Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print October 15, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.021733
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/2/364    most recent
biolreprod.103.021733v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.
Agricola
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.
BIOLOGY OF REPRODUCTION 70, 364–370 (2004)
DOI: 10.1095/biolreprod.103.021733
© 2004 by the Society for the Study of Reproduction, Inc.


Pituitary

Pituitary Follistatin Gene Expression in Female Rats: Evidence That Inhibin Regulates Transcription1

Kathleen A. Prendergast2, Laura L. Burger, Kevin W. Aylor, Daniel J. Haisenleder, Alan C. Dalkin, and John C. Marshall

Division of Endocrinology, Department of Internal Medicine, and the Center for Research in Reproduction, University of Virginia, Charlottesville, Virginia 22908


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Follistatin (FS), along with the members of the transforming growth factor ß family activin and inhibin, are important regulators of FSH secretion and messenger RNA production. While activin and inhibin appear to function as tonic modulators of FSH (stimulatory and inhibitory, respectively), dynamic changes in FS are noted through the estrous cycle and under varying physiological experimental paradigms. This suggests that FS is a major contributor to the precisely coordinated secretion of FSH that maintains reproductive function. The aim of this study was to investigate changes in FS, in particular the early (<12 h) rise observed after ovariectomy (OVX), and to determine whether these changes were as a consequence of variations in gene transcription rates. FS primary transcript (PT) and mRNA were found to increase 3-fold 12 h post-OVX, indicating increased gene transcription during this time period. Replacement with estradiol and/or blockade of GnRH had only modest effects on FS PT concentration. Inhibin immunoneutralization of intact rats resulted in a 3-fold increase in FS PT 12 h after administration of inhibin {alpha} antisera. Significant increases in FS mRNA at both 2 and 12 h also suggested that inhibin also may have effects on message stability. After administration of recombinant human inhibin A, there was a prompt decline in both FS PT and mRNA. These results indicate that inhibin is a major regulator of FS, both by transcriptional and nontranscriptional mechanisms.

follicle-stimulating hormone, follistatin, gene regulation, gonadotropin-releasing hormone, inhibin


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The interaction between activin, inhibin, and follistatin (FS) in the regulation of FSH secretion is complex and incompletely understood. Activin and inhibin, two structurally related members of the transforming growth factor ß superfamily [1], have divergent effects on FSHß expression [2]. FS, a monomeric glycoprotein secreted by gonadotrophs and folliculostellate cells [3], is known to bind and neutralize activin, reducing activin stimulation of FSHß production and secretion [4]. Inhibin exerts similar actions to FS on FSHß [2], albeit by different mechanisms, the precise details of which remain to be delineated. In addition to regulating FSH secretion, inhibin, activin, and FS have been demonstrated to regulate their own production and secretion [5, 6]. The present study aimed to investigate regulation of FS gene expression in an effort to clarify the complex interaction of these proteins in regulating FSHß.

In female rats, dynamic changes are seen in FS mRNA expression through the estrous cycle [7, 8], after ovariectomy (OVX) [9, 10], and after administration of GnRH [1114] or gonadal peptides[5, 6, 15, 16]. Within 24 h post-OVX, FS mRNA expression transiently increases 3-fold, and returns toward intact levels by 3 days [10]. The increase in FS mRNA may reflect increased GnRH secretion post-OVX, or the loss of ovarian estradiol (E2) or inhibin. Our laboratory has previously shown that a GnRH antagonist (LRF-147) partially prevented the increase in FS mRNA within 24 h post-OVX [17], suggesting another factor must also play a role in the increase in FS mRNA post-OVX. Treatment with supraphysiological doses of E2 increases FS mRNA levels [10], so it appears unlikely that loss of E2 would account for the acute increase after OVX. Administration of inhibin {alpha} antisera in vivo has been shown to increase FS mRNA expression 3-fold [16] and treatment of anterior pituitary cell culture with inhibin A reduces FS mRNA by 76% within 24 h [6]. Winters et al. observed a small but significant decline in FS promoter activation after treatment of {alpha}T3 cells with inhibin [18]. In sum, these data support the loss of inhibin as the major factor in the early post-OVX increase in FS mRNA.

These prior studies assessed mRNA content and it is unknown whether the actions of inhibin, GnRH, or E2 are on FS gene transcription or at a posttranscriptional level. In efforts to determine the mechanism of action on FS expression, we developed a primary transcript assay for FS in a similar manner to that described for gonadotropin subunit genes [17]. FS primary transcripts (PT) were then quantitated by real-time reverse-transcription polymerase chain reaction (RT-PCR) assay post-OVX and after blockade of GnRH or inhibin action or administration of E2 or inhibin.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Adult (225–250 g) female Sprague Dawley rats (Harlan Sprague Dawley, Inc., Indianapolis, IN) were used for all experiments. Rats were housed in a light- (lights on 0500–1700 h) and temperature- (25°C) controlled room and allowed access to food and water ad libitum. All surgeries were performed under 2.5% isoflurane anesthesia (Abbott Laboratories, North Chicago, IL). At the completion of experiments, rats were killed by decapitation. Trunk blood was collected for the determination of serum LH and FSH. Pituitaries were collected and snap frozen in liquid nitrogen and stored at -70°C until RNA was extracted [19]. The animal experimentation described within this report was approved by the University of Virginia Animal Research Committee.

Experiment 1: Assessment of FS PT, mRNA, and ßB mRNA Concentrations after OVX

Groups of intact female and OVX rats were killed 12, 24, 48, and 72 h and 7 days after ovariectomies. Serum LH, FS, and activin/inhibin ßB (hereafter referred to as ßB) mRNA, and FS PT concentrations were determined.

Experiment 2: To Define the Relative Contributions of E2 and GnRH in the Post-OVX Increase in FS PT and mRNA

Adult female rats underwent OVX and were divided into the following groups: OVX only, OVX + E2, OVX + LRF-147, OVX + LRF-147 + E2. For LRF-147, rats were pretreated with 200 µg s.c. (in 0.5 ml 0.9% saline, 0.1% BSA) 12 h prior to OVX. Animals received an additional 200-µg dose at the time of OVX. To replace E2 in OVX rats, estradiol implants (1 per rat), each containing 40 µg estradiol and constructed from 26-mm lengths of silicone tubing (1.6 mm i.d., 3.2 mm o.d.; Dow Corning, Midland, MI) filled with a 20-mm column of E2 (1 mg/ml, Sigma, St. Louis, MO) dissolved in sesame oil (Sigma) and closed with 3 mm silastic adhesive (Dow Corning), were used. Rats were killed 12 h after OVX in all groups. Serum LH and E2, FS and ßB mRNA, and FS PT concentrations were determined.

Experiment 3: To Assess the Regulation of FS PT and mRNA by Inhibin

To determine if the loss of circulating inhibin after OVX alters FS PT concentrations (previously reported for gonadotroph subunit transcription and secretion [19]), intact female rats were treated for 2 or 12 h with either anti-inhibin {alpha} subunit sera (kindly provided by Dr. W. Vale, Salk Institute, La Jolla, CA) or normal sheep sera (NSS, Jackson Immuno Research, West Grove, PA). Rats were fitted with indwelling jugular cannulae. The next day, rats received a single i.v. injection of either 0.5 ml inhibin antiserum or NSS and were killed 2 or 12 h later. Serum LH, FSH, FS and ßB mRNA, and FS PT concentrations were determined.

Experiment 4: To Determine the Effect of Inhibin Administration on FS PT and mRNA

Previously, we examined the effects of inhibin on gonadotroph subunit transcription [19] and these samples were used to assess the affect of inhibin on FS PT and mRNA. In brief, female rats were ovariectomized and the GnRH antagonist LRF-147 was given after surgery and again 11 h later. At 12 h post-OVX, a single dose of recombinant human (rh) inhibin A (10 µg/0.5 ml 0.9% saline, i.v., kindly provided by Dr. De Kretser, Monash Medical Center, Melbourne, Australia in cooperation with Biotech Australia Pty. Ltd.) was given and rats were killed 0, 15, 30, 60, 120, and 240 min later. Intact controls were also included in this experiment. Serum LH, FSH, FS and ßB mRNA, and FS PT concentrations were measured.

Measurements of mRNAs and FS PT

FS mRNA and ßB mRNA were measured as previously described [14, 16]. To quantify FS PT, a real-time, RT-PCR assay was developed. Amplification was performed utilizing the QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA). The oligonucleotide primers were designed to span the intron-exon boundary to ensure that the product was primary transcript. The primers used for this assay were sequences found in intron 2 (upstream, 5'TCCATCTCGGTTGCATGATTG3') and exon 3 (downstream, 5'TGCGGTAGGTTTTCCCATCG). A thousand to twelve hundred nanograms of total pituitary RNA were used per reaction. Reactions were performed using an iCycler IQ (Bio-Rad, Hercules, CA), and continuous SYBR Green I monitoring was done according to the manufacturer's recommendations. Assay conditions were optimized to produce a single peak in the melt curve at the desired temperature for the generated amplicon. To confirm the fidelity of real-time PCR beyond analysis of the melt curves, quality control included gel electrophoresis of PCR products after 45 cycles with comparison to DNA controls. The intra- and interassay coefficients of variation were 15% and 19%, respectively.

Generation of a Standard Curve

The desired DNA amplicon was generated by PCR from rat genomic DNA and subcloned into the plasmid pGEMT-Easy (Promega Corp., Madison, WI). After linearization with NcoI, the orientation of the construct was determined by sequence analysis and subsequently a sense-strand RNA run-off was performed using SP-6 RNA polymerase. The subsequent RNA run-off product was then quantitated using optical density before serial dilution to generate a standard curve, which was then used to quantitate unknown samples (Fig. 1).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. A) Amplification chart of 1:8 dilution series of FS PT sense strand RNA using real-time PCR technology. The threshold is chosen during the logarithmic phase of amplification, and the cycle number to attain this threshold is determined (threshold cycle). Larger quantities of RNA amplify at an earlier cycle number. B) A standard curve is generated by plotting the known starting quantity of in vitro transcribed RNA (standard) against the threshold cycle. Results of an unknown sample of RNA (triplicate measures) are shown

Statistics

Statistical analysis was performed using one-way ANOVA. Differences between groups were analyzed using Duncan multiple range test.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Experiment 1: Assessment of FS PT, mRNA, and ßB mRNA Concentrations after OVX

FS PT concentration increased 3-fold within 12 h, followed by a decline to 2-fold over basal levels through 72 h (Fig. 2). FS mRNA showed similar changes over the first 72 h post-OVX. After the initial acute rise in FS mRNA and PT, both declined, returning to near-intact levels in the case of FS PT at 7 days. The ßB mRNA rose modestly, though significantly within 12 h, and remained at or slightly above intact levels through 72 h, before increasing further at 7 days. Serum LH followed the anticipated pattern post-OVX (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Time course of changes in pituitary FS PT, FS mRNA, and ßB after ovariectomy. n = 5/group. Intact animals served as controls. Different letters indicate statistical significance (P < 0.05)

Experiment 2: To Define the Relative Contributions of Estradiol (E2) and GnRH in the Post-OVX Increase in FS Primary Transcript and mRNA

The effects of E2 replacement in the presence or absence of GnRH antagonist in 12-h post-OVX female rats are shown in Figure 3. Serum E2 levels in these rats (mean: 17.7 pg/ml; range: 7.3–26.1), was similar to levels in intact rats (mean: 14.7 pg/ml; range: 5–18.5). The increase in FS PT 12 h post-OVX was not impaired in the presence of E2 but was decreased slightly, although not significantly, by GnRH antagonist. E2 replacement resulted in a further increase in FS mRNA, but only in the absence of GnRH blockade. The observed changes in ßB again were modest and were unaffected by E2 administration. GnRH blockade did partially prevent the post-OVX rise. Serum LH and FSH levels increased slightly after OVX, and this increase was blocked by LRF-147 (Table 1). E2 replacement had little effect on serum LH, and levels were not statistically different from either intact or 12-h OVX.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. The effects of E2 administration in the presence or absence of GnRH in 12-h OVX rats. n = 4–5/group. Animals were ovariectomized and received replacement of E2, GnRH blockade with LRF-147, or both. Intact animals and untreated 12-h OVX animals served as controls. Different letters indicated statistical significance (P < 0.05)


View this table:
[in this window]
[in a new window]
 
TABLE 1. LH and FSH levels after OVX + replacement of E2 or administration of GnRH antagonist, LRF-147

Experiment 3: To Assess the Regulation of FS PT and mRNA by Inhibin

The effects of treatment with inhibin {alpha} antisera are presented in Figure 4. FS PT levels were unchanged at 2 h, but by 12 h had increased 4-fold over intact levels. Of interest, FS mRNA was elevated 3-fold after 2 h and remained increased at 12 h after treatment with anti-inhibin antisera. The ßB mRNA increased slightly (25%) 2 and 12 h after inhibin {alpha} antisera, though a similar increase was seen at 12 h in NSS-treated rats. Serum LH was unchanged by the administration of the antisera. Serum FSH increased significantly at 12 h after treatment [19].



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. The effects of inhibin immunoneutralization on FS PT, FS mRNA, and ßB. n = 4–7/group. Inhibin {alpha} antisera (+) or normal sheep sera (-) was administered i.v. to intact female rats, and pituitaries were collected 2 and 12 h later. Intact animals served as controls. Different letters indicate statistical significance (P < 0.05)

Experiment 4: To Determine the Effect of Inhibin Administration on FS PT and mRNA

Treatment with rh inhibin A 12 h post-OVX resulted in a rapid decline in FS PT within 15 min and in FS mRNA within 60 min, as shown in Figure 5. FS PT remained slightly above intact values. We observed a modest increase in FS PT at 240 min after treatment, possibly reflecting a waning effect of inhibin A. FS mRNA values fell more slowly than FS PT but declined steadily to intact levels by 240 min. No change was seen in ßB mRNA concentrations (data not shown). Serum LH and FSH were unchanged after the administration of inhibin [19].



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. The effects of rh inhibin administration on FS PT and mRNA. OVX rats were treated with GnRH antagonist rats and 12 h post-OVX received an i.v. injection of 10 µg rh inhibin. Pituitaries were collected at intervals over 4 h (n = 5–8/group). Intact animals served as controls and basal values were 1.3 ± 0.28 fg/100 µg RNA and 142.3 ± 38.3 fg/100 ng RNA for FS PT and mRNA, respectively. Different letters indicate statistical significance (P < 0.05)


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The coordination of FSH production and secretion through the reproductive cycle is known to arise from complex endocrine, autocrine, and paracrine effects of GnRH, gonadal steroids, pituitary activin, inhibin, and FS. Activin and inhibin appear to tonically regulate FSH (positively and negatively, respectively) and vary modestly during the estrous cycle [8, 20, 21]. FS, in contrast, exhibits significant changes throughout the cycle [7, 8], and it has been postulated that the proestrous decline in pituitary FS likely contributes to the secondary FSH surge.

The variations in FS mRNA seen through the estrous cycle likely reflect changes in GnRH, gonadal steroids, and gonadal peptides. Fast frequency GnRH in both males and females causes an increase in FS mRNA [11, 13, 14]. An increase in FS mRNA was observed after the administration of E2[10], whereas testosterone is known to reduce FS gene expression [14, 22]. In vitro, activin [6, 15], PACAP[18], and GnRH [23] treatment increases FS mRNA expression, whereas inhibin and FS itself are inhibitory [6].

Thus, FS production is potentially under the influence of many local and systemic factors, and it is important to identify the signal(s) dictating physiologic control. While prior studies have examined changes in FS mRNA expression and, to a limited degree, protein levels, we aimed to investigate FS gene transcription by developing an assay to measure FS PT in vivo using the OVX rat as a model. Within 12 h post-OVX, FS PT increased 3-fold, a change that was mirrored by FS mRNA, suggesting that FS gene expression at least partly, if not predominantly, reflects altered FS transcription. We therefore pursued identification of hormonal regulators that are involved in this early increase in FS gene transcription and expression post-OVX.

Given the intimate association between activin and FS, we measured ßB mRNA in our experimental paradigms to investigate if changes in activin contributed to the observed changes in FS PT and mRNA. Exposure to activin A can increase FS mRNA concentration in vitro [6], and thus could explain the increase in FS PT and mRNA. In agreement with our prior data, ßB mRNA expression increased slightly post-OVX, and this was partially prevented by GnRH blockade. E2 had no effect on ßB mRNA levels 12 h post-OVX in the presence or absence of GnRH blockade. Administration of inhibin {alpha} antisera did cause an early rise in ßB mRNA; however, at 12 h treatment with inhibin antisera, it did not produce ßB levels that differed from NSS treatment, suggesting a nonspecific effect. Overall, as the changes in ßB mRNA are slight and variable, these data do not support the hypothesis that dynamic changes in activin dictate patterned response in FS. While protein production and hormone secretion may differ from mRNA concentration, the changes in ßB gene expression are modest and differ from the greater magnitude of response in FS gene expression. Further study of local activin action will be possible with the development of sensitive activin assays, but the small and inconsistent change in ßB mRNA identified herein suggests that other factors regulate the increase in FS PT.

To investigate the relative contributions of E2 and GnRH on the early post-OVX rise in FS PT and mRNA, we administered E2 replacement ± GnRH blockade to 12-h OVX rats. E2 is known to affect hypothalamic priming and has been shown to increase FS mRNA [12]. The action of E2 was blocked by pentobarbital and it was theorized that the increase observed in FS gene expression was due to increased GnRH pulsatility. In our experiment, we found that E2 replacement had no effect on FS gene transcription. Interestingly, in the presence of endogenous GnRH, FS mRNA was increased by E2 replacement, consistent with prior reports [10, 12]. Conversely, our studies reveal that blockade of GnRH action prevents the increase in FS mRNA expression. These findings suggest that estradiol most likely acts to modify the GnRH secretory pattern, though a direct effect at the level of the pituitary to alter the response to GnRH by the gonadotrope cell cannot be excluded. Further studies are ongoing in our laboratory to clarify the mechanism whereby estradiol alters FS gene expression.

Previous studies in {alpha}T3 cells [18] demonstrated no stimulation of GnRH on FS gene transcription. However, in the study described here, GnRH blockade modestly reduced FS PT but not FS mRNA post-OVX. The mechanism(s) underlying the dissociation of FS PT and mRNA responses are unclear, but suggest that GnRH is, at least in part, responsible for the increase post-OVX in FS transcription. Whether longer term treatment with GnRH antagonist would result in parallel changes in mRNA and PT remains to be studied, but changes in transcription rate may require a number of hours before attenuation in mRNA levels are observed.

As neither E2 replacement nor GnRH blockade completely abolished the increase in FS PT and mRNA at 12 h post-OVX, we investigated the role of inhibin on FS gene expression. Physiologically, the interaction between inhibin and FS is confirmed in observations of the rat estrous cycle. Inhibin A and B levels reach nadir levels [20] at times when FS mRNA expression is at its peak [7]. Immunoneutralization of circulating inhibin caused a 3-fold increase in FS PT and mRNA concentrations within 12 h. Interestingly, FS mRNA but not PT was increased 2 h after anti-inhibin {alpha} sera, which suggests that inhibin has actions at both the level of transcription and mRNA stability and that the effects on FS message stability are more rapid.

Treatment with rh inhibin A rapidly reduced FS PT and mRNA levels. These in vivo results are consistent with earlier in vitro data [5, 6], where FS mRNA fell within 2 h of addition of inhibin A to pituitary cell cultures. Notably, both PT and mRNA concentrations were nearly unchanged for the immediate 30 min after rh inhibin treatment, though a slight decline in FS PT was observed. Thereafter, both PT and mRNA decreased significantly. The apparent difference in pattern of FS mRNA and PT expression after inhibin immunoneutralization versus inhibin treatment could reflect differences in the hormonal milieu between the two experiments. By administering inhibin antisera, we were presumably able to remove the physiologic inhibin effect. In contrast, the dose of rh inhibin A administered was chosen to provide maximum effect and may not entirely reproduce normal physiology. In addition, these experiments were performed in intact and OVX rats, respectively, and other ovarian factors may contribute to differing results between studies of endogenous and exogenous inhibin. The ability to perform further studies to investigate dose-response on FS gene transcription and expression will depend on availability of rh inhibin A.

The studies described here demonstrate that inhibin is a major regulator of FS. Divergent changes between mRNA and PT suggest that, while inhibin alters FS message stability, inhibin also has a clear effect on FS transcription. The mechanism(s) by which inhibin regulates FS gene transcription are unknown. Inhibin could interfere with activin stimulation of FS gene transcription; however, activin stimulation of FS gene transcription in vitro has been reported in some [24], but not all [18, 25], studies. Inhibin could block activin action by interacting with the ActRII receptors through its ß subunit [26, 27]. In addition, betaglycan has been shown to facilitate inhibin's binding to the ActRII receptor and prevent its association with type 1 receptor ALK4 [28], thereby preventing intracellular signaling. Alternatively, inhibin may bind to inhibin-binding protein/p120 that may function as a specific inhibin receptor independent of the activin receptor subunits [29]. Indeed, inhibin has been demonstrated to decrease FS promoter activation in the absence of activin or activin receptor in {alpha}T3 cells [18], suggesting the existence of an inhibin-specific pathway. Clarification of these potential pathways awaits development of an activin-deficient pituitary cell model in which to study inhibin responsiveness.

In conclusion, the current data suggest that the biphasic pattern of FS mRNA expression post-OVX is a reflection of changes in FS transcription. In investigating the early rise in FS after ovariectomy, we found only modest effects of GnRH blockade and E2 on FS transcription and mRNA expression. This suggested that another factor was responsible for the early increase in FS post-OVX rats. Studies in which inhibin was immunoneutralized or administered demonstrated marked changes on FS mRNA and PT, and we have concluded from these studies that inhibin is a major regulator of FS transcription and expression.


    ACKNOWLEDGMENTS
 
The authors wish to thank the University of Virginia, Center for Research in Reproduction Ligand Preparation and Assay Core, for conducting the RIAs. We would also like to thank Dr. R.G. Mirmira for his asistance in the development of the real-time RT-PCR assay.


    FOOTNOTES
 
1 This work was supported by NIH grants HD 11489 and HD 33039 (J.C.M.), by postdoctoral fellowship F32 HD DK42895 (K.A.P.), and by the Core Laboratories of Specialized Collaborative Centers Program for Research in Reproduction Center grant U54 HD 28934. Back

2 Correspondence: Kathleen A. Prendergast, University of Virginia, Department of Medicine, P.O. Box 800612, Charlottesville, VA 22908. FAX: 434 243 6913; kap2k{at}virginia.edu Back

Received: 14 August 2003.

First decision: 10 September 2003.

Accepted: 8 October 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Massague J. The TGF-beta family of growth and differentiation factors. Cell 1987 49:437-438[CrossRef][Medline]
  2. Carroll RS, Corrigan AZ, Gharib SD, Vale W, Chin WW. Inhibin, activin, and follistatin: regulation of follicle-stimulating hormone messenger ribonucleic acid levels. Mol Endocrinol 1989 3:1969-1976[Abstract/Free Full Text]
  3. Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs GV. Follistatin gene expression in the pituitary: localization in gonadotropes and folliculostellate cells in diestrous rats. Endocrinology 1992 130:3048-3056[Abstract/Free Full Text]
  4. Shimonaka M, Inouye S, Shimasaki S, Ling N. Follistatin binds to both activin and inhibin through the common subunit. Endocrinology 1991 128:3313-3315[Abstract/Free Full Text]
  5. Bilezikjian LM, Corrigan AZ, Vaughan JM, Vale WM. Activin-A regulates follistatin secretion from cultured rat anterior pituitary cells. Endocrinology 1993 133:2554-2560[Abstract/Free Full Text]
  6. Bilezikjian LM, Corrigan AZ, Blount AL, Vale WW. Pituitary follistatin and inhibin subunit messenger ribonucleic acid levels are differentially regulated by local and hormonal factors. Endocrinology 1996 137:4277-4284[Abstract]
  7. Besecke LM, Guendner MJ, Sluss PA, Polak AG, Woodruff TK, Jameson JL, Bauer-Dantoin AC, Weiss J. Pituitary follistatin regulates activin-mediated production of follicle-stimulating hormone during the rat estrous cycle. Endocrinology 1997 138:2841-2848[Abstract/Free Full Text]
  8. Halvorson LM, Weiss J, Bauer-Dantoin AC, Jameson JL. Dynamic regulation of pituitary follistatin messenger ribonucleic acids during the rat estrous cycle. Endocrinology 1994 134:1247-1253[Abstract/Free Full Text]
  9. DePaolo LV, Mercado M, Guo Y, Ling N. Increased follistatin (activin-binding protein) gene expression in rat anterior pituitary tissue after ovariectomy may be mediated by pituitary activin. Endocrinology 1993 132:2221-2228[Abstract/Free Full Text]
  10. Kaiser UB, Chin WW. Regulation of follistatin messenger ribonucleic acid levels in the rat pituitary. J Clin Invest 1993 91:2523-2531
  11. Besecke LM, Guendner MJ, Schneyer AL, Bauer-Dantoin AC, Jameson JL, Weiss J. Gonadotropin-releasing hormone regulates follicle-stimulating hormone-beta gene expression through an activin/follistatin autocrine or paracrine loop. Endocrinology 1996 137:3667-3673[Abstract]
  12. Bauer-Dantoin AC, Weiss J, Jameson JL. Gonadotropin-releasing hormone regulation of pituitary follistatin gene expression during the primary follicle-stimulating hormone surge. Endocrinology 1996 137:1634-1639[Abstract]
  13. Dalkin AC, Haisenleder DJ, Gilrain JT, Aylor K, Yasin M, Marshall JC. Gonadotropin-releasing hormone regulation of gonadotropin subunit gene expression in female rats: actions on follicle-stimulating hormone beta messenger ribonucleic acid (mRNA) involve differential expression of pituitary activin (beta-B) and follistatin mRNAs. Endocrinology 1999 140:903-908[Abstract/Free Full Text]
  14. Kirk SE, Dalkin AC, Yasin M, Haisenleder DJ, Marshall JC. Gonadotropin-releasing hormone pulse frequency regulates expression of pituitary follistatin messenger ribonucleic acid: a mechanism for differential gonadotrope function. Endocrinology 1994 135:876-880[Abstract]
  15. Dalkin AC, Haisenleder DJ, Yasin M, Gilrain JT, Marshall JC. Pituitary activin receptor subtypes and follistatin gene expression in female rats: differential regulation by activin and follistatin. Endocrinology 1996 137:548-554[Abstract]
  16. Dalkin AC, Haisenleder DJ, Gilrain JT, Aylor K, Yasin M, Marshall JC. Regulation of pituitary follistatin and inhibin/activin subunit messenger ribonucleic acids (mRNAs) in male and female rats: evidence for inhibin regulation of follistatin mRNA in females. Endocrinology 1998 139:2818-2823[Abstract/Free Full Text]
  17. Dalkin AC, Burger LL, Aylor KW, Haisenleder DJ, Workman LJ, Cho S, Marshall JC. Regulation of gonadotropin subunit gene transcription by gonadotropin-releasing hormone: measurement of primary transcript ribonucleic acids by quantitative reverse transcription-polymerase chain reaction assays. Endocrinology 2001 142:139-146[Abstract/Free Full Text]
  18. Winters SJ, Dalkin AC, Tsujii T. Evidence that pituitary adenylate cyclase activating polypeptide suppresses follicle-stimulating hormone-beta messenger ribonucleic acid levels by stimulating follistatin gene transcription. Endocrinology 1997 138:4324-4329[Abstract/Free Full Text]
  19. Burger LL, Dalkin AC, Aylor KW, Workman LJ, Haisenleder DJ, Marshall JC. Regulation of gonadotropin subunit transcription after ovariectomy in the rat: measurement of subunit primary transcripts reveals differential roles of GnRH and inhibin. Endocrinology 2001 142:3435-3442[Abstract/Free Full Text]
  20. Woodruff TK, Besecke LM, Groome N, Draper LB, Schwartz NB, Weiss J. Inhibin A and inhibin B are inversely correlated to follicle-stimulating hormone, yet are discordant during the follicular phase of the rat estrous cycle, and inhibin A is expressed in a sexually dimorphic manner. Endocrinology 1996 137:5463-5467[Abstract]
  21. Haisenleder DJ, Ortolano GA, Jolly D, Dalkin AC, Landefeld TD, Vale WW, Marshall JC. Inhibin secretion during the rat estrous cycle: relationships to FSH secretion and FSH beta subunit mRNA concentrations. Life Sci 1990 47:1769-1773[CrossRef][Medline]
  22. Leal AM, Blount AL, Donaldson CJ, Bilezikjian LM, Vale WW. Regulation of follicle-stimulating hormone secretion by the interactions of activin-A, dexamethasone and testosterone in anterior pituitary cell cultures of male rats. Neuroendocrinology 2003 77:298-304[CrossRef][Medline]
  23. Fujii Y, Okada Y, Moore JP Jr, Dalkin AC, Winters SJ. Evidence that PACAP and GnRH down-regulate follicle-stimulating hormone-beta mRNA levels by stimulating follistatin gene expression: effects on folliculostellate cells, gonadotrophs and LbetaT2 gonadotroph cells. Mol Cell Endocrinol 2002 192:55-64[CrossRef][Medline]
  24. Bilezikjian LM, Corrigan AZ, Blount AL, Chen Y, Vale WW. Regulation and actions of Smad7 in the modulation of activin, inhibin, and transforming growth factor-beta signaling in anterior pituitary cells. Endocrinology 2001 142:1065-1072[Abstract/Free Full Text]
  25. Bilezikjian LM, Leal AM, Blount AL, Corrigan AZ, Turnbull AV, Vale WW. Rat anterior pituitary folliculostellate cells are targets of interleukin-1beta and a major source of intrapituitary follistatin. Endocrinology 2003 144:732-740[Abstract/Free Full Text]
  26. Lebrun JJ, Vale WW. Activin and inhibin have antagonistic effects on ligand-dependent heteromerization of the type I and type II activin receptors and human erythroid differentiation. Mol Cell Biol 1997 17:1682-1691[Abstract]
  27. Martens JW, de Winter JP, Timmerman MA, McLuskey A, van Schaik RH, Themmen AP, de Jong FH. Inhibin interferes with activin signaling at the level of the activin receptor complex in Chinese hamster ovary cells. Endocrinology 1997 138:2928-2936[Abstract/Free Full Text]
  28. Gray PC, Bilezikjian LM, Vale W. Antagonism of activin by inhibin and inhibin receptors: a functional role for betaglycan. [republished from Mol Cell Endocrinol 180(1–2):47–53; PMID: 11451571] (review; 88 refs) Mol Cell Endocrinol 2002 188:254-260[Medline]
  29. Bernard DJ, Chapman SC, Woodruff TK. Inhibin binding protein (InhBP/p120), betaglycan, and the continuing search for the inhibin receptor (review; 41 refs). Mol Endocrinol 2002 16:207-212[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
W. Zheng, M. Jimenez-Linan, B. S. Rubin, and L. M. Halvorson
Anterior Pituitary Gene Expression with Reproductive Aging in the Female Rat
Biol Reprod, June 1, 2007; 76(6): 1091 - 1102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Iype, J. Francis, J. C. Garmey, J. C. Schisler, R. Nesher, G. C. Weir, T. C. Becker, C. B. Newgard, S. C. Griffen, and R. G. Mirmira
Mechanism of insulin Gene Regulation by the Pancreatic Transcription Factor Pdx-1: APPLICATION OF PRE-mRNA ANALYSIS AND CHROMATIN IMMUNOPRECIPITATION TO ASSESS FORMATION OF FUNCTIONAL TRANSCRIPTIONAL COMPLEXES
J. Biol. Chem., April 29, 2005; 280(17): 16798 - 16807.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. C. Wu, P. Su, N. W. Safwat, J. Sebastian, and W. L. Miller
Rapid, Efficient Isolation of Murine Gonadotropes and Their Use in Revealing Control of Follicle-Stimulating Hormone by Paracrine Pituitary Factors
Endocrinology, December 1, 2004; 145(12): 5832 - 5839.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/2/364    most recent
biolreprod.103.021733v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.
Agricola
Right arrow Articles by Prendergast, K. A.
Right arrow Articles by Marshall, J. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS