Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 20, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.021709
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/2/523    most recent
biolreprod.103.021709v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.
Agricola
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.
BIOLOGY OF REPRODUCTION 70, 523–533 (2004)
DOI: 10.1095/biolreprod.103.021709
© 2004 by the Society for the Study of Reproduction, Inc.

Ovary

Gene Expression Profiling of Differentially Expressed Genes in Granulosa Cells of Bovine Dominant Follicles Using Suppression Subtractive Hybridization1

Tania Fayad, Valérie Lévesque, Jean Sirois, David W. Silversides, and Jacques G. Lussier2

Centre de recherche en reproduction animale, Faculté de médecine vétérinaire, Université de Montréal, St-Hyacinthe, Québec, J2S 7C6, Canada


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Development of antral follicles beyond 3 to 4 mm in cattle appears as a wave pattern that occurs two to three times during the estrous cycle. Each wave presents a cyclic recruitment of multiple follicles at the 3- to 4-mm stage, followed by the selection of a single follicle that becomes the dominant follicle (DF). The molecular determinants involved in the follicular dominance process remain poorly understood. The objective of the current study was to compare gene expression in granulosa cells (GCs) between growing dominant follicles from Day 5 of the estrous cycle and nonselected small follicles (<=4 mm) using the suppression subtractive hybridization (SSH) approach to identify candidate genes differentially expressed in GCs of the DF. Small follicle cDNAs were subtracted from DF cDNAs (DF-SF) and used to establish a DF GC-subtracted cDNA library. A total of 42 nonredundant cDNAs were identified. Detection of previously identified genes such as CX43, CYP19, INHBA, and SERPINE2 supported the validity of our experimental model and the use of SSH as the method of analysis. For selected genes such as ApoER2, CPD, CSPG2, 14-3-3 epsilon, NR5A2/SF2, RGN/SMP30, and SERPINE2, gene expression profiles were compared by virtual Northern blot or reverse transcriptase-polymerase chain reaction, and results confirmed an increase or induction of their mRNA in GCs of dominant follicles compared with that of small follicles. We conclude that we have identified novel genes (known and unknown) that are up-regulated in bovine GCs that may affect follicular growth, dominance, or both.

follicle, gene regulation, granulosa cells, ovary


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In cattle, formation of the follicular antrum begins at a diameter of 0.2 mm, and follicles from 0.2 to 2 mm in size constitute a large pool of mostly healthy, growing follicles [1, 2]. As these follicles continue to develop throughout the antral phase, most of them degenerate through atresia [3]. In cattle, a critical physiological stage is reached at a follicle diameter of 3 to 4 mm, when most follicles are lost by atresia if circulating FSH concentrations are not adequate [2, 4]. Ovarian stimulation with FSH overcomes this physiological blockade [5]. Two or three waves of 7 to 11 follicles at the 3- to 4-mm stage are recruited during the bovine estrous cycle. This cyclic recruitment process is preceded by an increase in circulating FSH concentrations [6, 7]. A selection phase follows, in which a single follicle continues its development and becomes the dominant follicle (DF), whereas subordinate follicles degenerate by atresia. Circulating FSH concentrations remain low during this functional dominance phase. The mechanisms allowing a DF to be selected and potentially ovulate in conditions in which other follicles degenerate are not fully understood [6, 8, 9]. Molecular determinants known to intervene in follicular growth and dominance involve the acquisition of gonadotropin receptors [10, 11] and steroidogenic capacity, which is reflected by the increase in gene expression in granulosa cells (GCs) for HSD3B2 and CYP19 [10, 12]. Also, growth factors belonging to the inhibin family and members of the insulin growth factor (IGF) system are known to modulate the action of gonadotropins on follicles. The expression of these factors were shown to be modulated at the mRNA level, the protein level (or both) in relation to the development of the DF [6, 8, 9].

The overall objective of the present research is to identify genes that control sequential development and differentiation during the final stage of antral follicular development. The working hypothesis is that the development of a DF results from the expression of genes that are cell-specific and temporally regulated. Gene expression was studied in GCs because they represent an important compartment of the ovarian follicle involved in hormone synthesis and maturation of the oocyte [13]. The specific objective of this study was to identify genes that are differentially expressed in GCs of growing dominant follicles and to compare them with nonselected, <=4 mm follicles, because our knowledge of the genes that regulate final follicular growth is incomplete. Gene expression analysis was performed by the use of the suppression subtractive hybridization (SSH; [14]) approach, permitting the enrichment of differentially expressed genes followed by the establishment and analysis of a subtracted cDNA library from dominant follicles. The identification and characterization of gene expression patterns occurring during final follicular growth will contribute to a better understanding of the molecular determinants that affect follicular selection and dominance.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Experimental Animal Model, Tissue Collection, and RNA Isolation

Holstein heifers and nonlactating primiparous cows that exhibited normal estrous cycles were maintained on hay ration. They were synchronized with one injection of PGF2{alpha} (25 mg, i.m.; Lutalyse, Upjohn, Kalamazoo, MI) given in presence of a corpus luteum (CL). Behavioral estrus was monitored at 12-h intervals, from 48 h to 96 h following PGF2{alpha} injection. From the time of PGF2{alpha} injection until ovariectomy, ovarian follicular development was monitored once daily by transrectal ultrasonography performed with a real-time linear scanning ultrasound diagnostic system (LS-300; Tokyo Keiki, Tokyo, Japan) equipped with a 7.5-MHz transducer [2]. At each examination, the diameter of the CL and individual follicles >=4 mm were measured at their largest cross sectional area using internal calipers provided with the ultrasound unit. Following estrus synchronization by PGF2{alpha}, heifers were randomly assigned to one of two treatment groups: 1) the DF group, or 2) the preovulatory hCG-induced follicle group (OVU). In the DF group, the ovary bearing the DF on the morning of Day 5 of the estrous cycle (Day 0 = day of estrus) was obtained by ovariectomy (via colpotomy). The DF was defined as being >8 mm and growing, while subordinate follicles were either static or regressing [5]. During the synchronized estrous cycle, the OVU follicles were obtained following an injection of 25 mg of PGF2{alpha} (Lutalyse) at 2200 h on Day 7 to induce luteolysis, thereby maintaining the development of the DF of the first follicular wave into a preovulatory follicle [15]. An ovulatory dose of hCG (3000 IU, i.v.; APL; Ayerst, Montréal, QC) was injected 36 h after the induction of luteolysis, and the ovary bearing the hCG-induced preovulatory follicle was collected by ovariectomy 22 to 23 h after hCG injection. Immediately following ovariectomy, ovaries were rinsed with ice-cold physiological saline and transferred into ice-cold HEPES-buffered Dulbecco modified eagle medium (Life Technologies, Burlington, ON). Follicular fluid and GCs with oocytes were collected separately from individual dominant follicles or OVUs as described previously [16]. In the small follicle (SF) group, GC/oocytes and follicular fluid were collected from 2- to 4-mm follicles following their measurement at the surface of the ovary with calipers. Ovaries from Holstein cows were collected at the slaughterhouse and represented a total of three pools of 20 small follicles. GCs collected from small follicles (n = 20) were pooled to generate a sufficient amount of total RNA to perform an SSH experiment. These experiments were approved by the Animal Ethics Committee of the Faculty of Veterinary Medicine at the Université de Montréal.

Concentrations of progesterone (P4), estradiol-17ß (E2), and their ratio (P4:E2) were analyzed by RIA of follicular fluid as previously described [16]. The E2:P4 ratios were calculated for each sample: 1) 0.008, 0.06, and 0.01 for the SF pools; 2) 17.3, 19.7, 14.3, and 63.4 for individual dominant follicles at Day 5 (n = 4); and 3) 0.44, 0.87, 0.64, and 0.27 (n = 4) for individual OVU follicles. Corpora lutea at Day 5 of the estrous cycle were obtained by ovariectomy from cows following ultrasound monitoring of follicular development and estrus synchronization as described above. The CL were dissected from the ovarian stroma, frozen in liquid nitrogen, and stored at -80°C until RNA extraction. Total RNA was isolated from GC/oocytes or CL as previously described [16]. The concentration of total RNA was quantified by measurement of optical density at 260 nm, and quality was evaluated by visualizing the 28S and 18S ribosomal bands following electrophoretic separation on a 0.66 M formaldehyde denaturing 1% agarose gel with ethidium bromide [17].

Suppression Subtractive Hybridization

Suppression subtractive hybridization [14] was used to compare gene expression in GC/oocytes collected from DF versus SF groups. Identical amounts of total RNA (2 µg) from four dominant follicles or three pools of small follicles (n = 20) were pooled within treatment groups to decrease interanimal variation. To generate sufficient amounts of double-stranded cDNA for an SSH experiment, both DF and SF cDNAs were amplified using the SMART polymerase chain reaction (PCR) cDNA synthesis kit (user manual PT30411; BD Biosciences Clontech, Mississauga, ON; [18, 19]). One microgram of total RNA from each pooled group was reverse-transcribed with an oligo-dT30 primer (CDS: 5'-AAGCAGTGGTAACAACGCAGAGTACT(30)(A/C/G/T) (A/G/C)-3') and PowerScript (BD Biosciences Clontech) to generate the first-strand cDNA. Second-cDNA strands were produced with the SMART II 5'-anchored oligo (AAGCAGTGGTAACAACGCAGAGTACGCGGG), and PCR-amplified for 15 cycles using Advantage 2 DNA polymerase (BD Biosciences Clontech).

The DF cDNAs were subtracted against SF cDNAs (forward reaction: DF-SF) using PCR-Select cDNA subtraction technology (user manual PT11171; BD Biosciences Clontech). In a parallel experiment, the SF cDNAs were subtracted against the DF cDNAs (reverse reaction: SF-DF). Briefly, PCR-generated DF and SF cDNAs were digested with RsaI to generate blunt-ended cDNA fragments (from 0.2 to 2 kb) that are suitable for adaptor ligation and optimal for subtractive hybridization [14]. The DF cDNAs were subdivided into two pools and ligated to different adaptors (adaptor 1, CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT; or adaptor 2R, CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT). For the first hybridization, the pools of adaptor ligated-DF (tester) and SF (driver) cDNAs were incubated for 8 h at 68°C. This first hybridization normalizes and enriches for differentially expressed genes. For the second hybridization, excess competitor SF cDNAs were added directly to the pooled mix of the previous two hybridizations and incubated at 68°C for 18 h, generating DF cDNAs harboring different 5' or 3' adaptors (1 and 2R). Differentially expressed cDNAs with different adaptor ends in the DF group were amplified by 27 primary PCR cycles, and subsequently enriched by 12 secondary nested PCR cycles (PCR-nested 1, TCGAGCGGCCGCCCGGGCAGGT; and PCR-nested 2R, AGCGTGGTCGCGGCCGAGGT).

The efficiency of subtraction was analyzed by comparing the abundance of cDNAs before and after subtraction by PCR using bovine gene-specific primers for the constitutively expressed gene glyceraldehyde 3-phosphate dehydrogenase (GAPD; sense, TGTTCCAGTATGATTCCACCCACG; antisense, CTGTTGAAGTCGCAGGAGACAACC; [20]), and cytochrome P450 aromatase (P450arom or CYP19), a gene known to be up-regulated in dominant follicles (sense, GTCCGAAGTTGTGCCTATTGCCAGC; antisense, CCTCCAGCCTGTCCAGATGCTTGG; [21]). PCR amplification was performed using Advantage 2 DNA polymerase (BD Biosciences Clontech), and 5-µl aliquots were removed following determined numbers of PCR cycles. The amplified products were resolved on a 2% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, 0.5 µg/ml ethidium bromide). The difference in the number of cycles needed to generate approximately an equal amount of the corresponding PCR product in subtracted and unsubtracted samples served to indicate the subtraction efficiency.

We used the SSH technique because it has several important characteristics compared with other methods that aids in the isolation of differentially expressed genes. The PCR amplification of the cDNA pools that precedes the hybridization step allows the SSH procedure to be performed with limited quantities of mRNA [18]. It enriches for genes expressed in one sample relative to another, making it more likely that transcripts that differ greatly (greater than 5-fold) in representation will be isolated, rather than those with more moderate differences in expression. It overcomes the problem of differences in mRNA abundance by incorporating a hybridization step that normalizes for sequence abundance during the course of subtraction, thereby increasing the representation of rare transcripts [14]. It allows identification of both known and unknown genes. Because the isolated cDNA fragments often localize in open reading frame sequences, which are more conserved between species, proper gene identification via sequence data bank searches is rendered more likely. Finally, the cDNA fragments generated by SSH can be used as probes to screen cDNA libraries to generate the corresponding full-length cDNAs and to identify novel cDNAs [22].

Cloning of Subtracted Complementary DNAs

The subtracted cDNAs were cloned into the pT-Adv plasmid (BD Biosciences Clontech) to construct the DF-SF subtracted library as described previously [22]. Ligated DNA was used to transform competent TOP10F' E. coli, which were plated onto S-Gal/LB agar (Sigma-Aldrich, Oakville, ON) containing kanamycine (40 µg/ml). Individual colonies (n = 837) were transferred into 96-well plates, grown in LB freezing media (8.8% glycerol, 55 mM K2HPO4, 1 mM MgSO4, 26 mM KH2PO4, 15 mM NH4(SO4)) for 14 h at 37°C and frozen at -70°C.

Differential Hybridization Screening

The subtracted DF-SF cDNA library was used to establish macroarrays for differential screening. The insert of each cDNA clone was amplified in 96-well plates via 28 cycles of PCR using the PCR-nested primers 1 and 2R, and AmpliTaq DNA polymerase (Roche Molecular Systems, Laval, QC). To establish the cDNA macroarrays, an aliquot of each amplification product was denatured in 0.3 M NaOH with 5% bromophenol blue, and 10 µl were vacuum-transferred with a 96-well dot-blot apparatus onto nylon membrane (Hybond-N+; Amersham Pharmacia Biotech, Pointe-Claire, QC) and cross-linked with UV light (150 mJ, Gs Gene Linker; Bio-Rad, Mississauga, ON). Control cDNAs (GAPD, P450arom) were PCR-amplified from their full-length, cloned cDNA plasmids using the oligos described above. The cDNA fragments were purified on a 2% agarose 1x TAE gel, and extracted (QIAquick Gel Extraction Kit; Qiagen, Mississauga, ON) before being transferred onto macroarrays. Four identical cDNA macroarray membranes were generated from each 96-well plate.

The DF or SF unsubtracted mixtures, or the DF-SF or SF-DF subtracted mixtures, were used as complex hybridization probes for differential screening of macroarrays of the DF-SF cDNA library. Probes were obtained by performing the secondary nested PCR, and were then purified (QIAquick PCR Purification Kit; Qiagen). To prevent nonspecific interaction of the probes to cDNAs on macroarrays during hybridization, the adaptors were removed by three successive digestions with AfaI, SmaI, and EagI [14], the cDNA mixture was again purified (QIAquick PCR Purification Kit; Qiagen), and 75 to 100 ng were labeled with {alpha}32P[dCTP] by random priming (Megaprime DNA Labeling System; Amersham Pharmacia Biotech). The probes were purified (QIAquick Nucleotide Removal kit; Qiagen) and quantified using a beta counter.

The cDNA macroarray membranes were incubated for 4 h at 71°C in 20 ml of prehybridization solution (600 mM NaCl, 120 mM Tris pH 7.4, 4 mM EDTA, 0.1% Na4P2O7, 0.2% SDS, and 500 µg/ml heparin) to which heat denatured (5 min at 100°C) oligos were added to prevent nonspecific binding (1 mM each: PCR-nested 1; PCR-nested 2R; PCR-nested 1-INV [ACCTGCCCGGGCGGCCGCTCGA]; PCR-nested 2R-INV [ACCTCGGCCGCGACCACGCT]; 2 mM poly[dAdT]; Amersham Pharmacia Biotech). An equal amount (cpm) of each heat-denatured cDNA probe (DF-SF, SF-DF, DF, or SF) was added to separate 15-ml aliquots of hybridization solution and used to hybridize a designated duplicate of the DF-SF macroarray membrane. The hybridization solution was identical to the prehybridization solution but contained 15 µg of salmon sperm DNA and 10% dextran sulfate. The membranes were hybridized for 16 h at 71°C, then were washed for 15 min in 2x saline-sodium citrate (SSC; 0.3 M NaCl, 30 mM sodium citrate) and 0.1% SDS, followed by two 1-h washes in 0.1x SSC and 0.1% SDS at 71°C. Membranes were exposed to a phosphor screen for 4 to 16 h, and the images were digitized (Storm 840; Amersham Pharmacia Biotech). The differentially hybridizing cDNA clones were further characterized by DNA sequencing and gene expression analysis.

DNA Sequencing and Sequence Analysis

The cDNA clones identified as differentially expressed by the DF-SF subtracted probe were amplified by PCR for 15 cycles with the corresponding PCR-nested 1 and PCR-nested 2 oligos from the PCR product generated initially for the macroarrays. The PCR product was purified (Qiagen) and verified by agarose gel analysis for the presence of a single cDNA band before proceeding with sequencing. Ninety-seven cDNA clones were eliminated from sequencing because they presented multiple PCR fragments, 201 cDNA clones were sequenced, and 186 cDNA clones provided adequate sequencing results. Sequencing reactions were performed on cDNA clones via the dideoxy sequencing method (Big Dye Terminator 3.0, ABI Prism; Applied Biosystem PE, Branchburg, NJ) using the oligos PCR-nested 1 (1 mM) or P2R-INV (1 mM). Sequencing reactions were then analyzed on an ABI Prism 310 sequencer (Applied Biosystem). Nucleic acid sequences were analyzed using the basic local alignment search tool (BLAST) against GenBank data banks (NR and EST). A cDNA sequence was considered homologous to a GenBank sequence when at least 100 base pairs (bp) matched with an E probability value of less than e-10. The differentially expressed cDNAs were classified into three groups: 1) gene with known sequence and function; 2) gene with known sequence but unknown function; and 3) sequence with no significant match.

Gene Expression Analysis

The cDNA clones that were identified as differentially expressed in the SSH experiment were used to verify and compare their differential expression pattern in GC/oocytes of different stage follicles and CL using virtual Northern blot analysis or semiquantitative RT-PCR. To perform virtual Northern blots, SMART PCR cDNA synthesis technology (BD Biosciences Clontech) was used to generate cDNAs from 1 µg of total RNA isolated from GC/oocytes or CL as described above. The SMART cDNA synthesis was performed in a total volume of 10 µl with the addition of 42 ng of T4 gene 32 protein (Roche Molecular Biochemicals, Laval, QC) and PCR-amplified for 15 cycles as described previously [22]. The resulting cDNA pool was diluted to 50 µl in TE buffer (10 mM Tris pH 8, 1 mM EDTA), and 1 µl of the diluted pool was used in a secondary 100-µl PCR reaction for 18 cycles using Advantage 2 DNA polymerase (BD Biosciences Clontech) and the PCR primer (AAGCAGTGGTAACAACGCAGAGT). The cDNA products (10 µl) of the secondary PCR for each follicle or CL were separated on a 0.8% TBE-agarose gel (45 mM Tris-borate, 1 mM EDTA, 0.5 µg/ml ethidium bromide) for 4–5 h at 80–90 volts [17]. Molecular weight standards (1 kb ladder, {phi}X174-RF/HaeIII and {lambda}/HindIII; Amersham Pharmacia Biotech) were included to estimate size. The gel was washed in TBE buffer for 30 min, and cDNA samples were transferred onto nylon membrane (Hybond-N+) by alkaline capillary transfer [17], and then cross-linked by UV treatment (150 mJ, GS Gene Linker; BioRad).

Virtual Northern blot analysis was performed with differentially expressed cDNA fragments from the DF-SF group that had been classified as genes with known sequences and functions. GAPD was used as a control gene. Gene-specific probes were generated by PCR (20 cycles) using the primers PCR-nested 1 and PCR-nested 2R. The PCR products were separated on a 2% agarose gel in 1x TAE buffer. The cDNA bands were purified (QIAquick Gel Extraction Kit; Qiagen), digested with AfaI and EagI then re-purified (QIAquick, PCR Purification Kit; Qiagen), and labeled with {alpha}32P[dCTP] as described above. Virtual Northern membranes were prehybridized, hybridized, and washed as described for the differential hybridization of macroarrays, except that oligos were omitted during the prehybridization and hybridization steps. Membranes were exposed to a phosphor screen and the images were digitized (Storm 840; Amersham Pharmacia Biotech).

Semiquantitative RT-PCR was performed for genes that showed either a weak signal or no signal by virtual Northern blot analysis, or for which gene-specific primers were available. SMART cDNAs from secondary PCR reactions were diluted 10-fold in TE buffer, and 1 µl was used in a 25-µl PCR reaction using the Advantage 2 DNA polymerase. The number of PCR cycles were limited and optimized for each gene to be analyzed. Gene-specific PCR primers were for steroidogenic factor-2 (SF2; sense, AGAAAGCGTTGTCCCTACTGTCG; antisense, TCTGGCTCACACTTCAAAAGTTCC [23]), pregnancy-associated plasma protein-A (PAPP-A; sense, CCTGCATGGAGACAGAGCCCT; antisense, CAGTCAGTGGAGACAAAGGTC [24], and GAPD as described above. Twenty microliters of the PCR reactions were separated on a 2% TAE-agarose gel with ethidium bromide, PCR products were visualized with UV light, and the images digitized. The digitized signals for each gene obtained either by virtual Northern blot or semiquantitative RT-PCR were analyzed by densitometry using ImageQuant software (Amersham Pharmacia Biotech).

Statistical Analysis

Gene-specific signals for virtual Northern blots or RT-PCR analysis were normalized with corresponding GAPD signals for each sample. Homogeneity of variance between follicular group and CL was verified by O'Brien and Brown-Forsythe tests [25]. Corrected values of gene-specific mRNA levels were compared between follicular or CL groups by one-way ANOVA. When ANOVA indicated significant difference (P < 0.05), group means were compared with Tukey-Kramer multiple comparison tests. Data were presented as least-square means ± SEM.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of Differentially Expressed Genes Using SSH

To construct a subtracted cDNA library enriched in transcripts that are preferentially expressed in dominant follicles compared to small follicles, mRNA from the GC/oocytes of small follicles was reverse-transcribed into cDNAs, and subtracted from DF cDNAs by SSH (DF-SF). As a control, the reverse hybridization was also performed and consisted of DF cDNAs that were subtracted from SF cDNAs (SF-DF). The subtraction efficiency was evaluated by PCR analysis by comparing the abundance of two control cDNAs preceding and following subtraction.

First, GAPD was used as a control to confirm the reduced relative abundance of a housekeeping gene in the subtracted samples following the SSH procedure. The GAPD PCR product was observed after 15 PCR cycles in the DF unsubtracted sample, whereas in the DF-SF subtracted sample, the PCR-amplified GAPD fragment required five more PCR cycles to be detected on agarose gel (Fig. 1A). This indicated a marked decrease of GAPD cDNA abundance in the DF-SF subtracted sample. Second, CYP19 was used as a positive control for the enrichment of a differentially expressed gene in the DF-SF subtracted sample. To this end, PCR analysis was used to compare the abundance of CYP19 in dominant follicles to that of the DF-SF or SF-DF subtracted samples. The analysis showed that CYP19 PCR product was observed mainly in the GCs of dominant follicles compared to small follicles (Fig. 1B), and that CYP19 cDNA was efficiently enriched in the subtracted DF-SF sample when compared to the unsubtracted DF sample. Conversely, CYP19 cDNA was completely depleted in the reverse-subtracted (SF-DF) sample.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 1. Evaluation of subtraction efficiency. A) Reduction of GAPD cDNA following subtraction in the DF-SF sample. PCR was performed on DF-SF subtracted and DF-unsubtracted PCR samples using GAPD-specific primers, and aliquots were collected at an increasing number of PCR cycles as indicated. In the unsubtracted sample, the GAPD cDNA fragment (710 bp) was detected after 15 PCR cycles, but could be observed only following 20 PCR cycles in the subtracted sample. B) Enrichment of CYP19 cDNA following subtraction in the DF-SF sample. PCR was performed on the indicated samples using CYP19-specific primers. PCR product aliquots were collected at increasing number of PCR cycles as indicated. The CYP19 DNA fragment (520 bp) was detected following 13 cycles after subtraction, but not until 18 cycles in the corresponding unsubtracted DF sample

Once the subtraction efficiency was shown to be satisfactory, DF-SF SSH cDNA products were cloned into a plasmid vector to generate a subtracted DF cDNA library. Before proceeding to the characterization of cDNA clones, a differential hybridization procedure was performed to identify false positive clones among the 837 bacterial colonies that were randomly selected. The subtracted (DF-SF, SF-DF) and unsubtracted (SF, DF) cDNA preparations were used as hybridization probes for the differential screening of the 837 cDNA clones spotted on four identical sets of macroarrays. Representative differential screening results are illustrated in Figure 2. The differential hybridization screening yielded approximately 20% clones with no hybridization signal. The cDNA clones were classified as differentially expressed if they hybridized mainly with the DF-SF subtracted and DF-unsubtracted probes, but not with the reverse-subtracted probe (SF-DF), and only faintly (or not at all) with the SF unsubtracted probe, as determined by comparing signal intensities between the four identical macroarrays.



View larger version (81K):
[in this window]
[in a new window]
  		FIG. 2. Representative differential screening results by macroarrays of the DF-SF cDNA library. PCR-amplified cDNA fragments obtained by SSH were dot-blotted onto four identical sets of membranes. The macroarrays were then hybridized with four different probes: subtracted DF-SF cDNAs (A), unsubtracted DF cDNAs (B), reverse-subtracted SF-DF cDNAs (C), and unsubtracted SF cDNAs (D). The two upper left dots served as internal controls: 1 indicates CYP19 (positive control), 2 indicates GAPD (negative control). Examples of cDNA clones that were preferentially expressed in dominant follicles compared to small follicles (i.e., positive clones) are indicated by an arrow for ApoER2 or arrowhead for INHBA

The differential screening procedure identified 298 cDNA clones as true positives, of which 201 were analyzed by sequencing, and 186 generated adequate sequencing results. Comparison of the obtained DNA sequences against GenBank databases resulted in the identification of 42 nonredundant cDNAs, of which 22 corresponded to known cDNAs, 13 were classified as uncharacterized cDNAs (BAC or EST clones), and 7 were novel sequences (Table 1). All the known genes and their frequency of identification during the differential screening are listed in Table 2. Several genes, such as CYP19, inhibin/activin ß-A subunit (INHBA; [26]), connexin-43 (CX43; [27]), and serine protease inhibitor E2 (SERPINE2; [16]) were already known to be more abundant in GCs of dominant follicles than in those of small follicles, and their detection therefore further validated the subtraction procedure. Also identified were genes that had previously been reported to be expressed in GCs of ovarian follicles, including glutathione S-transferase alpha (GSTA-1 and GSTA-2; [28]), nuclear receptor 5A2 (NR5A2; also named steroidogenic factor-2, SF-2; [23]), tumor necrosis factor {alpha}-induced protein 6 (TNFAIP6; also named tumor necrosis factor gene-6, TSG6; [29]), and chondroitin sulfate proteoglycan-2 (CSPG2, also named versican; [30]). The remaining 14 cDNAs had not previously been reported to be expressed in ovarian follicles.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Summary of the subtracted DF-SF cDNA clones that were sequenced


View this table:
[in this window]
[in a new window]
  		TABLE 2. Identity of cDNA clones found to be differentially expressed by SSH in bovine granulosa cells of DF compared to SF


View this table:
[in this window]
[in a new window]
  		TABLE 2. Continued

Analysis of Messenger RNA Expression

To confirm that genes identified by SSH are differentially expressed in dominant follicles compared to small follicles, expression of selected genes was analyzed by virtual Northern blot analysis using mRNA samples derived from GCs of different stages of follicular development and CL from Day 5 of the estrous cycle. For this procedure, mRNAs were reverse-transcribed into cDNAs, separated on agarose gel, and used to generate six membranes that were hybridized to six of the cloned cDNA inserts described in Table 2. The ApoER2 (also named low-density lipoprotein receptor-related protein-8, LRP-8) was mainly detected in the DF with a 14-fold higher expression level in dominant follicles compared to small follicles (Fig. 3A). The carboxypeptidase-D (CPD) mRNA was also mainly expressed in dominant follicles, associated with a 20-fold higher expression level in dominant follicles compared to small follicles (Fig. 3B). The CSPG2 mRNA was mainly expressed in dominant follicles, where a 7-fold higher expression level was measured, compared to that of small follicles (Fig 3C). The 14-3-3 epsilon transcript was mainly expressed in dominant follicles, a 6-fold higher expression level in dominant follicles compared to that of small follicles (Fig. 3D). The regucalcin (RGN, also named senescence marker protein-30, SMP30) transcript was also expressed in all samples, and displayed an 8-fold higher expression level in dominant follicles compared to that of small follicles (Fig. 3E). The analyses showed an increase of at least 50-fold in SERPINE2 transcripts in dominant follicles compared to that of small follicles (Fig. 3F). A comparative RT-PCR assay was performed for the NR5A2 mRNA, which showed a weak signal by virtual Northern blot analysis (data not shown). We observed that NR5A2 transcript was increased in dominant follicles compared to small follicles, and its expression was maintained in OVU follicles but was reduced in CL (Fig. 4). Furthermore, a similar analysis for pregnancy-associated plasma protein-A (PAPP-A) was performed as a positive control for higher expression in the DF group compared to that of the SF group. We observed that the PAPP-A transcript was more abundant in the DF group than in SF group (Fig. 4).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 3. Analysis of mRNA expression by virtual Northern blot. Total RNA was extracted from bovine GC from <=4 mm follicles (SF), dominant follicles at Day 5 of the estrous cycle (DF), preovulatory follicles 22 to 23 h after injection of hCG (OVU), and CL from Day 5 of the estrous cycle, and was employed in mRNA expression analyses using the virtual Northern blot technique as described in Materials and Methods. GAPD was used as a control gene, and showed no significant difference in mRNA expression levels between samples. Gene-specific signals were normalized with corresponding GAPD signals for each sample. A) Expression of ApoER2 displayed a 14-fold higher expression level in DF than in SF (P < 0.0001); (B) expression of CPD mRNA was 20-fold higher in DF than in SF (P < 0.0001); (C) expression of CSPG2 mRNA was 7-fold higher in DF than in other samples (P < 0.0001); (D) expression of 14-3-3 epsilon mRNA was 6-fold higher in DF than in SF (P < 0.0001); (E) expression of RGN mRNA was 8-fold higher in DF than in SF (P < 0.0001); (F) expression of SERPINE2 mRNA was 50-fold higher in DF than in SF (P < 0.0001). Probability values for each one-way ANOVA analysis are specified above in parentheses. Group means that differed are indicated by an asterisk. Different letters denote samples that are significantly different (P < 0.05) when Tukey-Kramer multiple comparison tests were performed. Data are presented as least-square means ± SEM, and the number of independent samples per group is indicated in parentheses



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 4. Analysis of mRNA expression by RT-PCR. Total RNA was extracted from bovine GCs from <=4 mm follicles (SF), dominant follicles at Day 5 of the estrous cycle (DF), preovulatory follicles 22 to 23 h after injection of hCG (OVU) and CL from Day 5 of the estrous cycle, and was employed in mRNA expression analyses using RT-PCR as described in Materials and Methods. GAPD was used as a control gene, and showed no significant differences between samples. Gene-specific signals were normalized with corresponding GAPD signals for each sample. PAPP-A and NR5A2 are represented by filled and open boxes, respectively. Expression of PAPP-A mRNA was 7.3-fold higher in DF than in SF (P < 0.0001). Expression of NR5A2 mRNA was 6.2-fold higher in DF than in SF (P < 0.0001). Probability values for each one-way ANOVA analysis are specified above in parentheses. Different letters specify means that are significantly different (P < 0.05) when Tukey-Kramer multiple comparison tests were performed. Data are presented as least-square means ± SEM, and the number of independent samples per group is indicated in parentheses


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In mono-ovulatory species, the mechanisms that allow a DF to be selected and ovulate in conditions in which other follicles degenerate are not fully understood. Characterization of the specific subset of genes regulating final follicular growth provides valuable information about the developmental events that contribute to follicular selection and dominance. Available information pertaining to gene expression analysis in GCs of small antral bovine follicles (<=4 mm) compared to the growing DF is limited, and although some key genes are known, it is clear that many more must be identified. To further understand the molecular basis for DF selection and growth, we performed an SSH screen designed to identify genes that are differentially expressed in GCs of growing dominant follicles compared to nonselected small follicles (<=4 mm).

Screening the DF-SF subtracted cDNA library allowed the identification of genes such as SERPINE2 [16], CYP19 [6–9], CX43 [27, 31], and INHBA subunit [26, 32, 33] that had previously been shown to be differentially expressed in GCs of dominant follicles compared to that of small follicles. The identification of these genes thus provides an important validation of the physiological model and the analytical techniques used herein. However, other expected genes that would have been expected to be differentially expressed were not identified in the DF-SF subtracted library. The precise reason for this is unknown and may vary from one gene to another. For a given gene, it may be related to its low level of expression, to the small difference in level of expression between dominant and small follicles, to the presence of isoforms, to the limited number of cDNA clones analyzed, or to the detection limits of the differential screening procedure. To verify this assumption, we compared the expression of PAPP-A mRNA in dominant and small follicles, because PAPP-A is a long cDNA that is expressed at a low level, and was recently shown to be differentially expressed in growing versus atretic follicles [24]. The analysis confirmed that PAPP-A mRNA is more abundant in growing dominant follicles than in nonselected small follicles, providing further validation of our experimental model. Despite differences that were observed in insulin-like growth factor binding proteins (IGFBPs) in follicular fluid when bovine dominant follicles were compared to subordinate follicles [6–9], no difference in mRNA levels for IGFBP-2, -3, and -4 have been found in GCs of dominant follicles versus subordinate follicles [34]. The latter mRNA study is in agreement with our present results, because no IGFBP mRNA was found to be differentially expressed.

Other genes identified by the SSH procedure are already known to be expressed in GCs of ovarian follicles, but no report has yet indicated that these genes are differentially expressed during follicular development. This group includes NR5A2, CSPG-2, TSG-6, and GSTA1-2. NR5A2 (also known as FTF/LRH-1) is a member of the NR5A orphan nuclear receptor subfamily, and has been shown to share a high degree of structural similarity with another member of this subfamily, NR5A1a or SF-1 [35]. NR5A1a modulates the transcriptional activity of many genes involved in a variety of metabolic and developmental processes, including ovarian steroidogenic genes [36, 37]. NR5A2 transactivates the CYP7 and CYP19 genes and is believed to share the same DNA binding specificity as NR5A1a, suggesting a functional redundancy [38, 39]. Equine NR5A1a and NR5A2 have been characterized, and the expression of their mRNAs was studied in the follicle during hCG-induced ovulation and luteinization [23]. Unexpectedly, NR5A2 is highly expressed in equine GCs and CL compared to NR5A1a expression, thereby suggesting a more important role for NR5A2 than NR5A1 in controlling steroidogenesis in GCs. We report an increase of NR5A2 expression in bovine dominant follicles compared to small follicles, suggesting a possible prominent role for NR5A2 in the control of steroid synthesis as the selected DF develops.

CSPG-2 (also named versican) is a member of the hyaluronan-binding proteoglycans, termed hyalectins [40]. It is a large extracellular matrix proteoglycan with a versatile modular structure that interacts directly with cells or indirectly with molecules that are associated with cells. Versican regulates cell adhesion and survival, cell proliferation, cell migration, and extracellular matrix assembly [41, 42]. The central region of versican is encoded by two exons, named {alpha}GAG and ßGAG that specify chondroitin sulfate attachment. Four splice variants are described for versican mRNA, which correspond to V0 (containing {alpha}GAG and ßGAG), V1 (ßGAG), V2 ({alpha}GAG), and V3 (neither {alpha}GAG nor ßGAG; [40]). We identified the V0/V1 isoforms in the DF because one of the cDNA fragments derived from the SSH analysis corresponded to the ßGAG domain, whereas the other corresponded to the 3' untranslated region. Our mRNA expression analysis provided further evidence for the high-molecular-weight V0/V1 isoforms, and that V0/V1 expression is increased in dominant follicles compared to that of small follicles. While a previous report showed the presence of the V0/V1 versican isoforms in small antral follicles but not in primordial or preantral follicles [30], this is the first report of differential versican expression in dominant versus small follicles. In the rat, versican V0/V1 expression increases 4 to 6 h following induction with hCG [43]. However, in bovine GCs, we have not observed an increase in versican V0/V1 expression 23 h post-hCG injection, suggesting that the regulation of versican expression may vary significantly between species. The spatiotemporal expression of versican isoforms should be further studied in the bovine species during the periovulatory period, given its likely critical role in modifying the extracellular matrix to support the growth of the DF.

TNFAIP6 (also named TSG-6) was identified once in the DF cDNA subtracted library, and in a parallel study, we observed that TSG-6 mRNA was slightly increased in GCs of dominant follicles compared to that of small follicles [44]. TSG-6 is a member of the Link module superfamily and binds to hyaluronan, a vital component of the extracellular matrix. TSG-6 expression is tightly regulated in different tissues, and is induced in response to extracellular matrix remodeling, inflammatory mediators, and ovulation [13, 45]. A small mechanical strain imposed on vascular smooth muscles was shown to induce the expression of TSG-6 and versican, and promoted the aggregation of versican to hyaluronan [46]. Interaction between TSG-6, versican, and hyaluronan may counteract mechanical force induced by the growth of the DF and contribute to modifications of the extracellular matrix surrounding the DF.

GSTA-1 and -2 subunits were also identified, and they correspond to a multigene family of related proteins that have been divided into five classes of alpha, mu, pi, sigma, and theta. The biological action of GSTs is to provide protection against cellular oxidative stress [47]. GSTA-1 and -2 mRNAs are coexpressed, and immunohistochemistry revealed that expression of GSTAs is associated with GCs and theca cells, and that levels of GSTA mRNAs are modulated by FSH and LH in bovine follicles during the periovulatory period [28]. Expression of GSTA isoenzymes may thus be linked to cell types involved in steroid synthesis or metabolism and could be related to cellular oxidative stress induced by reactive oxygen species generated during steroid metabolism. Because steroidogenic activity increases as follicular development occurs, an increase in GSTA mRNA in healthy growing dominant follicles compared to small follicles, as shown in this study, would be expected.

The remaining 13 cDNAs identified in our SSH screening have not been previously shown to be expressed in the ovarian follicle. Among these, we believe that ApoER2, CPD, 14-3-3 epsilon, and RGN in particular represent interesting novel candidate genes associated with follicular growth and dominance. ApoER2, which was the second-most identified cDNA clone in the DF subtracted library, belongs to the low-density lipoprotein receptor (LDLR) gene family that includes LDLR, LDL-receptor-related protein (LRP), megalin, and the very-low-DLR (VLDLR). The LDLR are cell surface receptors that are known to mediate the uptake of extracellular lipoprotein's lipid-rich cargo into the cell, and were recently shown to transduce extracellular signals and activate intracellular tyrosine kinase signaling [48, 49]. ApoER2 differs from the other members of the LDLR family notably by its longer cytoplasmic domain, which contains a protein-protein interaction domain involved in transmembrane signal transduction mechanisms [50]. Indeed, extracellular domain of VLDLR and ApoER2 have been shown to bind Reelin [51, 52], triggering the phosphorylation of Dab1 bound to either ApoER2 or VLDLR [53, 54]. Furthermore, the ApoER2 contains a specific 59 amino acid proline-rich region found in its cytoplasmic domain that interacts with the c-Jun N-terminal kinase interacting protein (JIP) family [55, 56]. Our studies of ApoER2 in bovine follicles showed the highest expression of ApoER2 in GCs of dominant follicles, and low levels in small follicles, hCG-treated preovulatory follicles, and the CL. This pattern of expression contrasts markedly with the lipid requirements of ovarian steroidogenic cells, particularly in the CL [57, 58]. Therefore, coupled with the aforementioned proposed role of ApoER2 in signal transduction, our observations suggest that in the ovary, ApoER2 is likely to be involved in other functions than importing cholesterol for steroidogenesis. The characterization and further studies of the bovine ApoER2 isoforms in the ovary will be necessary to decipher its function in relation to follicular growth and dominance.

CPD is a carboxypeptidase E (CPE)-like enzyme that has been proposed to be involved in peptide processing, based on its presence in hormone-containing pituitary secretory vesicles [59]. Unlike other metallocarboxypeptidases, CPD contains multiple carboxypeptidase domains, and its expression is broadly distributed among mammalian tissues with highest levels in pituitary, brain, and adrenal gland [59–64]. CPD is present in the trans-Golgi network (TGN), the secretory and reuptake pathways, and transiently on the cell surface [65–67]. Therefore, CPD is believed to function following the action of furin, proprotein convertase 7, and related endopeptidases in the processing of proteins that transit the secretory pathway within the TGN and immature vesicles [60]. However, the absence of CPD from mature secretory vesicles suggests that this is not the primary role of CPD. Instead, it is possible that CPD is involved in the processing of proteins that are secreted via the constitutive pathway, such as growth factors and growth factor receptors (insulin, insulin-like growth factors, insulin receptor, insulin-like growth factor receptor, etc.). Therefore, increased expression of CPD mRNA in GCs of dominant follicles could be related to processing of growth factors and their receptors, which are important for follicular development and differentiation.

The 14-3-3 protein family, first discovered as acidic proteins in the brain, is highly conserved in animals, and nine isoforms have been identified. The precise function of 14-3-3 proteins is still not clear but they are known to inhibit cell cycle progression and apoptosis, and to act as stimulatory or inhibitory factors in many signal transduction pathways [68]. 14-3-3 epsilon has been shown to interact with activated type I insulin-like growth factor-receptor (IGF1R) via phosphoserine residues at the carboxy-terminus of the receptor, as well as with insulin receptor substrate-1 (IRS-1) in a phosphorylation-dependent manner [69]. The potential functional roles that 14-3-3 epsilon may play in IGF1R and IRS-1 mediated signaling remain to be elucidated. It is interesting that IGF-1, which binds the IGF1R, is known to stimulate granulosa and theca cell proliferation and steroidogenesis in response to gonadotropins [70, 71]. Also, IGF1R is expressed in GCs and increases in the later stages of DF development [72, 73]. Therefore, the increase of 14-3-3 epsilon mRNA observed in GCs of dominant follicles compared to small follicles suggests that 14-3-3 epsilon may modulate the IGF1 intracellular cascade during follicular development.

RGN is a calcium-binding protein also called senescence marker protein-30 (SMP30) [74, 75], and is expressed mainly in hepatocytes and renal tubular epithelia [74]. By RT-PCR analysis, RGN/SMP30 transcripts have been detected in additional tissues including the brain, lung, adrenal gland, stomach, ovary, testis, and epidermis [76]. The amounts of RGN/SMP30 increase during tissue-maturing stages and adulthood but decrease with aging in the livers and kidneys of rats [74, 77]. RGN/SMP30 has a reversible effect on the activation and inhibition of various enzymes by regulating Ca2+ in the rat liver [78]. Additional studies demonstrate that RGN/SMP30 rescues Hep G2 cells from apoptosis by enhancing plasma membrane Ca2+-pumping activity [79]. Furthermore, RGN/SMP30-knockout mouse livers are highly susceptible to apoptosis, suggesting that RGN/SMP30 has a protective role in cell injury such as apoptosis and hypoxia [76]. In aged tissues, decrease of RGN/SMP30 may induce dysregulation of Ca2+ homeostasis, which could result in the modification of the signaling system and therefore be responsible for the age-associated deterioration of cellular functions. Our results show that RGN/SMP30 mRNA expression increases with follicular development to reach highest levels within the CL. Because Ca2+ is a second messenger common to several signal transduction pathways that lead to cell proliferation, differentiation, and apoptosis, RGN/SMP30 could be involved in proper Ca2+ homeostasis during follicular development and luteal function.

In summary, we have identified several genes that may contribute toward understanding the mechanisms involved with final ovarian follicular growth, selection, and dominance in mono-ovulatory species. It will be necessary to further analyze their spatiotemporal expression pattern at the mRNA and protein levels in the developing ovarian follicle.


   ACKNOWLEDGMENTS
 
The authors thank Mrs. Manon Salvas for her technical assistance during nucleic acid sequencing, and Dr. Derek Boerboom and Dr. Alan Goff (Université de Montréal) for their constructive comments and corrections to the manuscript.


   FOOTNOTES
 
1 This work was supported by a CORPAQ grant from the Ministère de l'agriculture, des pêcheries et de l'alimentation du Québec and a Discovery Grant to J.G.L. from the Natural Sciences and Engineering Research Council of Canada (NSERC). Back

2 Correspondence: Jacques G. Lussier, Faculté de médecine vétérinaire, Université de Montréal, P.O. Box 5000, St-Hyacinthe, Québec, J2S 7C6, Canada. FAX: 450 778 8103; jacques.lussier{at}umontreal.ca Back

Received: 30 July 2003.

First decision: 19 August 2003.

Accepted: 17 October 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lussier JG, Matton P, Dufour JJ. Growth rates of follicles in the ovary of the cow. J Reprod Fertil 1987 81:301-307[Abstract/Free Full Text]
  2. Lussier JG, Matton P, Guilbault LA, Grasso F, Mapletoft RJ, Carruthers TD. Ovarian follicular development and endocrine responses in follicular-fluid-treated and hemi-ovariectomized heifers. J Reprod Fertil 1994 102:95-105[Abstract/Free Full Text]
  3. Markström E, Svensson ECh, Shao R, Svanberg B, Billig H. Survival factors regulating ovarian apoptosis—dependence on follicle differentiation. Reproduction 2002 123:23-30[Abstract]
  4. Gong JG, Campbell BK, Bramley TA, Gutierrez CG, Peters AR, Webb R. Suppression in the secretion of follicle-stimulating hormone and luteinizing hormone, and ovarian follicle development in heifers continuously infused with a gonadotropin-releasing hormone agonist. Biol Reprod 1996 55:68-74[Abstract]
  5. Guilbault LA, Grasso F, Lussier JG, Rouillier P, Matton P. Decreased superovulatory responses in heifers superovulated in the presence of a dominant follicle. J Reprod Fertil 1991 91:81-89[Abstract/Free Full Text]
  6. Fortune JE, Rivera GM, Evans ACO, Turzillo AM. Differentiation of dominant versus subordinate follicles in cattle. Biol Reprod 2001 65:648-654[Abstract/Free Full Text]
  7. Ginther OJ, Beg MA, Bergfelt DR, Donadeu FX, Kot K. Follicle selection in monovular species. Biol Reprod 2001 65:638-647[Abstract/Free Full Text]
  8. Mihm M, Austin EJ. The final stages of dominant follicle selection in cattle. Domest Anim Endocrinol 2002 23:155-166[CrossRef][Medline]
  9. Monget P, Fabre S, Mulsant P, Lecerf F, Elsen JM, Mazerbourg S, Pisselet C, Monniaux D. Regulation of ovarian folliculogenesis by IGF and BMP system in domestic animals. Domest Anim Endocrinol 2002 23:139-154[CrossRef][Medline]
  10. Bao B, Thomas MG, Williams GL. Regulatory roles of high-density and low-density lipoproteins in cellular proliferation and secretion of progesterone and insulin-like growth factor I by enriched cultures of bovine small and large luteal cells. J Anim Sci 1997 75:3235-3245[Abstract/Free Full Text]
  11. Evans AC, Fortune JE. Selection of the dominant follicle in cattle occurs in the absence of differences in the expression of messenger ribonucleic acid for gonadotropin receptors. Endocrinology 1997 138:2963-2971[Abstract/Free Full Text]
  12. Sunderland SJ, Crowe MA, Boland MP, Roche JF, Ireland JJ. Selection, dominance and atresia of follicles during the oestrous cycle of heifers. J Reprod Fertil 1994 101:547-555[Abstract/Free Full Text]
  13. Richards JS, Russell DL, Ochsner S, Espey LL. Ovulation: New dimensions and new regulators of the inflammatory-like response. Annu Rev Physiol 2002 64:69-92[CrossRef][Medline]
  14. Diatchenko L, Lukyanov S, Lau Y-F C, Siebert PD. Suppression subtractive hybridization: A versatile method for identifying differentially expressed genes. Methods Enzymol 1999 303:349-379[CrossRef][Medline]
  15. Sirois J. Induction of prostaglandin endoperoxide synthase-2 by human chorionic gonadotropin in bovine preovulatory follicles in vivo. Endocrinology 1994 135:841-848[Abstract]
  16. Bédard J, Brûlé S, Price CA, Silversides DW, Lussier JG. Serine protease inhibitor-E2 (SERPINE2) is differentially expressed in granulosa cells of dominant follicle in cattle. Mol Reprod Dev 2003 64:152-165[CrossRef][Medline]
  17. Sambrook J, Russell DW. Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2001
  18. Endege WO, Steinmann KE, Boardman LA, Thibodeau SN, Schlegel R. Representative cDNA libraries and their utility in gene expression profiling. Biotechniques 1999 26:542-550[Medline]
  19. Zhumabayeva B, Diatchenko L, Chenchik A, Siebert PD. Use of SMART-generated cDNA for gene expression studies in multiple human tumors. Biotechniques 2001 30:158-163[Medline]
  20. Lussier JG, Sirois J, Price C, Carrière P, Silversides DW. Research in genomics applied at the undergraduate level: When research meets teaching objectives. In: Program of the 34th annual meeting of the Society for the Study of Reproduction, 2001; Ottawa, ON. Abstract 71
  21. Hinshelwood MM, Corbin CJ, Tsang PC, Simpson ER. Isolation and characterization of a complementary deoxyribonucleic acid insert encoding bovine aromatase cytochrome P450. Endocrinology 1993 133:1971-1977[Abstract/Free Full Text]
  22. Lévesque V, Fayad T, Ndiaye K, Diouf MN, Lussier JG. Size-selection of cDNA libraries for the cloning of cDNAs after suppression subtractive hybridization. Biotechniques 2003 35:72-78[Medline]
  23. Boerboom D, Pilon N, Behdjani R, Silversides DW, Sirois J. Expression and regulation of transcripts encoding two members of the NR5A nuclear receptor subfamily of orphan nuclear receptors, steroidogenic factor-1 and NR5A2, in equine ovarian cells during the ovulatory process. Endocrinology 2000 141:4647-4656[Abstract/Free Full Text]
  24. Mazerbourg S, Overgaard MT, Oxvig C, Christiansen M, Conover CA, Laurendeau I, Vidaud M, Tosser-Klopp G, Zapf J, Monget P. Pregnancy-associated plasma protein-A (PAPP-A) in ovine, bovine, porcine, and equine ovarian follicles: involvement in IGF binding protein-4 proteolytic degradation and mRNA expression during follicular development. Endocrinology 2001 142:5243-5253[Abstract/Free Full Text]
  25. JMP. Software for statistical visualization on the Apple McIntosh. Version 2. SAS Institute Inc. Cary, NC; 1989
  26. Ireland JL, Ireland JJ. Changes in expression of inhibin/activin alpha, beta A and beta B subunit messenger ribonucleic acids following increases in size and during different stages of differentiation or atresia of non-ovulatory follicles in cows. Biol Reprod 1994 50:492-501[Abstract]
  27. Nuttinck F, Peynot N, Humblot P, Massip A, Dessy F, Fléchon JE. Comparative immunohistochemical distribution of connexin 37 and connexin 43 throughout folliculogenesis in the bovine ovary. Mol Reprod Dev 2000 57:60-66[CrossRef][Medline]
  28. Rabahi F, Brûlé S, Sirois J, Beckers JF, Silversides DW, Lussier JG. High expression of bovine alpha glutathione S-transferase (GSTA1, GSTA2) subunits is mainly associated with steroidogenically active cells and regulated by gonadotropins in bovine ovarian follicles. Endocrinology 1999 140:3507-3517[Abstract/Free Full Text]
  29. Yoshioka S, Ochsner S, Russell DL, Ujioka T, Fujii S, Richards JS, Espey LL. Expression of tumor necrosis factor-stimulated gene-6 in the rat ovary in response to an ovulatory dose of gonadotropin. Endocrinology 2000 141:4114-4119[Abstract/Free Full Text]
  30. McArthur ME, Irving-Rodgers HF, Byers S, Rodgers RJ. Identification and immunolocalization of decorin, versican, perlecan, nidogen, and chondroitin sulfate proteoglycans in bovine small-antral ovarian follicles. Biol Reprod 2000 63:913-924[Abstract/Free Full Text]
  31. Johnson ML, Redmer DA, Reynolds LP, Grazul-Bilska AT. Expression of gap junctional proteins connexin 43, 32 and 26 throughout follicular development and atresia in cows. Endocrine 1999 10:43-51[CrossRef][Medline]
  32. Sunderland SJ, Knight PG, Boland MP, Roche JF, Ireland JJ. Alterations in intrafollicular levels of different molecular mass forms of inhibin during development of follicular- and luteal-phase dominant follicles in heifers. Biol Reprod 1996 54:453-462[Abstract]
  33. Ginther OJ, Beg MA, Bergfelt DR, Kot K. Activin A, estradiol, and free insulin-like growth factor 1 in follicular fluid preceding the experimental assumption of follicle dominance in cattle. Biol Reprod 2002 67:14-19[Abstract/Free Full Text]
  34. Voge JL, Allen DT, Malayer JR, Spicer LJ. Relationships among levels of granulosa cells insulin-like growth factor binding-protein (IGFBP) mRNAs and follicular fluid IGFBPs and steroids in dominant and subordinate follicles of preovulatory cattle. In: Program of the 35th annual meeting of the Society for the Study of Reproduction; 2002; Baltimore, MD. Abstract 281
  35. Wilson TE, Fahrner TJ, Milbrandt J. The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor-DNA interaction. Mol Cell Biol 1993 13:5794-5804[Abstract/Free Full Text]
  36. Parker KL, Schimmer BP. Steroidogenic factor 1: A key determinant of endocrine development and function. Endocr Rev 1997 18:361-377[Abstract/Free Full Text]
  37. Leers-Sucheta S, Morohashi K, Mason JI, Melner MH. Synergistic activation of the human type II 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 1997 272:7960-7967[Abstract/Free Full Text]
  38. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: An orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7alpha-hydroxylase gene. Proc Natl Acad Sci U S A 1999 96:6660-6665[Abstract/Free Full Text]
  39. Clyne CD, Speed CJ, Zhou J, Simpson ER. Liver receptor homologue-1 (LRH-1) regulates expression of aromatase in preadipocytes. J Biol Chem 2002 277:20591-20597[Abstract/Free Full Text]
  40. Schmalfeldt M, Dours-Zimmermann MT, Winterhalter KH, Zimmermann DR. Versican V2 is a major extracellular matrix component of the mature bovine brain. J Biol Chem 1998 273:15758-15764[Abstract/Free Full Text]
  41. Kresse H, Schönherr E. Proteoglycans of the extracellular matrix and growth control. J Cell Physiol 2001 189:266-274[CrossRef][Medline]
  42. Wight TN. Versican: A versatile extracellular matrix proteoglycan in cell biology. Curr Opin Cell Biol 2002 14:617-623[CrossRef][Medline]
  43. Russell DL, Ochsner SA, Hsieh M, Mulders S, Richards JS. Hormone-regulated expression and localization of versican in the rodent ovary. Endocrinology 2003 144:1020-1031[Abstract/Free Full Text]
  44. Lévesque V, Fayad T, Sirois J, Silversides DW, Lussier JG. Identification of hCG-induced gene expression in granulosa cells of bovine preovulatory follicles using suppressive subtractive hybridization. In: Program of the 35th annual meeting of the Society for the Study of Reproduction; 2002; Baltimore, MD. Abstract 275
  45. Milner CM, Day AJ. TSG-6: A multifunctional protein associated with inflammation. J Cell Sci 2003 116:1863-1873[Abstract/Free Full Text]
  46. Lee RT, Yamamoto C, Feng Y, Potter-Perigo S, Briggs WH, Landschulz KT, Turi TG, Thompson JF, Libby P, Wight TN. Mechanical strain induces specific changes in the synthesis and organization of proteoglycans by vascular smooth muscle cells. J Biol Chem 2001 276:13847-13851[Abstract/Free Full Text]
  47. Ketterer B. Glutathione S-transferases and prevention of cellular free radical damage. Free Radic Res 1998 28:647-658[Medline]
  48. Willnow TE, Nykjaer A, Herz J. Lipoprotein receptors: new roles for ancient proteins. Nat Cell Biol 1999 1:E157-E162[CrossRef][Medline]
  49. Strickland DK, Gonias SL, Argraves WS. Diverse roles for the LDL receptor family. Trends Endocrinol Metab 2002 13:66-74[CrossRef][Medline]
  50. Kim DH, Magoori K, Inoue TR, Mao CC, Kim HJ, Suzuki H, Fujita T, Endo Y, Saeki S, Yamamoto TT. Exon/intron organization, chromosome localization, alternative splicing, and transcription units of the human apolipoprotein E receptor 2 gene. J Biol Chem 1997 272:8498-8504[Abstract/Free Full Text]
  51. Hiesberger T, Trommsdorff M, Howell BW, Goffinet A, Mumby MC, Cooper JA, Herz J. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron 1999 24:481-489[CrossRef][Medline]
  52. D'Arcangelo G, Homayouni R, Keshvara L, Rice DS, Sheldon M, Curran T. Reelin is a ligand for lipoprotein receptors. Neuron 1999 24:471-479[CrossRef][Medline]
  53. Trommsdorff M, Borg JP, Margolis B, Herz J. Interaction of cytosolic adaptor proteins with neuronal apolipoprotein E receptors and the amyloid precursor protein. J Biol Chem 1998 273:33556-33560[Abstract/Free Full Text]
  54. Trommsdorff M, Gotthardt M, Hiesberger T, Shelton J, Stockinger W, Nimpf J, Hammer RE, Richardson JA, Herz J. Reeler/Disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell 1999 97:689-701[CrossRef][Medline]
  55. Yasuda J, Whitmarsh AJ, Cavanagh J, Sharma M, Davis RJ. The JIP group of mitogen-activated protein kinase scaffold proteins. Mol Cell Biol 1999 19:7245-7254[Abstract/Free Full Text]
  56. Stockinger W, Brandes C, Fasching D, Hermann M, Gotthardt M, Herz J, Schneider WJ, Nimpf J. The reelin receptor ApoER2 recruits JNK-interacting proteins-1 and -2. J Biol Chem 2000 275:25625-25632[Abstract/Free Full Text]
  57. Zerbinatti CV, Dyer CA. Apolipoprotein E peptide stimulation of rat ovarian theca cell androgen synthesis is mediated by members of the low density lipoprotein receptor superfamily. Biol Reprod 1999 61:665-672[Abstract/Free Full Text]
  58. LaVoie HA, Garmey JC, Day RN, Veldhuis JD. Concerted regulation of low density lipoprotein receptor gene expression by follicle-stimulating hormone and insulin-like growth factor I in porcine granulosa cells: promoter activation, messenger ribonucleic acid stability, and sterol feedback. Endocrinology 1999 140:178-186[Abstract/Free Full Text]
  59. Song L, Fricker LD. Purification and characterization of carboxypeptidase D, a novel carboxypeptidase E-like enzyme, from bovine pituitary. J Biol Chem 1995 270:25007-25013[Abstract/Free Full Text]
  60. Song L, Fricker LD. Tissue distribution and characterization of soluble and membrane-bound forms of metallocarboxypeptidase D. J Biol Chem 1996 271:28884-28889[Abstract/Free Full Text]
  61. Song L, Fricker LD. Cloning and expression of human carboxypeptidase Z, a novel metallocarboxypeptidase. J Biol Chem 1997 272:10543-10550[Abstract/Free Full Text]
  62. Tan F, Rehli M, Krause SW, Skidgel RA. Sequence of human carboxypeptidase D reveals it to be a member of the regulatory carboxypeptidase family with three tandem active site domains. Biochem J 1997 327:81-87
  63. Ishikawa T, Murakami K, Kido Y, Ohnishi S, Yazaki Y, Harada F, Kuroki K. Cloning, functional expression, and chromosomal localization of the human and mouse gp180-carboxypeptidase D-like enzyme. Gene 1998 215:361-370[CrossRef][Medline]
  64. Varlamov O, Eng FJ, Novikova EG, Fricker LD. Localization of metallocarboxypeptidase D in AtT-20 cells. Potential role in prohormone processing. J Biol Chem 1999 274:14759-14767[Abstract/Free Full Text]
  65. Varlamov O, Fricker LD. Intracellular trafficking of metallocarboxypeptidase D in AtT-20 cells: Localization to the trans-Golgi network and recycling from the cell surface. J Cell Sci 1998 111:877-885[Abstract]
  66. Eng FJ, Varlamov O, Fricker LD. Sequences within the cytoplasmic domain of gp180/carboxypeptidase D mediate localization to the trans-Golgi network. Mol Biol Cell 1999 10:35-46[Abstract/Free Full Text]
  67. Kalinina E, Varlamov O, Fricker LD. Analysis of the carboxypeptidase D cytoplasmic domain: Implications in intracellular trafficking. J Cell Biochem 2002 85:101-111[CrossRef][Medline]
  68. Van Hemert MJ, Steensma HY, van Heusden GP. 2001. 14-3-3 Proteins: Key regulators of cell division, signalling and apoptosis. Bioessays 2001 23:936-946[CrossRef][Medline]
  69. Craparo A, Freund R, Gustafson TA. 14-3-3 (Epsilon) interacts with the insulin-like growth factor I receptor and insulin receptor substrate I in a phosphoserine-dependent manner. J Biol Chem 1997 272:11663-11669[Abstract/Free Full Text]
  70. Gong JG, McBride D, Bramley TA, Webb R. Effects of recombinant bovine somatotrophin, insulin-like growth factor-I and insulin on bovine granulosa cell steroidogenesis in vitro. J Endocrinol 1994 143:157-164[Abstract/Free Full Text]
  71. Glister C, Tannetta DS, Groome NP, Knight PG. Interactions between follicle-stimulating hormone and growth factors in modulating secretion and inhibin-related peptides by non-luteinized bovine granulosa cells. Biol Reprod 2001 65:1020-1028[Abstract/Free Full Text]
  72. Perks CM, Peters AR, Wathes DC. Follicular and luteal expression of insulin-like growth factors I and II and the type 1 IGF receptor in the bovine ovary. J Reprod Fertil 1999 116:157-165[Abstract/Free Full Text]
  73. Armstrong DG, Gutierrez CG, Baxter G, Glazyrin AL, Mann GE, Woad KJ, Hogg CO, Webb R. Expression of mRNA encoding IGF-I, IGF-II and type 1 IGF receptor in bovine ovarian follicles. J Endocrinol 2000 165:101-113[Abstract]
  74. Fujita T, Uchida K, Maruyama N. Purification of senescence marker protein-30 (SMP30) and its androgen-independent decrease with age in the rat liver. Biochim Biophys Acta 1992 1116:122-128[Medline]
  75. Shimokawa N, Yamaguchi M. Expression of hepatic calcium-binding protein regucalcin mRNA is mediated trough Ca2+/calmodulin in rat liver. FEBS Lett 1993 316:79-84[CrossRef][Medline]
  76. Ishigami A, Fujita T, Handa S, Shirasawa T, Koseki H, Kitamura T, Enomoto N, Sato N, Shimosawa T, Maruyama N. Senescence marker protein-30 knockout mouse liver is highly susceptible to tumor necrosis factor-alpha- and Fas-mediated apoptosis. Am J Pathol 2002 161:1273-1281[Abstract/Free Full Text]
  77. Fujita T, Shirasawa T, Uchida K, Maruyama N. Gene regulation of senescence marker protein-30 (SMP30): Coordinated up-regulation with tissue maturation and gradual down-regulation with age. Mech Ageing Dev 1996 87:219-229[CrossRef][Medline]
  78. Yamaguchi M. A Novel Ca(2+)-binding protein regucalcin and calcium inhibition; regulatory role in liver cell function. In: Kohama K (ed.), Calcium Inhibition. Tokyo, Japan and Boca Raton, FL: Sci Press and CRC Press; 1992:19–41
  79. Fujita T, Inoue H, Kitamura T, Sato N, Shimosawa T, Maruyama N. Senescence marker protein-30 (SMP30) rescues cell death by enhancing plasma membrane Ca(2+)-pumping activity in Hep G2 cells. Biochem Biophys Res Commun 1998 250:374-380[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
M. Assidi, I. Dufort, A. Ali, M. Hamel, O. Algriany, S. Dielemann, and M.-A. Sirard
Identification of Potential Markers of Oocyte Competence Expressed in Bovine Cumulus Cells Matured with Follicle-Stimulating Hormone and/or Phorbol Myristate Acetate In Vitro
Biol Reprod, August 1, 2008; 79(2): 209 - 222.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M Mihm, P J Baker, L M Fleming, A M Monteiro, and P J O'Shaughnessy
Differentiation of the bovine dominant follicle from the cohort upregulates mRNA expression for new tissue development genes
Reproduction, February 1, 2008; 135(2): 253 - 265.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T. Fayad, R. Lefebvre, J. Nimpf, D. W. Silversides, and J. G. Lussier
Low-Density Lipoprotein Receptor-Related Protein 8 (LRP8) Is Upregulated in Granulosa Cells of Bovine Dominant Follicle: Molecular Characterization and Spatio-Temporal Expression Studies
Biol Reprod, March 1, 2007; 76(3): 466 - 475.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
S. Azhar, S. Medicherla, W.-J. Shen, Y. Fujioka, L. G. Fong, E. Reaven, and A. D. Cooper
LDL and cAMP cooperate to regulate the functional expression of the LRP in rat ovarian granulosa cells
J. Lipid Res., November 1, 2006; 47(11): 2538 - 2550.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M A Beg and O J Ginther
Follicle selection in cattle and horses: role of intrafollicular factors.
Reproduction, September 1, 2006; 132(3): 365 - 377.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. N. Diouf, K. Sayasith, R. Lefebvre, D. W. Silversides, J. Sirois, and J. G. Lussier
Expression of Phospholipase A2 Group IVA (PLA2G4A) Is Upregulated by Human Chorionic Gonadotropin in Bovine Granulosa Cells of Ovulatory Follicles
Biol Reprod, June 1, 2006; 74(6): 1096 - 1103.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
A Hourvitz, E Gershon, J D Hennebold, S Elizur, E Maman, C Brendle, E Y Adashi, and N Dekel
Ovulation-selective genes: the generation and characterization of an ovulatory-selective cDNA library.
J. Endocrinol., March 1, 2006; 188(3): 531 - 548.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M. Cao, J. Buratini Jr, J. G Lussier, P. D Carriere, and C. A Price
Expression of protease nexin-1 and plasminogen activators during follicular growth and the periovulatory period in cattle
Reproduction, January 1, 2006; 131(1): 125 - 137.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
K. Ndiaye, T. Fayad, D. W. Silversides, J. Sirois, and J. G. Lussier
Identification of Downregulated Messenger RNAs in Bovine Granulosa Cells of Dominant Follicles Following Stimulation with Human Chorionic Gonadotropin
Biol Reprod, August 1, 2005; 73(2): 324 - 333.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J. Lefebvre-Lavoie, J. G. Lussier, and C. L. Theoret
Profiling of differentially expressed genes in wound margin biopsies of horses using suppression subtractive hybridization
Physiol Genomics, July 14, 2005; 22(2): 157 - 170.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. Boyer, J. G. Lussier, A. H. Sinclair, P. J. McClive, and D. W. Silversides
Pre-Sertoli Specific Gene Expression Profiling Reveals Differential Expression of Ppt1 and Brd3 Genes Within the Mouse Genital Ridge at the Time of Sex Determination
Biol Reprod, September 1, 2004; 71(3): 820 - 827.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. Cao, M. Sahmi, J. G. Lussier, and C. A. Price
Plasminogen Activator and Serine Protease Inhibitor-E2 (Protease Nexin-1) Expression by Bovine Granulosa Cells In Vitro
Biol Reprod, September 1, 2004; 71(3): 887 - 893.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
J. D. Hennebold
Characterization of the ovarian transcriptome through the use of differential analysis of gene expression methodologies
Hum. Reprod. Update, May 1, 2004; 10(3): 227 - 239.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/2/523    most recent
biolreprod.103.021709v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.
Agricola
Right arrow Articles by Fayad, T.
Right arrow Articles by Lussier, J. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS