Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print December 10, 2003.
Biol Reprod 2003, 10.1095/biolreprod.103.022665
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/4/1106    most recent
biolreprod.103.022665v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Agricola
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
BIOLOGY OF REPRODUCTION 70, 1106–1113 (2004)
DOI: 10.1095/biolreprod.103.022665
© 2004 by the Society for the Study of Reproduction, Inc.

Testis

Expression of Estrogen Receptors {alpha} and ß in the Fetal Baboon Testisand Epididymis1

Eugene D. Albrecht2,3, Reinhart B. Billiar4, Graham W. Aberdeen3, Jeffery S. Babischkin3, and Gerald J. Pepe4

Departments of Obstetrics, Gynecology, Reproductive Sciences, and Physiology,3 Center for Studies in Reproduction, University of Maryland School of Medicine, Baltimore, Maryland 21201 Department of Physiological Sciences,4 Eastern Virginia Medical School, Norfolk, Virginia 23501


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although studies in transgenic mice suggest that estrogen is important for development of the testis, very little is known about the potential role of estrogen in maturation of the primate fetal testis. Therefore, as a first step to determine whether estrogen regulates maturation of the fetal primate testis, we used immunocytochemistry to determine estrogen receptor (ER) {alpha} and ß expression in the fetal baboon testis. Second, we established methods to quantify ERß mRNA levels by competitive reverse transcription-polymerase chain reaction in Sertoli cells isolated by laser capture microdissection (LCM) from the fetal baboon testis. ERß protein expression was abundant in the nuclei of Sertoli, peritubular, and interstitial cells in baboon fetuses at mid (Day 100) and late (Day 165) gestation (term is 184 days). ERß mRNA level was 0.03 attomole/femtomole 18S rRNA in Sertoli cell nuclei and associated cytoplasm isolated by LCM. ER{alpha} was expressed in low level in seminiferous tubules and in moderate level in peritubular cells on Day 165. Germ cells expressed very little ER{alpha} or ERß protein, whereas the baboon fetal epididymis exhibited extensive ER{alpha} and ERß immunostaining at mid- and late gestation. In contrast to the robust expression of ERß, androgen receptor protein was not demonstrable within the cells of the seminiferous cords but was abundantly expressed in epididymal epithelial cells of the fetal baboon. In summary, the results of this study show that the fetal baboon testis and epididymis expressed the ER{alpha} and ERß, and we suggest that our nonhuman primate baboon model can be used to study the potential role of estrogen on maturation of the fetal testis.

estradiol receptor, male reproductive tract, testis


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have recently shown that the baboon fetal ovary expressed the estrogen receptor (ER) {alpha} and ß [1] and that estrogen regulated primate fetal ovarian folliculogenesis [2]. The possibility that estrogen might also act directly on the male reproductive system became apparent when ER was shown in the testis and epididymis of the rat [3, 4], mouse [5], and macaque [6]. Subsequently, ER{alpha} was shown in Leydig cells and epididymis of the adult rat and mouse [7–9] and germ and Sertoli cells of the adult human [10]. ERß has been detected in Sertoli cells and germ cells as well as efferent ductules and epididymis of the adult rat, mouse [8, 9, 11, 12], human, and nonhuman primate [13–15]. Because ER{alpha} and ERß are also expressed in Sertoli, germ, and Leydig cells of the human fetal and adult testis and epididymis [15–17], it has been suggested that estrogen may also be important for the development and function of the fetal testis and efferent ductule system [18, 19]. Consistent with this proposal, ER{alpha}-null male mice exhibited abnormal testicular and epididymal morphology and decreased sperm motility and fertility [18, 20, 21]. Although abnormal sperm motility and infertility have been reported in the few cases of ER-null mutation identified in men [22], it is not known whether the defects in reproductive development and function shown in estrogen-deficient mice are demonstrable in the human and nonhuman primate.

As a first step to conduct in vivo experiments to determine whether estrogen regulates development and function of the primate fetal testis, efferent ductule system, or both, in the present study we used immunocytochemistry to determine whether ER{alpha} and ERß were expressed in the baboon fetal testis and epididymis at mid- and late gestation. Moreover, to design studies to determine whether estrogen regulates cell-specific expression of molecules involved in development and function of the fetal primate testis, we established methods to isolate Sertoli cells from within seminiferous cords of the fetal baboon testis by laser capture microdissection (LCM) and developed a highly sensitive competitive reverse transcription (RT)-polymerase chain reaction (PCR) assay to simultaneously quantify ERß mRNA and constitutively expressed 18S rRNA in Sertoli cells.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Female baboons (Papio anubis) weighing 10–15 kg were housed individually in stainless steel cages in air-conditioned quarters and fed commercial primate chow and fresh fruit daily and given water ad libitum. Females were paired with males for 5 days at the anticipated time of ovulation, and pregnancy was confirmed by palpation and ultrasonography [23]. Ultrasonography was also used to identify male fetuses. On Days 100 (n = 6) and 165 (n = 7) of gestation (term = Day 184), baboons were anesthetized with isoflurane, the placenta and fetus were delivered by cesarean delivery, and the fetus was killed with an overdose of sodium pentobarbital. The fetal testis and epididymis were removed and either fixed in 10% buffered formalin for immunocytochemistry, snap frozen, and stored in liquid nitrogen for RT-PCR of ER{alpha} and ERß in whole testis tissue or embedded in cryomolds filled with OCT medium (Miles, Elkhart, IN), frozen on dry ice, and stored at -80°C for LCM of cells and competitive RT-PCR of ERß. Endometrium as an ER-positive tissue was also collected from adult baboons in the proliferative phase, as judged by menstrual cycle history and daily examination of perineal turgescence. Baboons were cared for and used strictly in accordance with U.S. Department of Agriculture regulations and the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Publication 85-23, 1985). The experimental protocol employed in this study was approved by the Institutional Animal Care and Use Committee of the University of Maryland School of Medicine.

Histology and Immunocytochemistry

Fetal testicular and epididymal histology and immunocytochemical detection of ER{alpha}, ERß, androgen receptor (AR), {alpha}-inhibin, and {Delta}5-3ß-hydroxysteroid dehydrogenase (3ß-HSD) were determined essentially as described previously by our laboratories [1, 24–26]. Briefly, sections of paraffin-embedded fetal testis and epididymis were mounted onto slides and endogenous peroxidase was blocked with H2O2. Except for analysis of {alpha}-inhibin and 3ß-HSD, slides were microwaved in 10 mM sodium citrate buffer for 15–20 min. All sections were preblocked with 5% normal goat serum (NGS). Sections were incubated 48 h (4°C) with a mouse monoclonal NCL-ER6 F11 antibody to the human ER{alpha} (Vector Laboratories, Burlingame, CA) diluted 1:40 in 5% NGS-PBS, chicken polyclonal ERß 503 immunoglobulin (Ig) Y antibody to the human ERß protein (supplied by Dr. Jan-Åke Gustafsson, Karolinska Institute, Sweden) diluted 1:1000 in NGS, monoclonal antibody to AR (NCL-AR-318; Nova Castra Laboratories, Newcastle Upon Tyne, UK) diluted 1:50 in NGS, mouse monoclonal antibody to the human {alpha}-subunit of inhibin (supplied by Dr. Nigel Groome, Oxford Brookes University, Oxford, UK) diluted to 5 µg/ml NGS, or rabbit polyclonal antibody to human 3ß-HSD (supplied by Dr. Ian Mason, University of Edinburgh, Scotland) diluted 1:5000 in NGS. Tissue sections were then washed in PBS; incubated with biotinylated goat anti-mouse, anti-chicken, or anti-rabbit IgG (Vector) and then with the VectaStain Elite kit (Vector); and stained with diaminobenzidine-imidazole-H2O2. Tissue sections were counterstained with Gill hematoxylin and examined by light microscopy. Our previous studies [1, 24–26] showed that ER{alpha}, {alpha}-inhibin, and 3ß-HSD were not detected in sections of fetal and adult baboon ovaries or adrenal glands incubated with primary antibodies preabsorbed with human recombinant or immunizing peptides. Specificity for the ERß antibody was previously confirmed in studies demonstrating an absence of nuclear signal in sections of rodent and human tissues incubated with antibody preabsorbed with excess human ERß protein and an inability of the antibody to detect ER{alpha} protein on Western blot [27].

LCM of Sertoli Cells

Serial 8-µm sections of the fetal testis were cut on a cryostat at -20°C and mounted onto glass slides at room temperature. Sections were fixed in 70% and 95% ethanol, immersed in eosin for 10 sec, dehydrated in 100% ethanol, and incubated 5 min x 3 in fresh xylene. Slides were air dried and transferred to a desiccator containing silica gel at room temperature. An Arcturus PixCell II LCM system (Arcturus Engineering, Inc., Mountain View, CA) was employed to capture the nuclei and immediately surrounding cytoplasm of Sertoli cells from randomly chosen seminiferous cords. Optimal conditions for LCM capture of Sertoli cells included a laser power of 40 mW, a duration of 1.5–2.5 msec, and a laser spot size of 7.5 µm. The LCM cap with captured cells was fitted to an Eppendorf tube containing lysis buffer (RNeasy; Qiagen, Valencia, CA) and incubated at 42°C for 30 min. At completion of the LCM process, samples were stored in lysate buffer overnight at -80°C and RNA extracted within 72 h.

RT-PCR of ER{alpha} and ERß

RNA extraction Total RNA was extracted from whole testis or endometrium according to the modified method of Chirgwin et al. [28] and from LCM captured Sertoli cells by Nonidet P-40-guanidine isothiocyanate extraction/silica gel spin column centrifugation (RNeasy; Qiagen). The samples were then sodium acetate/ethanol precipitated, centrifuged, and resuspended in 15 µl RNase-free water. Because the amount of total RNA obtained from Sertoli cells isolated by LCM was low, 18S rRNA was also quantified by competitive RT-PCR to normalize ERß levels.

Primers Oligonucleotide primers for ER{alpha}, ERß, and 18S rRNA were synthesized by Invitrogen Life Technologies, Inc. (Carlsbad, CA) and based on the human cDNA sequences described by Green et al. [29], Ogawa et al. [30], and Torczynski et al. [31], respectively: ER{alpha} (primer 1: downstream, 5'-TTC CAG AGA CTT CAG GGT GC-3' [position 1642–1623] and primer 2: upstream, 5'-GAT CCT ACC AGA CCC TTC AG-3' [position 1226–1245]); ERß (primer 3: downstream, 5'-GAAGTGAGCATCCCTCTTTGAACCTGGACCAGTATAAGGTGTGTTCTAGCGATC-3' [positions 542–509 and 449–430]); primer 4 (upstream, 5'-GCGGGGAGAGGAGTTCCCAGCAATGTCACTAACTTGG-3' [T7 polymerase sequence underlined plus three extra nucleotides 5', 10 extra nucleotides 3', and position 271–294]); primer 5 (downstream, 5'-CTCTTTGAACCTGGACCAGTA-3' [position 529–509]); primer 6 (upstream, 5'- TTCCCAGCAATGTCACTAACT-3' [position 271–291]); 18S rRNA (primer 7: downstream, 5' CGGCGTAGGGTAGGC ACACGCTGAGCCAGTCAGTGTAGCGCGCGTGCAGCCCCGGACATCTAAGGGCATCAC-3' [position 1667–1595]); primer 8 (upstream, 5'-GCGGCGGGGAGAGGAGTCAAGAACGAAAGTCGGAGGGCTTCCGGGAAACCAAAGTC-3' [T7 polymerase sequence underlined plus six extra nucleotides 5', 10 extra nucleotides 3', and positions 1126–1145 and 1235–1254]); primer 9 (downstream, 5'-GGACATCTAAGGGCATCACA-3' [position 1614–1595]); and primer 10 (upstream, 5'-TCAAGAACGAAAGTCGGAGG-3' [position 1126–1145]).

RNA competitor construction Homologous RNA competitive reference standards (CRSs) that shared the same primer binding sites but contained a shortened internal sequence with respect to the endogenous target RNA for ERß and 18S rRNA were prepared using the RT-PCR competitor construction kit (Ambion, Inc., Austin, TX). Total RNA from baboon testis (ERß) or endometrium (18S rRNA) was reverse transcribed and the RT mixture added to separate PCR reaction mixtures containing 0.2 mM each of deoxynucleotides, 1.25 U cloned Thermus aquaticus DNA polymerase (Amplitaq; Perkin-Elmer Corp./Cetus, Norwalk, CT) and 10 pmol of the respective paired primers (3, 4 and 7, 8) to generate cDNA templates for ERß and 18S rRNA. PCR was performed in a programmable thermal cycler (MJ Research, Inc., Cambridge, MA) for 40 (ERß) and 20 (18S rRNA) sequential cycles, respectively, at 94°C for 1 min, 55°C (ERß) or 60°C (18S rRNA) for 1 min and 72°C for 2 min. PCR products were fractionated in 2% agarose gel and gel purified (Qiagen). The CRSs were synthesized from 150 ng of each respective cDNA template using the MEGAscript T7 in vitro transcription kit (Ambion, Inc.).

Competitive RT-PCR ERß and 18S rRNA mRNA levels were simultaneously quantified by competitive RT-PCR [32, 33]. A constant amount of RNA (6 µl of LCM sample) was added to an RT mixture containing 2-fold serial dilutions of both ERß-CRS (6.25–0.10 attomoles) and 18S rRNA-CRS (40.0–2.56 femtomoles). Upon completion of the RT, 5 µl and 2 µl of the RT mixture for ERß and 18S rRNA, respectively, were added to separate PCR reaction mixtures (45 and 48 µl, respectively) containing 10 pmol of the respective paired primers (5, 6 and 9, 10) for ERß and 18S rRNA. ERß total endometrial, ERß LCM, and 18S rRNA LCM samples were amplified for 35, 36, and 23 sequential cycles, respectively; PCR products were gel fractionated, visualized with ethidium bromide, and photographed.

Negatives were scanned and the intensity of amplified products was represented as the relative area under each product band. A correction factor [34] was used to account for the relative size difference between the target and the CRS cDNAs. The logarithm (log) of the ratio of CRS to target area was plotted as a function of the log concentration of ERß or 18S rRNA CRS added to each PCR reaction. The concentration of ERß or 18S rRNA target mRNA was determined at which the ratio of the log of CRS and target area was equal to 0 (i.e., the equivalence point).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Fetal Testis Histology

Fetal testis weight (mean ± SEM) increased (P < 0.01) 4-fold between Days 100 and 165 of gestation (Table 1). A comparable increase in body weight also occurred during this period and thus testis:body weight ratio was similar at mid- and late gestation. At mid- (Fig. 1A) and late (Fig. 1B) gestation, the seminiferous cords of the baboon testis were comprised of numerous Sertoli cells with highly basophilic oval nuclei and several randomly situated germ cells or spermatogonia with prominent nuclei and ample highly eosinophilic cytoplasm. The seminiferous cords were encircled by peritubular cells and pockets of interstitial cells containing Leydig cells (see below).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Fetal body and organ weights in baboons.*



View larger version (151K):
[in this window]
[in a new window]
  		PLATE 1. Figures 1 and 2.FIG. 1. Histology of hematoxylin and eosin-stained fetal baboon testis on Days 100 (A) and 165 (B) of gestation (term = 184 days). GC, Germ cell nucleus; SC, Sertoli cell nucleus; PC, peritubular cell nucleus. Scale bar = 100 µm.FIG. 2. Immunocytochemical localization (brown precipitate) of ERß (A and C) and ER{alpha} (B and D) in the fetal baboon testis on Days 100 (A and B) and 165 (C and D) of gestation. GC, Germ cell nucleus; SC, Sertoli cell nucleus; PC, peritubular cell nucleus; IC, interstitial cell nucleus. Scale bar = 40 µm

Immunocytochemistry

ER{alpha} and ß ERß protein was abundantly expressed in the nuclei of Sertoli, peritubular, and interstitial cells in baboon fetuses on Day 100 (Fig. 2A) and Day 165 (Fig. 2C) of gestation. Moreover, the level of ERß expression appeared to be greater in all cells at late compared with midgestation. In contrast, ER{alpha} protein was only minimally expressed in the fetal testis on Day 100 (Fig. 2B) and present in low level in Sertoli cells within the seminiferous cords and in moderate level in peritubular and interstitial cells on Day 165 (Fig. 2D). Germ cells displayed very little expression of ER{alpha} and ERß protein as assessed by immunocytochemistry.

The epithelial nuclei of the epididymis of the baboon fetus exhibited extensive ER{alpha} (Fig. 3A) and ERß (Fig. 3B) immunocytochemical staining on Days 100 (not shown) and 165 of gestation.



View larger version (171K):
[in this window]
[in a new window]
  		PLATE 2. Figures 3, 4, and 5.FIG. 3. Immunocytochemical localization (brown precipitate) of ER{alpha} (A) and ERß (B) in the fetal baboon epididymis on Day 165 of gestation. Scale bar = 100 µm.FIG. 4. Immunocytochemical expression of AR in the fetal baboon testis on Days 100 (A) and 165 (B) of gestation and in fetal baboon epididymis on Day 165 of gestation (C). PC, Peritubular cell nucleus; EC, epithelial cell nucleus. Scale bar = 40 µm (A and B) and 100 µm (C).FIG. 5. Immunocytochemical staining for {alpha}-inhibin in seminiferous cords (A) and 3ß-HSD in Leydig cells (LC; B) of fetal baboon testis on Day 165 of gestation. Scale bar = 100 µm

Androgen receptor In contrast to the robust expression of ERß in the fetal testis, the AR was not demonstrable by immunocytochemistry within the cells of the seminiferous cords of baboon fetal testis either on Day 100 (Fig. 4A) or Day 165 (Fig. 4B) of gestation. However, AR protein was present in relatively low levels in peritubular cells of the fetal testis (Fig. 4B) and in high levels in epithelial cells of the fetal baboon epididymis (Fig. 4C).

{alpha} Inhibin and 3ß-HSD Sertoli cells of the baboon fetus on Day 100 (not shown) and Day 165 (Fig. 5A) of gestation exhibited intense immunocytochemical staining for the {alpha}-subunit of inhibin. The fetal baboon testicular Leydig cells also expressed the enzyme 3ß-HSD at both mid- (not shown) and late (Fig. 5B) gestation.

LCM and RT-PCR of ER{alpha} and ERß mRNA

LCM of Sertoli cells Figure 6A shows a cross-section of a seminiferous cord with at least two germ cells and numerous nuclei of Sertoli cells before LCM isolation. Figure 6B shows the same seminiferous cord after capture of the nuclei and immediately surrounding cytoplasm of three Sertoli cells. Figure 6C shows the LCM cap containing these Sertoli cells, which could then be used for mRNA analysis. Thus, a homogeneous population of Sertoli cells, devoid of germ cells or peritubular cells, can be obtained by LCM to quantify mRNA levels.



View larger version (70K):
[in this window]
[in a new window]
  		FIG. 6. Photomicrograph of hematoxylin-eosin histology illustrating LCM isolation of Sertoli cells (SC) from seminiferous cord of fetal baboon testis on Day 165 of gestation. A) Seminiferous cord showing basophilic nuclei of Sertoli cells (SC) and eosinophilic cytoplasm of germ cells (GC) before LCM. B) Remaining cells after removal of nuclei and immediately associated cytoplasm of three Sertoli cells (encircled by dashed line in A). C) Sertoli cell nuclei/cytoplasm collected on LCM cap. Scale bar = 100 µm

RT-PCR of ERß and ER{alpha} As shown in Figure 7, distinct 259-bp ERß and 417-bp ER{alpha} products were generated by PCR of RNA obtained from the baboon endometrium (lane 1), whole (i.e., mixed cells) testis (lane 2), and Sertoli cells isolated by LCM (lane 3). Competitive RT-PCR was then performed to quantify steady-state levels of ERß mRNA in Sertoli cells isolated by LCM from the fetal baboon testis. The 259-bp ERß target and 200-bp ERß CRS products generated by PCR are shown in Figure 8A. PCR products were not obtained when RNA or RT enzyme were omitted from the reaction. The slope of the log of CRS:target areas plotted as a function of log of increasing CRS concentrations is shown in Figure 3C. The correlation coefficient (r2) determined by linear regression of this plot was 0.99 (P < 0.01), indicating that PCR amplification was linear. The level of ERß mRNA in LCM-isolated Sertoli cells, normalized to the level of 18S rRNA simultaneously quantified by competitive RT-PCR in these cells (Fig. 8B), was 0.03 attomole/femtomole 18S rRNA.



View larger version (122K):
[in this window]
[in a new window]
  		FIG. 7. Expression of ERß and ER{alpha} mRNAs determined by RT-PCR in adult baboon endometrium (lane 1) and whole testis tissue (lane 2) and Sertoli cells isolated by LCM from seminiferous cords (lane 3) of the baboon fetus on Day 165 of gestation. The 259-bp ERß and 417-bp ER{alpha} mRNA products are shown separated on ethidium bromide-2% agarose gels (M, standard RNA marker ladder)



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 8. Competitive RT-PCR of ERß mRNA in Sertoli cells isolated by LCM from one fetal baboon testis. A) ERß 259-bp target and 200-bp CRS (serial dilution of 6.25–0.10 attomoles) products separated on agarose gel. B) The 18S rRNA 489-target and 400-bp CRS (serial dilution of 40.00–2.56 femtomoles) products separated on agarose gel. C) Log of ratio of ERß CRS/target analyzed by densitometry and plotted as function of log of CRS added to PCR


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The present study shows that the fetal baboon testis and epididymis expressed ER{alpha} and ERß mRNA and protein in the second half of baboon gestation. ERß protein was expressed in relatively high levels in Sertoli cells of the seminiferous cords, whereas the peritubular and interstitial cells and epididymis expressed both ER{alpha} and ERß. Consistent with these observations in fetal baboons of the present study, in the human and rodent fetal testis, ERß was expressed primarily by cells within the seminiferous cords [16, 17, 35], whereas ER{alpha} was absent from the seminiferous cords [35, 36] but abundantly expressed in cells lying outside of the seminiferous cords and in the efferent ductules and epididymis [36–38]. It is well established that placental estrogen production and secretion into the human and baboon fetus increases with advancing gestation [39]. Moreover, the testis appears to be a site of estrogen synthesis, and thus aromatase activity [40, 41] and P-450 aromatase expression [42–44] have been shown in Sertoli and Leydig cells of immature and adult rodents and humans. Consequently, based on the localization patterns of the ER{alpha} and ERß, exposure of the fetal testis to estrogen, and capacity for local aromatization of androgen to estrogen, it has been suggested that estrogen is important for development and function of the fetal testis and excurrent duct system [18, 19]. In support of this suggestion, male mice with targeted disruption of the P-450 aromatase gene exhibited a decline in sperm numbers and infertility [45], whereas ER{alpha} knockout mice exhibited altered morphology of the testis, efferent ductules, and epididymis, reduced sperm motility, and infertility [18, 20, 21, 46, 47]. In the adult human testis, estrogen acted as a cell survival factor by preventing apoptosis in vitro in germ cells, an effect reversed by ER antagonist ICI 182, 780 [48]. Moreover, azoospermia and infertility have been observed in men with null mutation of the P-450 aromatase gene [22].

The results of the present study also showed that Sertoli cell nuclei and associated cytoplasm could be isolated by LCM from the fetal baboon testis and ERß mRNA quantified by competitive RT-PCR in these cells. The combination of LCM and competitive RT-PCR provides a significant technological advance to assess expression of regulatory molecules by specific cells of the heterogenous testis. Thus, quantification of factors in Sertoli or other cells isolated by LCM from the testis of fetal baboons in which estrogen synthesis and levels are altered during various stages of gestation [49] will allow us in future studies to investigate the role of estrogen in regulating cell-specific expression of factors potentially important in maturation of the fetal testis.

The current study further showed that AR protein was not expressed within Sertoli or germ cells of the fetal baboon testis and was primarily localized to epithelial cells of the epididymis and peritubular cells. The AR also was only detected in peritubular cells and not within seminiferous cords of the human fetal testis [50]. In contrast, AR has been localized within Sertoli cells of the adult human testis [51], in which this receptor may mediate a tropic action of androgen on Sertoli cell function and consequently indirectly on spermatogenesis [52, 53]. The absence of AR in the fetal baboon Sertoli cells and germ cells suggests that autocrine/paracrine factors other than androgen are involved in regulating Sertoli cell and germ cell maturation and function at this time in prenatal development. Indeed, AR-knockout mice do not display seminiferous tubule dysfunction and may or may not exhibit alterations in spermatogenesis as observed in ER{alpha}-knockout mice [19, for review]. FSH and LH interact to regulate spermatogenesis postnatally [53, 54]; however, factors in addition to the latter gonadotropins (e.g., estrogen) may be important in maturation of the testis in utero.

The 3ß-HSD enzyme was expressed in Leydig cells and {alpha}-inhibin in Sertoli cells of the fetal baboon testis at mid- and late gestation. We have previously shown [55] that the fetal baboon testis near term has the capacity to convert C21-steroid precursors such as pregnenolone to C19-steroids (e.g., dehydroepiandrosterone) and to convert the latter {Delta}5-hydroxysteroids to {Delta}4-ketosteroids (e.g., androstenedione and testosterone). Thus, the fetal baboon testis has the steroidogenic capacity to form androgens, which can be aromatized either locally or within the placenta to estrogen. Estrogen acting via the ER within Sertoli and/or other cells may then regulate in a paracrine/autocrine manner testis maturation.

In summary, the present study shows that the fetal baboon testis and epididymis expressed ER{alpha} and ERß during the second half of gestation. Moreover, Sertoli cells were isolated by LCM from the fetal baboon testis and ERß mRNA quantified by competitive RT-PCR in these cells. These observations indicate that our nonhuman primate baboon model can be used to study the potential role of estrogen on maturation of, and regulation of cell-specific expression of molecules in, the fetal primate testis.


   ACKNOWLEDGMENTS
 
The secretarial assistance of Mrs. Wanda James with the manuscript is greatly appreciated. The technical assistance of Donna Suresch with the immunocytochemistry and LCM is sincerely appreciated.


   FOOTNOTES
 
1 This work was supported by National Institutes of Health Grant U54 HD 36207 as part of the NICHD Specialized Cooperative Centers Program in Reproduction Research. Back

2 Correspondence: Eugene D. Albrecht, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of Maryland School of Medicine, Bressler Research Laboratories, 11-019, 655 West Baltimore St., Baltimore, MD 21201. FAX: 410 706 5747;ealbrech{at}umaryland.edu Back

Received: 28 August 2003.

First decision: 19 September 2003.

Accepted: 25 November 2003.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Pepe GJ, Billiar RB, Leavitt MG, Zachos NC, Gustafsson JA, Albrecht ED. Expression of estrogen receptors {alpha} and ß in the baboon fetal ovary. Biol Reprod 2002 66:1054-1060[Abstract/Free Full Text]
  2. Zachos NC, Billiar RB, Albrecht ED, Pepe GJ. Developmental regulation of baboon fetal ovarian maturation by estrogen. Biol Reprod 2002 67:1148-1156[Abstract/Free Full Text]
  3. Brinkmann AO, Mulder E, Lamers-Stahlhofen GJ, Mechielsen JM, VanDer Molen HJ. An oestradiol receptor in rat testis interstitial tissue. Fed Eur Biochem Soc 1972 26:301-305
  4. Danzo BJ, Wolfe MS, Curry JB. The presence of an estradiol binding component in cytosol from immature rat epididymides. Mol Cell Endocrinol 1977 6:271-279[CrossRef][Medline]
  5. Greco TL, Furlow JD, Duello TM, Gorski J. Immunodetection of estrogen receptors in fetal and neonatal male mouse reproductive tracts. Endocrinology 1992 130:421-429[Abstract]
  6. West NB, Brenner RM. Estrogen receptor in the ductuli efferentes, epididymis, and testis of rhesus and cynomolgus macaques. Biol Reprod 1990 42:533-538[Abstract]
  7. Zhai J, Lanclos KD, Abney TO. Estrogen receptor messenger ribonucleic acid changes during Leydig cell development. Biol Reprod 1996 55:782-788[Abstract]
  8. Hess RA, Gist DH, Bunick D, Lubahn DB, Farrell A, Bahr J, Cooke PS, Greene GL. Estrogen receptor ({alpha} and ß) expression in the excurrent ducts of the adult male rat reproductive tract. J Androl 1997 18:602-611[Abstract/Free Full Text]
  9. Couse JF, Lindzey J, Brandien K, Gustafsson J, Korach KS. Tissue distribution and quantitative analysis of estrogen receptor-{alpha} (ER{alpha}) and estrogen receptor-ß (ERß) messenger ribonucleic acid in the wild-type and ER{alpha}-knockout mouse. Endocrinology 1997 138:4613-4621[Abstract/Free Full Text]
  10. Durkee TJ, Mueller M, Zinaman M. Identification of estrogen receptor protein and messenger ribonucleic acid in human spermatozoa. Am J Obstet Gynecol 1998 178:1288-1297[CrossRef][Medline]
  11. Van Pelt AM, de Rooij DG, van der Burg B, van der Saag PT, Gustafsson JA, Kuiper GG. Ontogeny of estrogen receptor-ß expression in rat testis. Endocrinology 1999 140:478-483[Abstract/Free Full Text]
  12. Rosenfeld CS, Ganjam VK, Taylor JA, Yuan X, Stiehr JR, Hardy MP, Lubahn DB. Transcription and translation of estrogen receptor-ß in the male reproductive tract of estrogen receptor-{alpha} knock-out and wild-type mice. Endocrinology 1998 139:2982-2987[Abstract/Free Full Text]
  13. Pelletier G, El-Alfy M. Immunocytochemical localization of estrogen receptors {alpha} and ß in the human reproductive organs. J Clin Endocrinol Metab 2000 85:4835-4840[Abstract/Free Full Text]
  14. Pelletier G, Luu-The V, Charbonneau A, Labrie F. Cellular localization of estrogen receptor ß messenger ribonucleic acid in cynomolgus monkey reproductive organs. Biol Reprod 1999 61:1249-1255[Abstract/Free Full Text]
  15. Saunders PT, Sharpe RM, Williams K, Macpherson S, Urquart H, Irvine DS, Millar MR. Differential expression of oestrogen receptor {alpha} and ß proteins in the testes and male reproductive system of human and non-human primates. Mol Hum Reprod 2001 7:227-236[Abstract/Free Full Text]
  16. Brandenberger AW, Tee MK, Lee JY, Chao V, Jaffe RB. Tissue distribution of estrogen receptors {alpha} (ER-{alpha}) and ß (ER-ß) mRNA in the midgestational human fetus. J Clin Endocrinol Metab 1997 82:3509-3512[Abstract/Free Full Text]
  17. Takeyama J, Suzuki T, Inoue S, Kaneko C, Nagura H, Harada N, Sasano H. Expression and cellular localization of estrogen receptors {alpha} and ß in the human fetus. J Clin Endocrinol Metab 2001 86:2258-2262[Abstract/Free Full Text]
  18. Hess RA. Oestrogen in fluid transport in efferent ducts of the male reproductive tract. Rev Reprod 2000 5:84-92[Abstract]
  19. O'Donnell L, Robertson KM, Jones ME, Simpson ER. Estrogen and spermatogenesis. Endocr Rev 2001 22:289-318[Abstract/Free Full Text]
  20. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 1993 90:11162-11166[Abstract/Free Full Text]
  21. Couse JE, Mahato D, Eddy EM, Korach KS. Molecular mechanism of estrogen action in the male: insights from the estrogen receptor null mice. Reprod Fertil Dev 2001 13:211-219[CrossRef][Medline]
  22. Grumbach MM, Auchus EJ. Estrogen: consequences and implication of human mutations in synthesis and action. J Clin Endocrinol Metab 1999 84:4677-4694[Abstract/Free Full Text]
  23. Albrecht ED. A role for estrogen in progesterone production during baboon pregnancy. Am J Obstet Gynecol 1980 136:569-574[Medline]
  24. Albrecht ED, Babischkin JS, Davies WA, Leavitt MG, Pepe GJ. Identification and developmental expression of the estrogen receptor {alpha} and ß in the baboon fetal adrenal gland. Endocrinology 1999 140:5953-5961[Abstract/Free Full Text]
  25. Billiar RB, Zachos NC, Burch MG, Albrecht ED, Pepe GJ. Upregulation of {alpha}-inhibin expression in the fetal ovary of estrogen-suppressed baboons is associated with impaired fetal ovarian folliculogenesis. Biol Reprod 2003 68:1989-1996[Abstract/Free Full Text]
  26. Leavitt MG, Albrecht ED, Pepe GJ. Development of the baboon fetal adrenal gland: regulation of the ontogenesis of the definitive and transitional zones by adrenocorticotropin. J Clin Endocrinol Metab 1999 84:3831-3835[Abstract/Free Full Text]
  27. Saji S, Jensen EV, Nilsson S, Rylander T, Warner M, Gustafsson JA. Estrogen receptors {alpha} and ß in the rodent mammary gland. Proc Natl Acad Sci USA 2000 97:337-342[Abstract/Free Full Text]
  28. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979 18:5294-5299[CrossRef][Medline]
  29. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P. Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 1986 320:134-139[CrossRef][Medline]
  30. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M. The complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitro. Biochem Biophys Res Commun 1998 243:122-126[CrossRef][Medline]
  31. Torczynski RM, Fuke M, Bollon AP. Cloning and sequencing of a human 18S ribosomal RNA gene. DNA 1985 4:283-291[Medline]
  32. Riedy MC, Timm EA Jr, Stewart CC. Quantitative RT-PCR for measuring gene expression. Biotechniques 1995 18:70-76[Medline]
  33. Babischkin JS, Pepe GJ, Albrecht ED. Estrogen regulation of placental P-450 cholesterol side-chain cleavage enzyme messenger ribonucleic acid levels and activity during baboon pregnancy. Endocrinology 1997 138:452-459[Abstract/Free Full Text]
  34. Menzo S, Bagnarelli P, Giacca M, Manzin A, Varaldo P, Clementi M. Absolute quantitation of viremia in human immunodeficiency virus infection by competitive reverse transcription and polymerase chain reaction. J Clin Microbiol 1992 267:1752-1757
  35. Gaskell TL, Robinson LLL, Groome NP, Anderson RA, Saunders PTK. Differential expression of two estrogen receptor ß isoforms in the human fetal testis during the second trimester of pregnancy. J Clin Endocrinol Metab 2003 88:424-432[Abstract/Free Full Text]
  36. Fisher JS, Millar MR, Majdic G, Saunders PT, Fraser HM, Sharpe RM. Immunolocalisation of oestrogen receptor-{alpha} within the testis and excurrent ducts of the rat and marmoset monkey from perinatal life to adulthood. J Endocrinol 1997 153:485-495[Abstract]
  37. Nielsen M, Bjornsdottir S, Hoyer PE, Byskov AG. Ontogeny of oestrogen receptor {alpha} in gonads and sex ducts of fetal and newborn mice. J Reprod Fertil 2000 118:195-204[Abstract]
  38. Sar M, Welsch F. Oestrogen receptor {alpha} and ß in rat prostate and epididymis. Andrologia 2000 32:295-301[CrossRef][Medline]
  39. Albrecht ED, Pepe GJ. Placental steroid hormone biosynthesis in primate pregnancy. Endocr Rev 1990 11:124-150[Abstract]
  40. Inkster S, Yue W, Brodie A. Human testicular aromatase: immunocytochemical and biochemical studies. J Clin Endocrinol Metab 1995 80:1941-1947[Abstract]
  41. Papadopoulos V, Carreau S, Szerman-Joly E, Drosdowsky MA, Dehennin L, Scholler R. Rat testis 17 ß-estradiol: identification by gas chromatography-mass spectrometry and age related cellular distribution. J Steroid Biochem 1986 24:1211-1216[CrossRef][Medline]
  42. Weniger JP. Aromatase activity in fetal gonads of mammals. J Dev Physiol 1990 14:303-306[Medline]
  43. Carreau S, Genissel C, Bilinska B, Levallet J. Sources of estrogen in the testis and reproductive tract of the male. Int J Androl 1999 22:211-223[CrossRef][Medline]
  44. Abney TO. The potential roles of estrogens in regulating Leydig cell development function: a review. Steroids 1999 64:610-617[CrossRef][Medline]
  45. Robertson KM, O'Donnell L, Jones ME, Meachem SJ, Boon WC, Fisher CR, Graves KH, McLachlan RI, Simpson ER. Impairment of spermatogenesis in mice lacking a functional aromatase (cyp19) gene. Proc Natl Acad Sci USA 1999 96:7986-7991[Abstract/Free Full Text]
  46. Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC, Lubahn DB, Korach KS. Targeted disruption of the estrogen receptor gene in male mice causes alteration of spermatogenesis and infertility. Endocrinology 1996 137:4796-4805[Abstract]
  47. Mahato D, Goulding EH, Korach KS, Eddy EM. Spermatogenic cells do not require estrogen receptor-{alpha} for development or function. Endocrinology 2000 141:1273-1276[Abstract/Free Full Text]
  48. Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L. Estrogen acts as a germ cell survival factor in the human testis in vitro. J Clin Endocrinol Metab 2000 85:2057-2067[Abstract/Free Full Text]
  49. Albrecht ED, Aberdeen GW, Pepe GJ. A role for estrogen in the maintenance of primate pregnancy. Am J Obstet Gynecol 2000 182:432-438[CrossRef][Medline]
  50. Murray TJ, Fowler PA, Abramovich DR, Haites W, Lea RG. Human fetal testis: second trimester proliferative and steroidogenic capabilities. J Clin Endocrinol Metab 2000 85:4812-4817[Abstract/Free Full Text]
  51. Suárez-Quian CA, Martinez-Garcia F, Nistal M, Regadera J. Androgen receptor distribution in adult human testis. J Clin Endocrinol Metab 1999 84:350-358[Abstract/Free Full Text]
  52. Sar M, Hall SH, Wilson EM, French FS. Androgen regulation of Sertoli cells. In: Russell LD, Griswold MD (eds.), The Sertoli Cell. Clearwater, FL: Cache River Press; 1993: 509–516
  53. McLachlan RI, O'Donnell L, Meachem SJ, Stanton PG, deKretser DM, Pratis K, Robertson DM. Identification of specific sites of hormonal regulation in spermatogenesis in rats, monkeys, and man. Rec Prog Horm Res 2002 57:149-179[Abstract/Free Full Text]
  54. Plant TM, Marshall GR. The functional significance of FSH in spermatogenesis and the control of its secretion in male primates. Endocr Rev 2001 22:764-786[Abstract/Free Full Text]
  55. Redmond AF, Albrecht ED, Pepe GJ. Testosterone production by collagenase-dispersed cells from baboon fetal testis. Biol Reprod 1986 35:372-376[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/4/1106    most recent
biolreprod.103.022665v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.
Agricola
Right arrow Articles by Albrecht, E. D.
Right arrow Articles by Pepe, G. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS