentially regulate fibronectin expression in endometrial epithelial and stromal cells Am J Physiol Endocrinol Metab, November 1, 2004; 287(5): E991 - E1001. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |