Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print January 14, 2004.
Biol Reprod 2004, 10.1095/biolreprod.103.022624
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/5/1380    most recent
biolreprod.103.022624v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by González-Martínez, D.
Right arrow Articles by Muñoz-Cueto, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by González-Martínez, D.
Right arrow Articles by Muñoz-Cueto, J. A.
Agricola
Right arrow Articles by González-Martínez, D.
Right arrow Articles by Muñoz-Cueto, J. A.
BIOLOGY OF REPRODUCTION 70, 1380–1391 (2004)
DOI: 10.1095/biolreprod.103.022624
© 2004 by the Society for the Study of Reproduction, Inc.

Neuroendocrinology

Cloning and Expression of Gonadotropin-Releasing Hormone Receptor in the Brain and Pituitary of the European Sea Bass: An In Situ Hybridization Study1

David González-Martínez3, Thierry Madigou4, Evaristo Mañanos5, José Miguel Cerdá-Reverter5, Silvia Zanuy5, Olivier Kah4, and José Antonio Muñoz-Cueto2,3

Departamento de Biología,3 Facultad de Ciencias del Mar y Ambientales, Universidad de Cádiz, 11510 Puerto Real, Spain Endocrinologie Moléculaire de la Reproduction,4 UMR CNRS 6026, Campus de Beaulieu,35042 Rennes cedex, France Instituto de Acuicultura Torre de la Sal,5 CSIC 12595, Ribera de Cabanes, Castellón, Spain


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A full-length cDNA encoding a GnRH receptor (GnRH-R) has been obtained from the pituitary of the European sea bass, Dicentrarchus labrax. The complete cDNA is 1814 base pairs (bp) in length and encodes a protein of 416 amino acids. The 5' UTR and 3' UTR are 239 bp and 324 bp in size, respectively. The expression sites of this GnRH-R were studied in the brain and pituitary of sea bass by means of in situ hybridization. A quantitative analysis of the expression of the GnRH-R gene along the reproductive cycle was also performed. The GnRH-R brain expression was especially relevant in the ventral telencephalon and rostral preoptic area. Some GnRH-R messenger-expressing cells were also evident in the dorsal telencephalon, caudal preoptic area, ventral thalamus, and periventricular hypothalamus. A conspicuous and specific GnRH-R expression was detected in the pineal gland. The highest expression of the GnRH-R gene was observed in the proximal pars distalis of the pituitary. This expression was evident in all LH cells and some FSH cells but not in somatotrophs. In the pituitary, the quantitative analysis revealed a higher expression of GnRH-R gene during late vitellogenesis in comparison with maturation, spawning, and postspawning/resting periods. However, in the brain, the highest GnRH-R expression was evident at spawning or postspawning/ resting periods. These results suggest that the expression of this GnRH-R is regulated in a different manner in the brain and the pituitary of sea bass.

central nervous system, gonadotropin-releasing hormone receptor, neuroendocrinology, pituitary, seasonal reproduction


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The decapeptide GnRH plays a major role in controlling the release of gonadotroph [1], but has also been implicated in the stimulation of growth hormone [2] and prolactin [3] secretion. However, increasing evidence suggests that GnRH serves important autocrine/paracrine actions in extrapituitary tissues such as gonad, liver, kidney, placenta, breast, and prostate [4, 5]. In addition, GnRH may also act in the brain to modulate nesting [6] and sexual behavior [7], but the precise sites of GnRH actions in the central nervous system are unknown.

In perciforms, three different GnRH forms are expressed, seabream GnRH (sbGnRH), salmon GnRH (sGnRH) and chicken II GnRH (cGnRH-II)[8]. It is clearly stated that the sbGnRH form represents the main hypophysiotrophic hormone [8, 9], whereas the roles of the two other GnRH forms expressed, sGnRH and cGnRH-II, remain still unknown. A critical step in the elucidation of the precise functions of different GnRH forms in the brain and pituitary is the study of their respective projections and targets. Recently, an immunohistochemical study performed in sea bass, using antibodies against the divergent GnRH-associated peptides of each GnRH precursor, unambiguously revealed the distinct pattern of projections of the three different GnRH systems expressed in this species [10].

The first step in GnRH action is the recognition of the hormone by specific membrane-associated receptors, which belong to the G-protein-coupled receptor family [1]. Since the first cloning of GnRH receptor (GnRH-R) in mouse [11, 12], cDNA encoding the GnRH-R has been characterized in a number of mammalian species [13–17]. The analysis of the primary sequence reveals that GnRH-R is a single polypeptide containing seven hydrophobic transmembrane domains connected by hydrophilic extracellular and intracellular loops [1]. Recently, cDNAs for GnRH-R have been cloned and functionally characterized in different teleosts [18–23]. Emerging data obtained in vertebrates and phylogenetic analyses have suggested the existence of different GnRH-R subtypes with distinct structural and/or pharmacological characteristics, different gene structures and/or tissue distributions [19, 23–28].

The correlation of the pattern of projections of the different GnRH systems with the expression of GnRH receptors could greatly contribute to improving the knowledge of real hormone-receptor interactions and to clarifying the precise functions of multiple GnRH forms in the control of reproduction and other physiological processes. To obtain such information, we have cloned a full-length GnRH-R cDNA and analyzed, using in situ hybridization techniques, the qualitative and quantitative expression of this receptor in the brain and pituitary of the European sea bass along the reproductive cycle.


   MATERIAL AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Animals

European sea bass, Dicentrarchus labrax, specimens from the experimental fish laboratories of the Instituto de Acuicultura de Torre La Sal (CSIC, Castellón, Spain) were kept in running sea water with natural photoperiod and temperature conditions. Twenty-four females were killed along the reproductive cycle, in November 1999 (late vitellogenesis; n = 6), December 1999 (maturation; n = 6), February 2000 (spawning; n = 6), and May 2000 (postspawning/resting; n = 6). All animals were treated in agreement with the European Union regulation concerning the protection of experimental animals.

Cloning of a Full-Length cDNA for a Sea Bass GnRH-R

Total RNA was prepared from pituitaries of vitellogenic females (GSI > 5%) using the TRIzol reagent (Gibco-BRL, Invitrogen, Carlsbad, CA) as recommended by the manufacturer. Reverse transcription was performed with 5 µg of total RNA using 400 U of M-MLV Reverse Transcriptase (Gibco-BRL) in the presence of random hexanucleotide primers (200 ng) for 1 h at 37°C.

The full-length coding region was obtained by polymerase chain reaction (PCR) using degenerate primers designed from conserved sequences surrounding the start and the stop codon in other perciform fish, i.e., the striped bass (Morone saxatilis; [22]), the amberjack (Seriola dumerili; GenBank AJ130876), and the sea bream (Sparus aurata; N. Zmora, personal communication). Sequences of these primers were SB-for 5' TCAGAAAATGRACACCACTCT 3' and SB-rev 5' CTCATAKGWTGCTSTCAGAG 3.' PCR products of the expected size (about 1300 base pairs [bp]) were purified and cloned in the EcoRV site of the Bluescript plasmid for sequencing.

The cloning of the 3' and 5' extremities of the cDNA was then performed using the 5'/3' RACE kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocols. Briefly, for the amplification of the 5' flanking region, 1.5 µg of total RNA were reverse transcribed using a specific primer (SB-5R1: 5' ATTGATAGCCAGAGGGTTGAG 3'). After the addition of a poly(A) tail at the 3' flanking region of the first-strand cDNA using a terminal transferase, a first amplification was performed using an internal specific primer (SB-5R2: 5' GGGTTGAGGATGGCTGACTGC 3') and an oligo-d(T)-anchor primer (Roche Diagnostics). A nested PCR was carried out using 1 µl of the first reaction as template with the primer SB-5R3 (5' CACGGTGACAAAGGCGCAAGA 3') and a second anchor primer (Roche Diagnostics). A single PCR product of about 700 bp was obtained and cloned in the pCDNA3.1-TOPO cloning vector (Invitrogen) for sequencing. For the amplification of the 3' flanking region, reverse transcription was performed on 2 µg of total RNA using an oligo-d(T) primer. A first PCR was performed using a specific primer (SB-3R1: 5' TTTCCTGCCTGTTCCTGCTGC 3') and the oligo-d(T)-anchor primer (Roche Diagnostics). A second PCR was then realized using a nested specific primer (SB-3R2: 5' GAATAACATCCCCAGAGCCCG 3') and the second anchor primer (Roche Diagnostics). A single PCR product of about 800 bp was obtained and cloned in the same plasmid as above for sequencing. The cDNA sequence corresponding to the sea bass GnRH receptor has been submitted to the GenBank under the accession number AJ419594.

Sequence Analysis

Multiple alignments and phylogenetic analysis were carried out using ClustalW. This analysis was performed using the amino acid sequences of GnRH receptors available from GenBank. The sequence sources and GenBank accession numbers are as follows: Drosophila melanogaster (AF077299), japanese eel (AB041327), catfish (catfish-1, X97497; catfish- 2, AF329894), goldfish (goldfish A, AF121845; goldfish B, AF121846), rainbow trout (AJ272116), medaka (medaka1, AB057675; medaka2, AB057674), amberjack (AJ130876), Haplochromis burtoni (AY028476), striped bass (AF218841), rubber eel (AF174481), Xenopus (Xenopus I, AF172330; Xenopus II, AF257320), bullfrog (bullfrog-1, AF144063; bullfrog-2, AF15913; bullfrog-3, AF144062), chicken (AJ304414), mouse (L01119), rat (S59525), brushtail possum [29], sheep (L22215), bovine (U00934), horse (AF018072), dog (AF206513), pig (AH009128), marmoset monkey [30], bonnet monkey (AF156930), rhesus monkey (AF353987), and human (human I, L03380; human II, NM057163).

In Situ Hybridization

The preparation of [{alpha}-35S] dUTP-labeled single-stranded mRNA probes was carried out according to standard procedures. Sense and antisense sea bass GnRH-R riboprobes were synthesized using p-Bluescript- sbGnRH-R transcription vector as a template and then linearized with BamHI or EcoRI with T3 and T7 RNA polymerase, respectively. One microgram of the linearized plasmid was incubated for 1 h at 37°C in a solution containing a transcription buffer (Tris-HCl 40 mM, MgCl2 6 mM, Spermidine 2 mM), 10 mM dithiothreitol (DTT), rATP, rGTP, rCTP (0.25 mM each), 100 µCi of [{alpha}-35S] dUTP (MP Biomedicals, Irvine, CA), RNase inhibitor, and 2.5 U of the appropriate RNA polymerase. The DNA template was then digested with RQ-1 DNase for 15 min at 37°C. Probes were purified on a Sephadex G50 column (Amersham Biosciences, Little Chalfont, UK) equilibrated with 50 µg of yeast tRNA using a loading buffer (Tris-HCl 10 mM, pH 7.5; EDTA 1 mM; DTT 10 mM; 0.1% SDS). The fractions containing the highest amount of radioactivity were pooled and the probes were precipitated overnight at –20°C and resuspended in the hybridization mix (50% formamide; 0.3 M NaCl; 20 mM Tris-HCl, pH 8.5; 5 mM EDTA; 10% dextran sulfate; 1x Denhardt solution; 10 mM DTT; 0.5 µg/µl yeast tRNA) at a concentration of 2 x 104 cpm/µl.

The protocol for in situ hybridization was according to González-Martínez et al. [31]. Brains were collected from animals anesthetized in phenoxyethanol (0.3 ml/L), previously perfused with 0.65% NaCl and fixative solution (4% paraformaldehyde; 0.1 M phosphate buffer, pH 7.4; 5% picric acid). Transverse paraffin brain and pituitary sections (6 µm thick) were equilibrated at room temperature, rehydrated, and postfixed for 20 min. Sections were treated with protein kinase (20 µg/ml in 50 mM Tris-HCl, pH 8, and 5 mM EDTA) for 7.5 min and washed with PBS for 5 min, followed by a refixation in 4% paraformaldehyde for 5 min and a quick wash with distilled water. Thereafter, sections were acetylated for 10 min with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8), dehydrated through increasing concentrations of ethanol, and air dried. The sections were covered with the hybridization mix (20 x 103 cpm/slide), coverslipped, and incubated overnight at 52°C. Coverslips were then removed by immersion in a 5x SSC, 10 mM DTT solution at 55°C for 30 min, and then washed in a 2x SSC, 50% formamide, 10 mM DTT solution at 65°C for 30 min followed by several washes in NTE buffer (10 mM Tris-HCl, 0.5 M NaCl, 5 mM EDTA) for 10 min at 37°C. To degrade single-stranded probe, the sections were incubated in a solution of NTE containing RNase A (20 µg/ml) for 30 min at 37°C. Sections were then rinsed in 2x SSC, 50% formamide, 10 mM DTT at 65°C, washed in 2x SSC and 0.1x SSC at room temperature, and dehydrated in ethanol. Slides were then dipped into an Ilford K5 photographic emulsion and exposed for 12 days at 4°C, developed, and counterstained with toluidine blue 0.02%. Adjacent sections were systematically treated with the sense and antisense probes.

In situ hybridization sections were analyzed on a Leica photomicroscope (Leica Microsystems AG, Wetzlar, Germany) equipped with bright field and dark field, and computer images were obtained with a Sony DKC-CM30 Digital Camera (Sony, Tokyo, Japan). The software used was Adobe PhotoShop 5.5 (Adobe Systems Incorporated, San Jose, CA) and no subsequent alterations were made. For the precise localization of GnRH-R-expressing cells, we have used a detailed sea bass brain atlas recently developed in our laboratory [32, 33].

For double in situ hybridization studies, nonisotopic riboprobes for sea bass luteinizing hormone (LH) and follicle-stimulating hormone (FSH) ß subunits [34] were synthesized using a digoxigenin (DIG)-RNA labeling mix (Roche Diagnostics) according to the manufacturer's instructions. DIG-labeled riboprobes were dissolved in an appropriate volume of diethyl pyrocarbonate-treated H2O to obtain 200 ng probe/µl. After 5 min incubation at 80°C, both 35S-UTP and DIG riboprobes were simultaneously diluted 1:10 (final concentration of probes, 2 x 104 cpm/µl and 20 ng/µl, respectively) in hybridization buffer. Subsequently, 100 µl of hybridization solution containing either DIG-labeled LH-ß or FSH-ß riboprobes and 35S- UTP labeled sbGnRH-R riboprobe were added to each pretreated slide. The posthybridization procedure was as above, but before dehydration, slides were washed for 10 min at room temperature in buffer A (100 mM Tris-HCl, pH 7.5; 150 mM NaCl) and then incubated in blocking solution (2% blocking reagent [Roche Diagnostics] in buffer A) for 30 min at room temperature. Subsequently, the slides were incubated with anti-DIG Fab fragments from sheep conjugated to alkaline phosphatase (Roche Diagnostics) diluted 1:1000 in blocking solution for 1 h at room temperature. The slides were then rinsed twice in buffer B (100 mM Tris-HCl, pH = 9.5; 50 mM MgCl2; 100 mM NaCl). For signal detection, a NBT (4- nitroblue tetrazolium chloride)/BCIP (5-bromo-4-chloro-3-indolyl-phosphate) ready-to-use tablet (Roche Diagnostics) was diluted in buffer B containing 1 mM levamisole (Sigma, St. Louis, MO) and the slides were incubated in chromogenic solution for 1 h at room temperature. After color development, slides were dehydrated in ethanol solutions containing 0.3 M ammonium acetate, dipped in photographic emulsion (Amersham Biosciences), exposed under dry conditions at 4°C and developed after 12 days.

In addition, GnRH-R in situ hybridization was combined with GH immunohistochemistry using a streptavidin-biotin-peroxidase complex method. In this case, pituitary sections were first processed for in situ hybridization using [{alpha}-35S] dUTP-labeled GnRH-R riboprobes, as reported above, and subsequently they were incubated overnight in a moist chamber at room temperature with a rabbit antiserum against recombinant seabream GH (kindly donated by Dr. Valdivia) diluted 1:1000 in Coons buffer (CBT; 0.01 M Veronal, 0.15 M NaCl) containing 0.1–0.2% Triton X-100 and 0.5% casein. Sections were washed in CBT (2 x 15 min) and incubated for 1.5 h at room temperature with Biotin-sp-Conjugated-AffiniPure Goat Anti-rabbit-IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) diluted 1:1000 in CBT. After washing in CBT (2 x 15 min), sections were incubated 1.5 h at room temperature with peroxidase-conjugated- streptavidin complex (Jackson ImmunoResearch Laboratories Inc.) diluted 1:1000 in CBT. Finally, sections were washed in CBT followed by Tris- HCl (0.05 M, pH 7.4) and peroxidase activity was visualized in 0.05 M Tris-HCl, pH 7.6, containing 0.025% 3,3 diaminobenzidine tetrahydrochloride (Sigma) and 0.01% hydrogen peroxide. Controls were performed by preabsorption of primary antisera with their respective antigens, replacement of primary antisera with the corresponding preimmune sera, and omission of primary or biotinylated antisera.

Quantitative Analysis of GnRH-R Expression in Brainand Pituitary

For quantitative analysis of GnRH-R expression along the reproductive cycle, at least 60 brain and pituitary sections (10 sections/animal), hybridized with the antisense or sense probe, were randomly selected at each reproductive stage (late vitellogenesis, maturation, spawning, and postspawning/resting). Randomly selected bright field pictures (30 pictures/ animal) covering 1100 µm2 of surface in positive cell areas were obtained in the photomicroscope at high magnification with the help of a digital camera. To measure the percentage of the total pituitary area occupied by GnRH-R-expressing cells along the reproductive cycle, 60 antisense whole pituitary sections (10 sections/animal) were selected at random at each reproductive stage and randomly selected dark field pictures (30 pictures/ animal) covering 0.146 mm2 of surface were obtained at low magnification with the help of a digital camera. The area occupied by autoradiographic silver grains was measured with the help of the Scion Image Beta 4.0.2 software (NIH, Rockville, MD) and results were presented as mean ± SEM. The statistical analysis was performed with the help of the SPSS 10.0 program (SPSS Inc., Chicago, IL). As requirements of normality and homogeneity of variances were not satisfied, the Kruskall-Wallis nonparametric analysis of variance method was used followed by the Mann-Whitney and Wilcoxon tests. To compare the percentage of the total pituitary area occupied by GnRH-R-expressing cells along the reproductive cycle, a proportion test was used. Differences between mean values were considered significant at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Cloning of a Full-Length cDNA Encoding a Sea Bass GnRH Receptor and Sequence Analysis

Using degenerate primers surrounding the start and the stop codons, we have cloned a cDNA containing the full- coding sequence of a sbGnRH-R. The sequence was then completed by obtaining the 5' and 3' untranslated region (UTR) using the rapid amplification of cDNA ends-PCR method. The complete cDNA was 1814 bp in length and encoded a predicted protein of 416 amino acids. The 5' UTR and 3' UTR were 239 bp and 324 bp in size, respectively. The complete nucleic acid sequence as well as the deduced amino acid sequence are shown in Figure 1. Hydrophobic analysis of the protein sequence showed an arrangement in seven transmembrane domains that is typical of a G protein-coupled receptor (Fig. 2). The structure of the molecule showed the presence of a C-terminal tail and restoration of Asp96, which is shared by the rest of GnRH- R present in perciforms. Moreover, the conserved Cys25 and Cys123 were present and four potential N-linked glycosylation sites were evident in the NH2-terminal region (Fig. 2). Sequence comparison was performed using ClustalW and a rooted phylogenetic tree was constructed by the addition of the Drosophila GnRH receptor-like sequence (Fig. 3). This analysis revealed a very high similarity with the GnRH-R cloned in other perciforms. Indeed, the sea bass GnRH-R shared about 96% and 90% of identity with striped bass GnRH-R and amberjack GnRH-R, respectively. The sbGnRH-R also showed 67% of identity with one of the receptors cloned in medaka and more than 55% of identity with an amphibian receptor cloned in the bullfrog, the bfGnRH-R-1. The identity with the GnRH-R of other vertebrates was about 40%.



View larger version (83K):
[in this window]
[in a new window]
  		FIG. 1. Nucleotide and deduced amino acid sequence of the sea bass GnRH receptor. Numbers on the left indicate the nucleotide positions. Amino acids are indicated below their respective codons and are numbered on the right



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 2. Potential glycosylation sites ({diamond}), casein kinase I (•) and II ({blacktriangledown}) sites, calmodulin II ({square}), PKA ({diamondsuit}), and PKC ({triangleup}) phosphorylation sites are shown in the sbGnRH-R sequence as indicated. Note that all the phosphorylation sites are present in intracellular or extracellular loop regions. The putative transmembrane domains are indicated in the underlined regions



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3. Phylogenetic analysis of the GnRH-R sequences. Sequence alignment was performed according to the Lipman-Pearson algorithm using the Dayhoff matrix for amino acid homology. Distances for the different receptors were calculated with the neighbor joining method and one thousand bootstrap replicates were performed (expressed as percentages). The rooted tree was constructed by the addition of the drosophila GnRH-R like sequence

Localization of GnRH-R mRNA in the Brain and Pituitary of the European Sea Bass

The cloned sequence was revealed as a specific and useful probe for the precise localization of expression of GnRH-R gene in the brain and pituitary of sea bass by in situ hybridization. The specificity of the signal was systematically checked on adjacent control sections incubated with the sense probe, which only showed uniform background. In sea bass, GnRH-R was only detected in the forebrain, pineal, and adenohypophysis (Fig. 4). In the telencephalon, most GnRH-R-expressing cells were found in the ventral telencephalon (Figs. 4 and 5, A, B, and F) and, particularly, in the central (Fig. 5B), ventral (Fig. 5B) and intermediate (Fig. 5F) nuclei. Furthermore, a conspicuous GnRH-R expression was observed in cells of the central nucleus of the dorsal telencephalon (Fig. 5, C and D). In the diencephalon, most GnRH-R-expressing cells appeared in the preoptic area (Figs. 4 and 5, E–H), especially in the anteroventral (Fig. 5, E and F) and parvocellular (Fig. 5F) parts of the parvocellular preoptic nucleus. Further caudal, a weaker GnRH-R expression was evident in the anterior periventricular nucleus (Fig. 5G) and the gigantocellular part of the magnocellular preoptic nucleus (Fig. 5H).



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 4. Sagittal drawing of sea bass brain and pituitary summarizing the distribution of GnRH receptor-expressing cells. C, Corpus of the cerebellum; Dc, central nucleus of the dorsal telencephalon; MO, medulla oblongata; NAPv, anterior periventricular nucleus; NLT, lateral tuberal nucleus; NPOav, anteroventral part of the parvocellular preoptic nucleus; NPOpc, parvocellular part of the parvocellular preoptic nucleus; NRL, nucleus of the lateral recess; OB, olfactory bulbs; OT, optic tectum; Pin, pineal gland; Pit, pituitary; PMgc, gigantocellular part of the magnocellular preoptic nucleus; VC, valvula of the cerebellum; Vc, central nucleus of the ventral telencephalon; Vi, intermediate nucleus of the ventral telencephalon; VM, ventromedial thalamic nucleus; Vv, ventral nucleus of the ventral telencephalon; SC, spinal cord; SV, saccus vasculosus; Tel, telencephalon. Scale bar = 1 mm



View larger version (131K):
[in this window]
[in a new window]
  		FIG. 5. Localization of sea bass GnRH receptor in the brain and pineal gland of sea bass using in situ hybridization. A) Bright field picture through the ventral telencephalon corresponding to the section presented in B. B) Positive cells (arrowheads) in the ventral (Vv) and central (Vc) nuclei of the ventral telencephalon. C) Bright field picture through the dorsal telencephalon corresponding to the section presented in D. D) GnRH-R expressing cells (arrowhead) in the central nucleus of the dorsal telencephalon (Dc). E) Intensely positive neurons (arrowheads) in the anteroventral part of the parvocellular preoptic nucleus (NPOav). F) GnRH-R positive cells (arrowheads) in the anteroventral (NPOav) and parvocellular (NPOpc) parts of the parvocellular preoptic nucleus and in the intermediate nucleus of the ventral telencephalon (Vi). G) GnRH-R expressing cells (arrowheads) in the anterior periventricular nucleus (NAPv). H) Note the presence of positive cells (arrowheads) in the gigantocellular part of the magnocellular preoptic nucleus (PMgc). I) Section through the thalamus of sea bass showing the expression of GnRH-R in cells (arrowheads) of the ventromedial thalamic nucleus (VM). J) Positive cells (arrowheads) in the ventral part of the lateral tuberal nucleus (NLTv) of the hypothalamus and in the pituitary (Pit). K) GnRH-R expressing cells (arrowheads) in the nucleus of the lateral recess (NRL). L) Pineal gland of the sea bass exhibiting intensely positive cells (arrowheads). Asterisks in A to D mark the ventricle. Tel, Telencephalon; POA, preoptic area; VTh, ventral thalamus; Hyp, hypothalamus. Scale bars = 500 µm in A to D and 250 µm in E to L

In addition, a few GnRH-R-expressing cells were detected in the ventromedial thalamic nucleus (Figs. 4 and 5I). The most caudal GnRH-R-expressing cells appeared in the hypothalamus, particularly in the ventral part of the lateral tuberal nucleus (Figs. 4 and 5J) and in the nucleus of the lateral recess (Figs. 4 and 5K). A clear, specific radiolabeling was also evident in cells of the pineal gland (Figs. 4 and 5L). The highest expression of GnRH-R gene was observed in the pituitary (Fig. 6). Positive cells appeared as compact cell groups in the proximal pars distalis, but also in clusters and lining the external border of the pars intermedia (Fig. 6, A–D). Double in situ hybridization revealed that virtually all LH cells expressed GnRH-R (Fig. 6E) but only a few FSH cells exhibited a remarkable GnRH-R expression (Fig. 6F). However, sea bass GH-immunoreactive cells were not positive for GnRH-R (Fig. 6G).



View larger version (123K):
[in this window]
[in a new window]
  		FIG. 6. Localization of sea bass GnRH receptor in the pituitary of sea bass using in situ hybridization. A) Pituitary of a sea bass specimen from November (late vitellogenesis). B) Pituitary of a sea bass specimen from December (maturation). C) Pituitary of a sea bass specimen from February (spawning). D) Pituitary of a sea bass specimen from May (postspawning/resting). E) Expression of GnRH-R (silver grains) in LHß-expressing cells (dark staining). Note that all LH cells express the GnRH-R. F) Picture showing a FSHß-expressing cell positive for GnRH-R (arrow) surrounded by several FSH cells that do not exhibit GnRH-R expression (open arrowhead). G) Picture showing immunostained GH cells that do not express GnRH-R but appear surrounded by GnRH-R-expressing cells (silver grains). Scale bars = 250 µm in A to D and 10 µm in E to G. PPD, Proximal pars distalis; PI, pars intermedia

Quantitative Analysis of Brain and Pituitary GnRH-R Expression along the Reproductive Cycle

In the brain, the quantitative analysis of cell masses exhibiting specific radiolabeling revealed the existence of changes in the expression of GnRH-R along the reproductive cycle. Values obtained were expressed as mean area occupied by silver grains in µm2/1000 µm2 of brain section ± SEM, and appear represented in Figure 7. The highest GnRH-R expression was observed in the preoptic area, particularly in the anteroventral part of the parvocellular preoptic nucleus (NPOav). In this nucleus, the GnRH-R expression was low during late vitellogenesis and maturation periods and increased notably during the spawning season (78.25 ± 11.69; P < 0.001), decreasing significantly at the postspawning/resting period. In the remaining brain nuclei and in the pineal gland, significantly higher levels of GnRH-R were observed during the postspawning/resting season in relation to late vitellogenesis, maturation, and spawning stages (Fig. 7). This increase was especially evident in the pineal gland (56.03 ± 11.03; P < 0.001), ventromedial thalamic nucleus (VM; 52.43 ± 13.88; P < 0.001), and parvocellular part of the parvocellular preoptic nucleus (NPOpc; 46.38 ± 14.01; P < 0.001), but also in the anterior periventricular nucleus (NAPv; 38.66 ± 20.4; P < 0.001), the nucleus of the lateral recess (NRL; 38.38 ± 8.09; P < 0.001), the central nucleus of the dorsal telencephalon (Dc; 35.21 ± 20.2; P < 0.001), and the central (Vc; 33.54 ± 6.72; P < 0.001) and intermediate (Vi; 35.31 ± 10.58; P < 0.001) nuclei of the ventral telencephalon. The lowest increases in GnRH-R expression were observed in the ventral part of the lateral tuberal nucleus (NLTv; 29.28 ± 4.30; P < 0.001), the ventral nucleus of the ventral telencephalon (Vv; 22.98 ± 5.82; P < 0.001), and the magnocellular preoptic nucleus (PMgc; 18.86 ± 4.55; P < 0.001).



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 7. Quantitative analysis of expression of sea bass GnRH-R gene in the pineal gland and different forebrain nuclei of sea bass along the reproductive cycle. Nov, November (late vitellogenesis); Dec, December (maturation); Feb, February (spawning), May (postspawning/resting). Black and grey columns represent mean values of sense (S) and antisense (AS) sections, respectively. Values are expressed as mean area occupied by silver grains in µm2/1000 µm2 of brain section ± SEM. Asterisk indicates significant differences between mean values of antisense and sense sections from the same period (*, P < 0.01; **, P < 0.001). Different letters indicate significant differences between antisense mean values from different reproductive periods (P < 0.05). For abbreviations, see Figure 4 except for NLTv, ventral part of the lateral tuberal nucleus; Pineal, pineal gland. Note the different Y-axes in histograms

The pituitary of the sea bass exhibited an important expression of the GnRH-R gene at all stages of the reproductive cycle (Fig. 6, A–D). However, this expression was significantly higher in late vitellogenesis (318 ± 224.00; P < 0.002; Figs. 6A and 8A) in relation to maturation (Figs. 6B and 8A), spawning (Figs. 6C and 8A), and postspawning/ resting periods (Figs. 6D and 8A), in which the GnRH-R expression was markedly reduced. This reduction is the consequence of a decrease in the expression of GnRH-R within positive cells (Fig. 8A) but also in the number or size of GnRH-R-expressing cells because the mean percentage of pituitary section occupied by GnRH-R-expressing cells also exhibited a dramatic reduction from vitellogenesis (22%, F = 14.661; P < 0.001) to maturation (7.75%), spawning (2.5%), and postspawning/resting (3%) periods (Fig. 8B).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 8. A). Quantitative analysis of expression of sea bass GnRH-R gene in the pituitary of sea bass along the reproductive cycle in November (late vitellogenesis), December (maturation), February (spawning), and May (postspawning/resting). Black and grey columns represent mean values of sense (S) and antisense (AS) sections, respectively. Values are expressed as mean area occupied by silver grains in µm2/1000 µm2 of pituitary section ± SEM. Asterisk indicates significant differences between mean values of antisense and sense sections from the same period (*, P < 0.001). Different letters indicate significant differences between antisense mean values from different reproductive periods (P < 0.05). B) Quantitative analysis of the mean percentage of pituitary area occupied by GnRH receptor-expressing cells along the reproductive cycle. Different letters indicate significant differences between mean values from different reproductive periods (P < 0.05)


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The complete sequence of a sea bass GnRH-R is presented herein. The presence of a C-terminal tail and restoration of Asp96 (compared with the G-protein coupled receptors) are the characteristics that classify the sbGnRH- R as a member of the growing family of perciform GnRH- Rs. A change in the signature sequence (Asp-Arg-Tyr) of the rhodopsin family of G-protein coupled receptors at the junction of the transmembrane domain III and second intracellular domain is unique to the vertebrate GnRH-Rs. A similar change has been observed in the case of the sbGnRH-R (147DRQ149), which is conserved in the GnRH-Rs identified in amberjack, rubber eel, and striped bass. The sbGnRH-R has several predicted phosphorylation sites, of which PKA-specific Ser83 and calmodulin II-specific Thr273 and most of the serine sites are also present in the GnRH- Rs of striped bass, amberjack, and rubber eel. The conserved single Cys25 in the first extracellular loop and Cys123 in the second extracellular loop that have been implicated for proper receptor folding in all the mammalian species [35] are also present in sbGnRH-R. Similar to the catfish GnRH-R1 [18], there are at least four potential N-linked glycosylation sites in the NH2-terminal of sbGnRH-R. Glycosylation is important for the GnRH-R expression in mammalian species [36].

To date, most information concerning the GnRH-R expression in the fish brain has been obtained by RT-PCR [21, 22, 24, 37, 38] and information on the precise sites of expression of the GnRH-Rs is limited to the rainbow trout [20]. This trout receptor is poorly expressed in the pituitary, but a conspicuous expression was detected in midbrain areas [20]. Surprisingly, this pattern of expression markedly differs from that observed in sea bass, in which a strong expression is detected in the pituitary and the forebrain, whereas no signal could be detected in the mesencephalon. Thus, the difference in the distribution of these receptors and their low level of identity probably reflects the fact that they represent different GnRH-R subtypes, most likely involved in different functions.

In 1998, Troskie et al. suggested that different GnRH receptor subtypes might have accompanied the evolution of the GnRH subtypes [25]. Analysis of the sequences of the extracellular loop 3 of these receptors, which is important for the ligand selectivity in mammalian receptors [39], allowed these authors to classify the receptors into three groups (type I, with subtypes IA and IB, and II). In fish, the presence of two different GnRH receptor subtypes has been described in goldfish [19], Haplochromis burtoni [22], medaka [23], and African catfish [24]. Phylogenetic analyses indicated that the sea bass GnRH-R is closely related to those of perciforms and beloniforms, notably striped bass and medaka GnRH-R1, all intensely expressed in the pituitary. In contrast, the trout sequence falls in another branch, together with the medaka GnRH-R2 [23], the gene of which, similar to the trout GnRH-R gene, contains an additional exon [40]. Another fish species in which two GnRH-Rs have been reported is the goldfish [19], but the phylogenetic trees indicate that these are variant forms from the same subtype. In mammals, two different GnRH receptors have also been characterized [27, 28], and three distinct GnRH receptors seem to be present in several vertebrate classes [25, 26]. In the bullfrog, GnRH-R1 is intensely expressed in the pituitary whereas the GnRH-R2 has a low pituitary expression [26].

Comparing the distribution of GnRH-R and prepro- GnRH-ir fibers in sea bass brain [10], it seems evident that most GnRH-R-expressing cells appear in cell nuclei that mainly received sGnRH and sbGnRH projections. Thus, it appears that the GnRH-R of sea bass represents a receptor for the most abundant GnRHs in the forebrain of this species, sbGnRH and sGnRH. Supporting this assumption, this GnRH-R is highly expressed in sea bass pituitary gonadotrophic cells, which received sbGnRH and sGnRH fibers but not cGnRH-II projections [10], and seems to represent a GnRH receptor responsible for direct sbGnRH and/or sGnRH stimulatory actions on gonadotroph release. Moreover, significant differences in sea bass pituitary GnRH-R expression was observed during the reproductive cycle, showing the highest levels in November (late vitellogenesis). Interestingly, sbGnRH levels are also higher in this period, at least in male sea bass [9]. However, it is probable that more than one form of GnRH-R exists in the brain of sea bass, as it occurs in other vertebrates [25, 26]. In this sense, two types of GnRH-R sequences are expressed in Haplochromis burtoni (Perciformes) and medaka (Beloniformes) [22, 23].

In sea bass, GnRH-R-expressing cells were only evident in the pituitary, forebrain, and pineal. In the pituitary, labeling was restricted to the proximal pars distalis (PPD), and the external border of the pars intermedia, two regions that contain gonadotrophic cells [41]. This GnRH-R expression in sea bass pituitary was mainly detected in LH cells but also in some FSH cells, whereas somatotrophs appeared devoid of GnRH-R expression. Interestingly, in tilapia, gonadotrophic cells (FSH and LH) but not GH cells expressed type IA and IB GnRH-Rs, whereas GH cells but not gonadotrophic cells expressed a different type III GnRH-R [42].

Qualitative and quantitative analyses reveal that the pituitary expression of GnRH-R was higher in November (late vitellogenesis) than in December (maturation), February (spawning), or May (postspawning/resting). However, in this study, we are detecting GnRH-R mRNAs and not the functional proteins, and their profiles could differ along the sea bass reproductive cycle. In other fish species, it has also been shown that the number of pituitary GnRH receptors [43] or pituitary GnRH-R mRNA levels [21] varies over the maturation process. Furthermore, there is evidence demonstrating that GnRH induces the expression of its own receptor [44, 45]. Thus, in rat, the administration of low concentrations of GnRH is followed by an upregulation of GnRH receptor in the anterior hypophysis [44]. The treatment with sGnRH analogs also increases the number of high-affinity GnRH receptors in the goldfish pituitary [45].

In the sea bass brain, the highest GnRH-R expression was observed in the anteroventral part of the parvocellular preoptic nucleus during the spawning season. The presence of sGnRH and sbGnRH cells in the immediacy of this nucleus has previously been reported in sea bass [10, 31]. This nucleus also contains catecholaminergic cells in sea bass [46] and other teleost species [47–49], which represent a source of dopaminergic projections reaching the pituitary and inhibiting the gonadotroph secretion [49]. Thus, the putative presence of GnRH-R in catecholaminergic cells of the anteroventral part of the parvocellular preoptic nucleus could represent a morphological substrate for GnRH-dopamine interactions, reinforcing the major role of this cell mass in the control of fish reproduction. However, such a role cannot be attributed to this nucleus in sea bass because the role of dopamine in regulating gonadotroph release in this species is rather dubious [50].

Other preoptic cell masses, as the parvocellular part of the parvocellular preoptic nucleus and the gigantocellular part of the magnocellular preoptic nucleus, also expressed GnRH-R in sea bass. These nuclei, which have been largely implicated in the control of pituitary functions and are considered as important neuroendocrine centers [51], represent a target for steroid hormones [47, 49, 52].

The presence of GnRH-Rs was also evident in ventral (Vv, Vc, Vi) and dorsal (Dc) telencephalic nuclei, in the anterior periventricular nucleus of the preoptic area, the lateral tuberal nucleus, and the nucleus of the lateral recess of the hypothalamus. In sea bass, these cell masses, as well as the parvocellular and magnocellular preoptic nuclei, have been implicated in the control of appetite and feeding and are known for the presence of neuropeptide Y (NPY), peptide Y (PY), peptide YY [53, 54], galanin [55], and/or catecholamines [46]. The stimulatory effects of NPY on gonadotroph secretion have also been largely referred in teleosts, including sea bass [56, 57]. These NPY actions on gonadotroph secretion seem to exhibit seasonal variations [58]. Furthermore, it has been suggested that GnRH and NPY could cooperate to modulate the interactions between the reproductive and metabolic processes [59]. Interestingly, the GnRH-R expression in these nuclei rise significantly at the postspawning/resting period, when sea basses recuperate their feeding habits after a natural fasting period coincident with the maturation/spawning season. In this way, the presence of GnRH-R- and NPY-related peptide expression in the same nuclei could be implicated in the mediation of these metabolic and reproductive interactions.

The ventromedial thalamic nucleus of sea bass also expressed GnRH-R. In gilthead seabream, the presence of sbGnRH-expressing cells was also evident in the ventral thalamus [60]. Moreover, the existence of hypophysiotrophic neurons in the thalamus has been described in goldfish [51] and Apteronotus leptorynchus [61]. The thalamus of goldfish [62] and rainbow trout [47] also expressed steroid receptors, and electrical stimulation of the thalamus elicits reproductive behavior, including sex color change and gamete release, in the hermaphrodite sea bass Serranus subligarius [63]. Although GnRH-expressing cells were not detected in the thalamus of sea bass [10, 31], a conspicuous sGnRH and cGnRH-II innervation was present in the ventral thalamus of this species [10]. Thus, GnRH acting on thalamic GnRH-R could have a role in the regulation of similar events in sea bass.

In sea bass, GnRH-Rs were also present in the pineal gland. In fish, the pineal gland has endocrine cells but retains a photoreceptive function. The presence of GnRH and/ or GnRH-R in other visually related structures as the retina or the optic tectum has been extensively described [10, 20, 22, 64]. Based on these evidences, a role of GnRH in the coordination of visual sensory information has been proposed [22]. In this way, the presence of GnRH-R in a photoreceptive structure as the pineal gland of sea bass could reinforce this assumption.

In conclusion, the present study analyzes the expression of a GnRH-R cloned in the brain and pituitary of a perciform species along the reproductive cycle. The abundant expression of GnRH-R in pituitary gonadotrophs and forebrain neuroendocrine centers as well as the variation in GnRH-R expression along the reproductive cycle strongly suggest a relevant role of this receptor in the mediation of GnRH effects on the release of gonadotrophs and reproductive events. Furthermore, the quantitative analysis during the reproductive cycle reveals that GnRH-R expression is regulated in a different manner in the brain and the pituitary of sea bass.


   FOOTNOTES
 
1 Supported by UE (FAIR CT97–3785), CICYT (MAR1988–1542-CE), and CNRS. Back

2 Correspondence: José Antonio Muñoz-Cueto, Departamento de Biología, Facultad de Ciencias del Mar y Ambientales, Universidad de Cádiz, Polígono Río San Pedro, 11510 Cádiz, Spain. FAX: 34 956 016019; munoz.cueto{at}uca.es Back

Received: 29 August 2003.

First decision: 21 September 2003.

Accepted: 2 January 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sealfon SC, Millar RP. Functional domains of the gonadotropin-releasing hormone receptor. Cell Mol Neurobiol 1995 15:25-42[CrossRef][Medline]
  2. Marchant TA, Chang JP, Nahorniak CS, Peter RE. Evidence that gonadotropin-releasing hormone also functions as a growth hormone- releasing factor in the goldfish. Endocrinology 1989 124:2509-2518[Abstract]
  3. Weber GM, Powell JF, Park M, Fischer WH, Craig AG, Rivier JE, Nanakorn U, Parhar IS, Ngamvongchon S, Grau EG, Sherwood NM. Evidence that gonadotropin-releasing hormone (GnRH) functions as a prolactin-releasing factor in a teleost fish (Oreochromis mossambicus) and primary structures for three native GnRH molecules. J Endocrinol 1997 155:121-132[Abstract]
  4. Habibi HR, Patti D. Extrapituitary gonadotropin-releasing hormone (GnRH) binding sites in goldfish. Fish Physiol Biochem 1993 11:43-49[CrossRef]
  5. Leung PC, Peng C. Gonadotropin-releasing hormone receptor: gene structure, expression and regulation. Biol Signals 1996 5:63-69[Medline]
  6. Yamamoto N, Oka Y, Kawashima S. Lesions of gonadotropin-releasing hormone-immunoreactive terminal nerve cells: effects on the reproductive behavior of male dwarf gouramis. Neuroendocrinology 1997 65:403-412[Medline]
  7. Volkoff H, Peter RE. Actions of two forms of gonadotropin releasing hormone and a GnRH antagonist on spawning behavior of the goldfish Carassius auratus. Gen Comp Endocrinol 1999 116:347-355[CrossRef][Medline]
  8. Powell JF, Zohar Y, Elizur A, Park M, Fischer WH, Craig AG, Rivier JE, Lovejoy DA, Sherwood NM. Three forms of gonadotropin-releasing hormone characterized from brains of one species. Proc Natl Acad Sci U S A 1994 91:12081-12085[Abstract/Free Full Text]
  9. Rodriguez L, Carrillo M, Sorbera LA, Soubrier MA, Mañanós E, Holland MC, Zohar Y, Zanuy S. Pituitary levels of three forms of GnRH in the male European sea bass (Dicentrarchus labrax, L.) during sex differentiation and first spawning season. Gen Comp Endocrinol 2000 120:67-74[CrossRef][Medline]
  10. Gonzalez-Martinez D, Zmora N, Mañanós E, Saligaut D, Zanuy S, Zohar Y, Elizur A, Kah O, Muñoz-Cueto JA. Immunohistochemical localization of three different prepro-GnRHs in the brain and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. J Comp Neurol 2002 446:95-113[CrossRef][Medline]
  11. Reinhart J, Mertz LM, Catt KJ. Molecular cloning and expression of cDNA encoding the murine gonadotropin-releasing hormone receptor. J Biol Chem 1992 267:21281-21284[Abstract/Free Full Text]
  12. Tsutsumi M, Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan CA, Dong K, Gillo B, Sealfon SC. Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 1992 6:1163-1169[Abstract]
  13. Eidne KA, Sellar RE, Couper G, Anderson L, Taylor PL. Molecular cloning and characterisation of the rat pituitary gonadotropin-releasing hormone (GnRH) receptor. Mol Cell Endocrinol 1992 90:R5-R9[CrossRef][Medline]
  14. Brooks J, Taylor PL, Saunders PT, Eidne KA, Struthers WJ, McNeilly AS. Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Mol Cell Endocrinol 1993 94:R23-R27[CrossRef][Medline]
  15. Chi L, Zhou W, Prikhozhan A, Flanagan C, Davidson JS, Golembo M, Illing N, Millar RP, Sealfon SC. Cloning and characterization of the human GnRH receptor. Mol Cell Endocrinol 1993 91:R1-R6[CrossRef][Medline]
  16. Kakar SS, Rahe CH, Neill JD. Molecular cloning, sequencing, and characterizing the bovine receptor for gonadotropin releasing hormone (GnRH). Domest Anim Endocrinol 1993 10:335-342[CrossRef][Medline]
  17. Weesner GD, Matteri RL. Rapid communication: nucleotide sequence of luteinizing hormone-releasing hormone (LHRH) receptor cDNA in the pig pituitary. J Anim Sci 1994 72:1911[Medline]
  18. Tensen C, Okuzawa K, Blomenrohr M, Rebers F, Leurs R, Bogerd J, Schulz R, Goos H. Distinct efficacies for two endogenous ligands on a single cognate gonadoliberin receptor. Eur J Biochem 1997 243:134-140[Medline]
  19. Illing N, Troskie BE, Nahorniak CS, Hapgood JP, Peter RE, Millar RP. Two gonadotropin-releasing hormone receptor subtypes with distinct ligand selectivity and differential distribution in brain and pituitary in the goldfish (Carassius auratus). Proc Natl Acad Sci U S A 1999 96:2526-2531[Abstract/Free Full Text]
  20. Madigou T, Mañanós-Sanchez E, Hulshof S, Anglade I, Zanuy S, Kah O. Cloning, tissue distribution, and central expression of the gonadotropin-releasing hormone receptor in the rainbow trout (Oncorhynchus mykiss). Biol Reprod 2000 63:1857-1866[Abstract/Free Full Text]
  21. Alok D, Hassin S, Sampath KR, Trant JM, Yu K, Zohar Y. Characterization of a pituitary GnRH-receptor from a perciform fish, Morone saxatilis: functional expression in a fish cell line. Mol Cell Endocrinol 2000 168:65-75[CrossRef][Medline]
  22. Robison RR, White RB, Illing N, Troskie BE, Morley M, Millar RP, Fernald RD. Gonadotropin-releasing hormone receptor in the teleost Haplochromis burtoni: structure, location, and function. Endocrinology 2001 142:1737-1743[Abstract/Free Full Text]
  23. Okubo K, Nagata S, Ko R, Kataoka H, Yoshiura Y, Mitani H, Kondo M, Naruse K, Shima A, Aida K. Identification and characterization of two distinct GnRH receptor subtypes in a teleost, the medaka Oryzias latipes. Endocrinology 2001 142:4729-4739[Abstract/Free Full Text]
  24. Bogerd J, Diepenbroek WB, Hund E, van Oosterhout F, Teves AC, Leurs R, Blomenrohr M. Two gonadotropin-releasing hormone receptors in the African catfish: no differences in ligand selectivity, but differences in tissue distribution. Endocrinology 2002 143:4673-4682[Abstract/Free Full Text]
  25. Troskie B, Illing N, Rumbak E, Sun YM, Hapgood J, Sealfon S, Conklin D, Millar R. Identification of three putative GnRH receptor subtypes in vertebrates. Gen Comp Endocrinol 1998 112:296-302[CrossRef][Medline]
  26. Wang L, Bogerd J, Choi HS, Seong JY, Soh JM, Chun SY, Blomenrohr M, Troskie BE, Millar RP, Yu WH, McCann SM, Kwon HB. Three distinct types of GnRH receptor characterized in the bullfrog. Proc Natl Acad Sci U S A 2001 98:361-366[Abstract/Free Full Text]
  27. Neill JD, Duck LW, Sellers JC, Musgrove LC. A gonadotropin-releasing hormone (GnRH) receptor specific for GnRH II in primates. Biochem Biophys Res Commun 2001 282:1012-1018[CrossRef][Medline]
  28. Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar R, Faurholm B, Scobie G, Kuestner R, Terasawa E, Katz A. A novel mammalian receptor for the evolutionarily conserved type II GnRH. Proc Natl Acad Sci U S A 2001 98:9636-9641[Abstract/Free Full Text]
  29. King JA, Fidler A, Lawrence S, Adam T, Millar RP, Katz A. Cloning and expression, pharmacological characterization, and internalization kinetics of the pituitary GnRH receptor in a metatherian species of mammal. Gen Comp Endocrinol 2000 117:439-448[CrossRef][Medline]
  30. Byrne B, McGregor A, Taylor PL, Sellar R, Rodger FE, Fraser HM, Eidne KA. Isolation and characterisation of the marmoset gonadotrophin releasing hormone receptor: Ser(140) of the DRS motif is substituted by Phe. J Endocrinol 1999 163:447-456[Abstract]
  31. González-Martínez D, Madigou T, Zmora N, Anglade I, Zanuy S, Zohar Y, Elizur A, Muñoz-Cueto JA, Kah O. Differential expression of three different prepro-GnRH (gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). J Comp Neurol 2001 429:144-155[CrossRef][Medline]
  32. Cerda-Reverter JM, Zanuy S, Muñoz-Cueto JA. Cytoarchitectonic study of the brain of a perciform species, the sea bass (Dicentrarchus labrax). I. The telencephalon. J Morphol 2001 247:217-228[CrossRef][Medline]
  33. Cerdá-Reverter JM, Zanuy S, Muñoz-Cueto JA. Cytoarchitectonic study of the brain of a perciform species, the sea bass (Dicentrarchus labrax). II. The diencephalon. J Morphol 2001 247:229-251[CrossRef][Medline]
  34. Mateos J, Mañanos E, Martínez-Rodríguez G, Carrillo M, Querat B, Zanuy S. Molecular characterization of sea bass gonadotropin subunits (alpha, FSHbeta, and LHbeta) and their expression during the reproductive cycle. Gen Comp Endocrinol 2003 133:216-232[CrossRef][Medline]
  35. Sealfon SC, Weinstein H, Millar RP. Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocr Rev 1997 18:180-205[Abstract/Free Full Text]
  36. Davidson JS, Flanagan CA, Zhou W, Becker II, Elario R, Emeran W, Sealfon SC, Millar RP. Identification of N-glycosylation sites in the gonadotropin-releasing hormone receptor: role in receptor expression but not ligand binding. Mol Cell Endocrinol 1995 107:241-245[CrossRef][Medline]
  37. Yu KL, He ML, Chik CC, Lin XW, Chang JP, Peter RE. mRNA expression of gonadotropin-releasing hormones (GnRHs) and GnRH receptor in goldfish. Gen Comp Endocrinol 1998 112:303-311[CrossRef][Medline]
  38. Okubo K, Amano M, Yoshiura Y, Suetake H, Aida K. A novel form of gonadotropin-releasing hormone in the medaka, Oryzias latipes. Biochem Biophys Res Commun 2000 276:298-303[CrossRef][Medline]
  39. Flanagan CA, Becker II, Davidson JS, Wakefield IK, Zhou W, Sealfon SC, Millar RP. Glutamate 301 of the mouse gonadotropin-releasing hormone receptor confers specificity for arginine 8 of mammalian gonadotropin-releasing hormone. J Biol Chem 1994 269:22636-22641[Abstract/Free Full Text]
  40. Madigou T, Uzbekova S, Lareyre JJ, Kah O. Two messenger RNA isoforms of the gonadotrophin-releasing hormone receptor, generated by alternative splicing and/or promoter usage, are differentially expressed in rainbow trout gonads during gametogenesis. Mol Reprod Dev 2002 63:151-160[CrossRef][Medline]
  41. Cambre ML, Verdonck W, Ollevier F, Vandesande F, Batten TF, Kuhn ER. Immunocytochemical identification and localization of the different cell types in the pituitary of the seabass (Dicentrarchus labrax). Gen Comp Endocrinol 1986 61:368-375[CrossRef][Medline]
  42. Parhar IS, Soga T, Sakuma Y, Millar RP. Spatio-temporal expression of gonadotropin-releasing hormone receptor subtypes in gonadotropes, somatotropes and lactotropes in the cichlid fish. J Neuroendocrinol 2002 14:657-665[CrossRef][Medline]
  43. Habibi HR, Peter RE. Gonadotropin releasing hormone (GnRH) receptors in teleost. In: Scott AP, Sumpter JP, Kime DE, Rolfe MS (eds.), Reproductive Physiology of Fish. Sheffield: FishSymp; 1991: 109–113
  44. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW. Regulation of rat pituitary gonadotropin-releasing hormone receptor mRNA levels in vivo and in vitro. Endocrinology 1993 133:931-934[Abstract]
  45. Omeljaniuk RJ, Habibi HR, Peter RE. Alterations in pituitary GnRH and dopamine receptors associated with the seasonal variation and regulation of gonadotropin release in the goldfish (Carassius auratus). Gen Comp Endocrinol 1989 74:392-399[CrossRef][Medline]
  46. Batten TF, Berry PA, Maqbool A, Moons L, Vandesande F. Immunolocalization of catecholamine enzymes, serotonin, dopamine and L- dopa in the brain of Dicentrarchus labrax (Teleostei). Brain Res Bull 1993 31:233-252[CrossRef][Medline]
  47. Anglade I, Pakdel F, Bailhache T, Petit F, Salbert G, Jego P, Valotaire Y, Kah O. Distribution of estrogen receptor-immunoreactive cells in the brain of the rainbow trout (Oncorhynchus mykiss). J Neuroendocrinol 1994 6:573-583[CrossRef][Medline]
  48. Rodriguez-Gomez FJ, Rendon-Unceta MC, Sarasquete C, Muñoz-Cueto JA. Localization of tyrosine hydroxylase-immunoreactivity in the brain of the Senegalese sole, Solea senegalensis. J Chem Neuroanat 2000 19:17-32[CrossRef][Medline]
  49. Linard B, Anglade I, Corio M, Navas JM, Pakdel F, Saligaut C, Kah O. Estrogen receptors are expressed in a subset of tyrosine hydroxylase-positive neurons of the anterior preoptic region in the rainbow trout. Neuroendocrinology 1996 63:156-165[Medline]
  50. Prat F, Zanuy S, Carrillo M. 2001. Effect of gonadotropin-releasing hormone analogue (GnRHa) and pimozide on plasma levels of sex steroids and ovarian development in sea bass (Dicentrarchus labrax L). Aquaculture 2001 198:325-338[CrossRef]
  51. Anglade I, Zandbergen T, Kah O. Origin of the pituitary innervation in the goldfish. Cell Tissue Res 1993 273:345-355[CrossRef]
  52. Teitsma C, Lethimonier C, Tujague M, Anglade I, Saligaut D, Bailhache T, Pakdel F, Kah O, Ducouret B. Identification of potential sites of cortisol actions on the reproductive axis in rainbow trout. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 1998 119:243-249[CrossRef][Medline]
  53. Cerda-Reverter JM, Anglade I, Martinez-Rodriguez G, Mazurais D, Muñoz-Cueto JA, Carrillo M, Kah O, Zanuy S. Characterization of neuropeptide Y expression in the brain of a perciform fish, the sea bass (Dicentrarchus labrax). J Chem Neuroanat 2000 19:197-210[CrossRef][Medline]
  54. Cerda-Reverter JM, Martinez-Rodriguez G, Anglade I, Kah O, Zanuy S. Peptide YY (PYY) and fish pancreatic peptide Y (PY) expression in the brain of the sea bass (Dicentrarchus labrax) as revealed by in situ hybridization. J Comp Neurol 2000 426:197-208[CrossRef][Medline]
  55. Batten TF, Moons L, Cambre M, Vandesande F. Anatomical distribution of galanin-like immunoreactivity in the brain and pituitary of teleost fishes. Neurosci Lett 1990 111:12-17[CrossRef][Medline]
  56. Breton B, Mikolajczyk T, Popek W, Bieniarz K, Epler P. Neuropeptide Y stimulates in vivo gonadotropin secretion in teleost fish. Gen Comp Endocrinol 1991 84:277-283[CrossRef][Medline]
  57. Cerda-Reverter JM, Sorbera LA, Carrillo M, Zanuy S. Energetic dependence of NPY-induced LH secretion in a teleost fish (Dicentrarchus labrax). Am J Physiol 1999 277:R1627-R1634
  58. Peng C, Trudeau VL, Peter RE. Seasonal variation of neuropeptide Y actions on growth hormone and gonadotropin-II secretion in the goldfish: effects of sex steroids. J Neuroendocrinol 1993 5:273-280[CrossRef][Medline]
  59. Li C, Chen P, Smith MS. Morphological evidence for direct interaction between arcuate nucleus neuropeptide Y (NPY) neurons and gonadotropin-releasing hormone neurons and the possible involvement of NPY Y1 receptors. Endocrinology 1999 140:5382-5390[Abstract/Free Full Text]
  60. Gothilf Y, Muñoz-Cueto JA, Sagrillo CA, Selmanoff M, Chen TT, Kah O, Elizur A, Zohar Y. Three forms of gonadotropin-releasing hormone in a perciform fish (Sparus aurata): complementary deoxyribonucleic acid characterization and brain localization. Biol Reprod 1996 55:636-645[Abstract]
  61. Johnston SA, Maler L. Anatomical organization of the hypophysiotrophic systems in the electric fish, Apteronotus leptorhynchus. J Comp Neurol 1992 317:421-437[CrossRef][Medline]
  62. Kim YS, Stumpf WE, Sar M. Topography of estrogen target cells in the forebrain of goldfish, Carassius auratus. J Comp Neurol 1978 182:611-620[CrossRef][Medline]
  63. Demski LS, Dulka JG. Thalamic stimulation evokes sex-color change and gamete release in a vertebrate hermaphrodite. Experientia 1986 42:1285-1287[CrossRef][Medline]
  64. Munz H, Claas B, Stumpf WE, Jennes L. Centrifugal innervation of the retina by luteinizing hormone releasing hormone (LHRH)-immunoreactive telencephalic neurons in teleostean fishes. Cell Tissue Res 1982 222:313-323[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
N. Moncaut, G. Somoza, D. M Power, and A. V M Canario
Five gonadotrophin-releasing hormone receptors in a teleost fish: isolation, tissue distribution and phylogenetic relationships
J. Mol. Endocrinol., June 1, 2005; 34(3): 767 - 779.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)