|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pituitary |
Division of Endocrinology, Department of Internal Medicine, and the Center for Research in Reproduction, University of Virginia, Charlottesville, Virginia 22908
| ABSTRACT |
|---|
|
|
|---|
antisera. Significant increases in FS mRNA at both 2 and 12 h also suggested that inhibin also may have effects on message stability. After administration of recombinant human inhibin A, there was a prompt decline in both FS PT and mRNA. These results indicate that inhibin is a major regulator of FS, both by transcriptional and nontranscriptional mechanisms.
follicle-stimulating hormone, follistatin, gene regulation, gonadotropin-releasing hormone, inhibin
| INTRODUCTION |
|---|
|
|
|---|
In female rats, dynamic changes are seen in FS mRNA expression through the estrous cycle [7, 8], after ovariectomy (OVX) [9, 10], and after administration of GnRH [1114] or gonadal peptides[5, 6, 15, 16]. Within 24 h post-OVX, FS mRNA expression transiently increases 3-fold, and returns toward intact levels by 3 days [10]. The increase in FS mRNA may reflect increased GnRH secretion post-OVX, or the loss of ovarian estradiol (E2) or inhibin. Our laboratory has previously shown that a GnRH antagonist (LRF-147) partially prevented the increase in FS mRNA within 24 h post-OVX [17], suggesting another factor must also play a role in the increase in FS mRNA post-OVX. Treatment with supraphysiological doses of E2 increases FS mRNA levels [10], so it appears unlikely that loss of E2 would account for the acute increase after OVX. Administration of inhibin
antisera in vivo has been shown to increase FS mRNA expression 3-fold [16] and treatment of anterior pituitary cell culture with inhibin A reduces FS mRNA by 76% within 24 h [6]. Winters et al. observed a small but significant decline in FS promoter activation after treatment of
T3 cells with inhibin [18]. In sum, these data support the loss of inhibin as the major factor in the early post-OVX increase in FS mRNA.
These prior studies assessed mRNA content and it is unknown whether the actions of inhibin, GnRH, or E2 are on FS gene transcription or at a posttranscriptional level. In efforts to determine the mechanism of action on FS expression, we developed a primary transcript assay for FS in a similar manner to that described for gonadotropin subunit genes [17]. FS primary transcripts (PT) were then quantitated by real-time reverse-transcription polymerase chain reaction (RT-PCR) assay post-OVX and after blockade of GnRH or inhibin action or administration of E2 or inhibin.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Adult (225250 g) female Sprague Dawley rats (Harlan Sprague Dawley, Inc., Indianapolis, IN) were used for all experiments. Rats were housed in a light- (lights on 05001700 h) and temperature- (25°C) controlled room and allowed access to food and water ad libitum. All surgeries were performed under 2.5% isoflurane anesthesia (Abbott Laboratories, North Chicago, IL). At the completion of experiments, rats were killed by decapitation. Trunk blood was collected for the determination of serum LH and FSH. Pituitaries were collected and snap frozen in liquid nitrogen and stored at -70°C until RNA was extracted [19]. The animal experimentation described within this report was approved by the University of Virginia Animal Research Committee.
Experiment 1: Assessment of FS PT, mRNA, and ßB mRNA Concentrations after OVX
Groups of intact female and OVX rats were killed 12, 24, 48, and 72 h and 7 days after ovariectomies. Serum LH, FS, and activin/inhibin ßB (hereafter referred to as ßB) mRNA, and FS PT concentrations were determined.
Experiment 2: To Define the Relative Contributions of E2 and GnRH in the Post-OVX Increase in FS PT and mRNA
Adult female rats underwent OVX and were divided into the following groups: OVX only, OVX + E2, OVX + LRF-147, OVX + LRF-147 + E2. For LRF-147, rats were pretreated with 200 µg s.c. (in 0.5 ml 0.9% saline, 0.1% BSA) 12 h prior to OVX. Animals received an additional 200-µg dose at the time of OVX. To replace E2 in OVX rats, estradiol implants (1 per rat), each containing 40 µg estradiol and constructed from 26-mm lengths of silicone tubing (1.6 mm i.d., 3.2 mm o.d.; Dow Corning, Midland, MI) filled with a 20-mm column of E2 (1 mg/ml, Sigma, St. Louis, MO) dissolved in sesame oil (Sigma) and closed with 3 mm silastic adhesive (Dow Corning), were used. Rats were killed 12 h after OVX in all groups. Serum LH and E2, FS and ßB mRNA, and FS PT concentrations were determined.
Experiment 3: To Assess the Regulation of FS PT and mRNA by Inhibin
To determine if the loss of circulating inhibin after OVX alters FS PT concentrations (previously reported for gonadotroph subunit transcription and secretion [19]), intact female rats were treated for 2 or 12 h with either anti-inhibin
subunit sera (kindly provided by Dr. W. Vale, Salk Institute, La Jolla, CA) or normal sheep sera (NSS, Jackson Immuno Research, West Grove, PA). Rats were fitted with indwelling jugular cannulae. The next day, rats received a single i.v. injection of either 0.5 ml inhibin antiserum or NSS and were killed 2 or 12 h later. Serum LH, FSH, FS and ßB mRNA, and FS PT concentrations were determined.
Experiment 4: To Determine the Effect of Inhibin Administration on FS PT and mRNA
Previously, we examined the effects of inhibin on gonadotroph subunit transcription [19] and these samples were used to assess the affect of inhibin on FS PT and mRNA. In brief, female rats were ovariectomized and the GnRH antagonist LRF-147 was given after surgery and again 11 h later. At 12 h post-OVX, a single dose of recombinant human (rh) inhibin A (10 µg/0.5 ml 0.9% saline, i.v., kindly provided by Dr. De Kretser, Monash Medical Center, Melbourne, Australia in cooperation with Biotech Australia Pty. Ltd.) was given and rats were killed 0, 15, 30, 60, 120, and 240 min later. Intact controls were also included in this experiment. Serum LH, FSH, FS and ßB mRNA, and FS PT concentrations were measured.
Measurements of mRNAs and FS PT
FS mRNA and ßB mRNA were measured as previously described [14, 16]. To quantify FS PT, a real-time, RT-PCR assay was developed. Amplification was performed utilizing the QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA). The oligonucleotide primers were designed to span the intron-exon boundary to ensure that the product was primary transcript. The primers used for this assay were sequences found in intron 2 (upstream, 5'TCCATCTCGGTTGCATGATTG3') and exon 3 (downstream, 5'TGCGGTAGGTTTTCCCATCG). A thousand to twelve hundred nanograms of total pituitary RNA were used per reaction. Reactions were performed using an iCycler IQ (Bio-Rad, Hercules, CA), and continuous SYBR Green I monitoring was done according to the manufacturer's recommendations. Assay conditions were optimized to produce a single peak in the melt curve at the desired temperature for the generated amplicon. To confirm the fidelity of real-time PCR beyond analysis of the melt curves, quality control included gel electrophoresis of PCR products after 45 cycles with comparison to DNA controls. The intra- and interassay coefficients of variation were 15% and 19%, respectively.
Generation of a Standard Curve
The desired DNA amplicon was generated by PCR from rat genomic DNA and subcloned into the plasmid pGEMT-Easy (Promega Corp., Madison, WI). After linearization with NcoI, the orientation of the construct was determined by sequence analysis and subsequently a sense-strand RNA run-off was performed using SP-6 RNA polymerase. The subsequent RNA run-off product was then quantitated using optical density before serial dilution to generate a standard curve, which was then used to quantitate unknown samples (Fig. 1).
|
Statistics
Statistical analysis was performed using one-way ANOVA. Differences between groups were analyzed using Duncan multiple range test.
| RESULTS |
|---|
|
|
|---|
FS PT concentration increased 3-fold within 12 h, followed by a decline to 2-fold over basal levels through 72 h (Fig. 2). FS mRNA showed similar changes over the first 72 h post-OVX. After the initial acute rise in FS mRNA and PT, both declined, returning to near-intact levels in the case of FS PT at 7 days. The ßB mRNA rose modestly, though significantly within 12 h, and remained at or slightly above intact levels through 72 h, before increasing further at 7 days. Serum LH followed the anticipated pattern post-OVX (data not shown).
|
Experiment 2: To Define the Relative Contributions of Estradiol (E2) and GnRH in the Post-OVX Increase in FS Primary Transcript and mRNA
The effects of E2 replacement in the presence or absence of GnRH antagonist in 12-h post-OVX female rats are shown in Figure 3. Serum E2 levels in these rats (mean: 17.7 pg/ml; range: 7.326.1), was similar to levels in intact rats (mean: 14.7 pg/ml; range: 518.5). The increase in FS PT 12 h post-OVX was not impaired in the presence of E2 but was decreased slightly, although not significantly, by GnRH antagonist. E2 replacement resulted in a further increase in FS mRNA, but only in the absence of GnRH blockade. The observed changes in ßB again were modest and were unaffected by E2 administration. GnRH blockade did partially prevent the post-OVX rise. Serum LH and FSH levels increased slightly after OVX, and this increase was blocked by LRF-147 (Table 1). E2 replacement had little effect on serum LH, and levels were not statistically different from either intact or 12-h OVX.
|
|
Experiment 3: To Assess the Regulation of FS PT and mRNA by Inhibin
The effects of treatment with inhibin
antisera are presented in Figure 4. FS PT levels were unchanged at 2 h, but by 12 h had increased 4-fold over intact levels. Of interest, FS mRNA was elevated 3-fold after 2 h and remained increased at 12 h after treatment with anti-inhibin antisera. The ßB mRNA increased slightly (25%) 2 and 12 h after inhibin
antisera, though a similar increase was seen at 12 h in NSS-treated rats. Serum LH was unchanged by the administration of the antisera. Serum FSH increased significantly at 12 h after treatment [19].
|
Experiment 4: To Determine the Effect of Inhibin Administration on FS PT and mRNA
Treatment with rh inhibin A 12 h post-OVX resulted in a rapid decline in FS PT within 15 min and in FS mRNA within 60 min, as shown in Figure 5. FS PT remained slightly above intact values. We observed a modest increase in FS PT at 240 min after treatment, possibly reflecting a waning effect of inhibin A. FS mRNA values fell more slowly than FS PT but declined steadily to intact levels by 240 min. No change was seen in ßB mRNA concentrations (data not shown). Serum LH and FSH were unchanged after the administration of inhibin [19].
|
| DISCUSSION |
|---|
|
|
|---|
The variations in FS mRNA seen through the estrous cycle likely reflect changes in GnRH, gonadal steroids, and gonadal peptides. Fast frequency GnRH in both males and females causes an increase in FS mRNA [11, 13, 14]. An increase in FS mRNA was observed after the administration of E2[10], whereas testosterone is known to reduce FS gene expression [14, 22]. In vitro, activin [6, 15], PACAP[18], and GnRH [23] treatment increases FS mRNA expression, whereas inhibin and FS itself are inhibitory [6].
Thus, FS production is potentially under the influence of many local and systemic factors, and it is important to identify the signal(s) dictating physiologic control. While prior studies have examined changes in FS mRNA expression and, to a limited degree, protein levels, we aimed to investigate FS gene transcription by developing an assay to measure FS PT in vivo using the OVX rat as a model. Within 12 h post-OVX, FS PT increased 3-fold, a change that was mirrored by FS mRNA, suggesting that FS gene expression at least partly, if not predominantly, reflects altered FS transcription. We therefore pursued identification of hormonal regulators that are involved in this early increase in FS gene transcription and expression post-OVX.
Given the intimate association between activin and FS, we measured ßB mRNA in our experimental paradigms to investigate if changes in activin contributed to the observed changes in FS PT and mRNA. Exposure to activin A can increase FS mRNA concentration in vitro [6], and thus could explain the increase in FS PT and mRNA. In agreement with our prior data, ßB mRNA expression increased slightly post-OVX, and this was partially prevented by GnRH blockade. E2 had no effect on ßB mRNA levels 12 h post-OVX in the presence or absence of GnRH blockade. Administration of inhibin
antisera did cause an early rise in ßB mRNA; however, at 12 h treatment with inhibin antisera, it did not produce ßB levels that differed from NSS treatment, suggesting a nonspecific effect. Overall, as the changes in ßB mRNA are slight and variable, these data do not support the hypothesis that dynamic changes in activin dictate patterned response in FS. While protein production and hormone secretion may differ from mRNA concentration, the changes in ßB gene expression are modest and differ from the greater magnitude of response in FS gene expression. Further study of local activin action will be possible with the development of sensitive activin assays, but the small and inconsistent change in ßB mRNA identified herein suggests that other factors regulate the increase in FS PT.
To investigate the relative contributions of E2 and GnRH on the early post-OVX rise in FS PT and mRNA, we administered E2 replacement ± GnRH blockade to 12-h OVX rats. E2 is known to affect hypothalamic priming and has been shown to increase FS mRNA [12]. The action of E2 was blocked by pentobarbital and it was theorized that the increase observed in FS gene expression was due to increased GnRH pulsatility. In our experiment, we found that E2 replacement had no effect on FS gene transcription. Interestingly, in the presence of endogenous GnRH, FS mRNA was increased by E2 replacement, consistent with prior reports [10, 12]. Conversely, our studies reveal that blockade of GnRH action prevents the increase in FS mRNA expression. These findings suggest that estradiol most likely acts to modify the GnRH secretory pattern, though a direct effect at the level of the pituitary to alter the response to GnRH by the gonadotrope cell cannot be excluded. Further studies are ongoing in our laboratory to clarify the mechanism whereby estradiol alters FS gene expression.
Previous studies in
T3 cells [18] demonstrated no stimulation of GnRH on FS gene transcription. However, in the study described here, GnRH blockade modestly reduced FS PT but not FS mRNA post-OVX. The mechanism(s) underlying the dissociation of FS PT and mRNA responses are unclear, but suggest that GnRH is, at least in part, responsible for the increase post-OVX in FS transcription. Whether longer term treatment with GnRH antagonist would result in parallel changes in mRNA and PT remains to be studied, but changes in transcription rate may require a number of hours before attenuation in mRNA levels are observed.
As neither E2 replacement nor GnRH blockade completely abolished the increase in FS PT and mRNA at 12 h post-OVX, we investigated the role of inhibin on FS gene expression. Physiologically, the interaction between inhibin and FS is confirmed in observations of the rat estrous cycle. Inhibin A and B levels reach nadir levels [20] at times when FS mRNA expression is at its peak [7]. Immunoneutralization of circulating inhibin caused a 3-fold increase in FS PT and mRNA concentrations within 12 h. Interestingly, FS mRNA but not PT was increased 2 h after anti-inhibin
sera, which suggests that inhibin has actions at both the level of transcription and mRNA stability and that the effects on FS message stability are more rapid.
Treatment with rh inhibin A rapidly reduced FS PT and mRNA levels. These in vivo results are consistent with earlier in vitro data [5, 6], where FS mRNA fell within 2 h of addition of inhibin A to pituitary cell cultures. Notably, both PT and mRNA concentrations were nearly unchanged for the immediate 30 min after rh inhibin treatment, though a slight decline in FS PT was observed. Thereafter, both PT and mRNA decreased significantly. The apparent difference in pattern of FS mRNA and PT expression after inhibin immunoneutralization versus inhibin treatment could reflect differences in the hormonal milieu between the two experiments. By administering inhibin antisera, we were presumably able to remove the physiologic inhibin effect. In contrast, the dose of rh inhibin A administered was chosen to provide maximum effect and may not entirely reproduce normal physiology. In addition, these experiments were performed in intact and OVX rats, respectively, and other ovarian factors may contribute to differing results between studies of endogenous and exogenous inhibin. The ability to perform further studies to investigate dose-response on FS gene transcription and expression will depend on availability of rh inhibin A.
The studies described here demonstrate that inhibin is a major regulator of FS. Divergent changes between mRNA and PT suggest that, while inhibin alters FS message stability, inhibin also has a clear effect on FS transcription. The mechanism(s) by which inhibin regulates FS gene transcription are unknown. Inhibin could interfere with activin stimulation of FS gene transcription; however, activin stimulation of FS gene transcription in vitro has been reported in some [24], but not all [18, 25], studies. Inhibin could block activin action by interacting with the ActRII receptors through its ß subunit [26, 27]. In addition, betaglycan has been shown to facilitate inhibin's binding to the ActRII receptor and prevent its association with type 1 receptor ALK4 [28], thereby preventing intracellular signaling. Alternatively, inhibin may bind to inhibin-binding protein/p120 that may function as a specific inhibin receptor independent of the activin receptor subunits [29]. Indeed, inhibin has been demonstrated to decrease FS promoter activation in the absence of activin or activin receptor in
T3 cells [18], suggesting the existence of an inhibin-specific pathway. Clarification of these potential pathways awaits development of an activin-deficient pituitary cell model in which to study inhibin responsiveness.
In conclusion, the current data suggest that the biphasic pattern of FS mRNA expression post-OVX is a reflection of changes in FS transcription. In investigating the early rise in FS after ovariectomy, we found only modest effects of GnRH blockade and E2 on FS transcription and mRNA expression. This suggested that another factor was responsible for the early increase in FS post-OVX rats. Studies in which inhibin was immunoneutralized or administered demonstrated marked changes on FS mRNA and PT, and we have concluded from these studies that inhibin is a major regulator of FS transcription and expression.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Kathleen A. Prendergast, University of Virginia, Department of Medicine, P.O. Box 800612, Charlottesville, VA 22908. FAX: 434 243 6913; kap2k{at}virginia.edu ![]()
Received: 14 August 2003.
First decision: 10 September 2003.
Accepted: 8 October 2003.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Zheng, M. Jimenez-Linan, B. S. Rubin, and L. M. Halvorson Anterior Pituitary Gene Expression with Reproductive Aging in the Female Rat Biol Reprod, June 1, 2007; 76(6): 1091 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iype, J. Francis, J. C. Garmey, J. C. Schisler, R. Nesher, G. C. Weir, T. C. Becker, C. B. Newgard, S. C. Griffen, and R. G. Mirmira Mechanism of insulin Gene Regulation by the Pancreatic Transcription Factor Pdx-1: APPLICATION OF PRE-mRNA ANALYSIS AND CHROMATIN IMMUNOPRECIPITATION TO ASSESS FORMATION OF FUNCTIONAL TRANSCRIPTIONAL COMPLEXES J. Biol. Chem., April 29, 2005; 280(17): 16798 - 16807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Wu, P. Su, N. W. Safwat, J. Sebastian, and W. L. Miller Rapid, Efficient Isolation of Murine Gonadotropes and Their Use in Revealing Control of Follicle-Stimulating Hormone by Paracrine Pituitary Factors Endocrinology, December 1, 2004; 145(12): 5832 - 5839. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |