Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print January 14, 2004.
Biol Reprod 2004, 10.1095/biolreprod.103.025346
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/5/1400    most recent
biolreprod.103.025346v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.
Agricola
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.
BIOLOGY OF REPRODUCTION 70, 1400–1410 (2004)
DOI: 10.1095/biolreprod.103.025346
© 2004 by the Society for the Study of Reproduction, Inc.


Testis

The Acroplaxome Is the Docking Site of Golgi-Derived Myosin Va/Rab27a/b- Containing Proacrosomal Vesicles in Wild-Type and Hrb Mutant Mouse Spermatids1

Abraham L. Kierszenbaum2,3, Laura L. Tres3, Eugene Rivkin3, Ningling Kang-Decker4, and Jan M. A. van Deursen4

Department of Cell Biology and Anatomical Sciences,3 The Sophie Davis School of Biomedical Education/City University of New York Medical School, New York, New York 10031 Department of Pediatrics and Adolescent Medicine,4 Mayo Clinic, Rochester, Minnesota 55905


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Acrosome biogenesis involves the transport and fusion of Golgi-derived proacrosomal vesicles along the acroplaxome, an F-actin/keratin 5-containing cytoskeletal plate anchored to the spermatid nucleus. A significant issue is whether the acroplaxome develops in acrosomeless mutant mice. Male mice with a Hrb null mutation are infertile and both spermatids and sperm are round-headed and lack an acrosome. Hrb, a protein that contains several NPF motifs (Asn-Pro-Phe) and interacts with proteins with Eps15 homology domains, is regarded as critical for the docking and/or fusion of Golgi-derived proacrosomal vesicles. Here we report that the lack of an acrosome in Hrb mutant spermatids does not prevent the development of the acroplaxome. Yet the acroplaxome in the mutant contains F-actin but is deficient in keratin 5. We also show that the actin-based motor protein myosin Va and its receptor, Rab27a/b, known to be involved in vesicle transport, are present in the Golgi and Golgi-derived proacrosomal vesicles in wild-type and Hrb mutant mouse spermatids. In the Hrb mutant, myosin-Va-bound proacrosome vesicles tether to the acroplaxome, where they flatten and form a flat sac, designated pseudoacrosome. As spermiogenesis advances, round-shaped spermatid nuclei of the mutant display several nuclear protrusions, designated nucleopodes. Nucleopodes are consistently found at the acroplaxome- pseudoacrosome site. Our findings support the interpretation that the acroplaxome provides a focal point for myosin-Va/ Rab27a/b-driven proacrosomal vesicles to accumulate, coalesce, and form an acrosome in wild-type spermatids and a pseudoacrosome in Hrb mutant spermatids. We suggest that nucleopodes develop at a site where a keratin 5-deficient acroplaxome may not withstand tension forces operating during spermatid nuclear shaping.

male sexual function, sperm, spermatid, spermatogenesis, testis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Spermiogenesis is a fundamental process required for the generation of the male gamete with a specialized acrosome and tail, both necessary for fertilization. Nuclear elongation and condensation are two additional characteristics of the developing spermatid. A transient manchette, consisting of a perinuclear ring and inserted microtubules, encircles the nucleus and develops caudally to the acrosome. How the correct polarity of the acrosome, manchette, and axoneme becomes established remains undefined. Spermatid nuclear shaping has been traditionally linked to the perinuclear acrosome and manchette. Support for this assumption derives to a great extent from mouse mutants, which lack an acrosome and consistently give rise to round-headed spermatids and sperm (e.g., the blind-sterile mouse mutant [1] and reviewed by Escalier [2]). Acrosome biogenesis starts early in spermiogenesis when sorted proacrosomal vesicles, derived from the Golgi apparatus, fuse with each other to form an acrosome sac tightly bound to the nuclear envelope (reviewed in [3]). It has been suggested that the final shape and size of the acrosome involve vesicular transport shuttling from the Golgi to the acrosome coupled with vesicle retrieval [4]. How Golgi-derived proacrosomal vesicles are mobilized toward a precise site is not understood. It is compelling to think that a perturbation in acrosome biogenesis may impact on the assembly site of the manchette and consequently on spermatid nuclear shaping. A lack of acrosome development in Hrb-deficient mice [5] and GOPC- deficient mice [6] correlates with the development of round-headed sperm. Hrb, a protein (also called Rab or hRip), binds to the cytosolic surface of proacrosomal transporting vesicles [5]. A lack of Hrb prevents vesicles from fusing and forming the acrosome. GOPC is associated with the trans-Golgi region in round spermatids and a lack of GOPC hinders vesicle transport from the Golgi apparatus to the acrosome. Yet the question whether a developmentally arrested acrosome by itself is responsible for generating round-headed sperm proves difficult to answer.

We have recently reported that the acrosome of rat and mouse spermatids is anchored to a cytoskeletal plate, called the acroplaxome [7]. The acroplaxome contains an F-actin- keratin 5/complex and is attached to a nuclear lamina, which is associated with the spermatid inner membrane of the nuclear envelope. The acroplaxome displays a marginal ring at the descending leading edge of the acrosome, which seems to guide the caudal descent of the acrosome. The ring consists of two opposite plaques: the acrosome dense plaque, which is bound to the inner acrosome membrane and is the insertion site of K5-containing filaments, and the nuclear dense plaque, a focal thickening of the nuclear lamina. The molecular nature of the nuclear lamina and plaques has not been determined. The marginal ring also contains myosin-Va, thus suggesting a role of this motor protein in connecting the acrosome to the F-actin network during spermatid nuclear shaping [8]).

Here we report that a K5-deficient acroplaxome develops in the Hrb mutant spermatids and that myosin-Va/Rab27a/ b-bound proacrosomal vesicles, derived from the medullary region of the Golgi apparatus, dock along the acroplaxome of wild-type and Hrb-deficient mutant spermatids. Proacrosomal vesicles coalesce into an acrosome in the wild- type, and a flat pseudoacrosomal sac develops in the Hrb- deficient mutant. As spermiogenesis progresses, two deformities of the round-shaped spermatid nucleus were observed: nuclear peglike projections (designated nucleopodes, from Greek, podos, foot-shaped) at the acroplaxome site and a deep nuclear indentation opposite to the acroplaxome harboring bundles of manchette microtubules.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Experiments using live animals were carried out according to National Research Council animal care and welfare guidelines and were approved by the IACUC committee at the City College of New York/The Sophie Davis School of Biomedical Education.

Reverse Transcription-Polymerase Chain Reaction Analysis of Hrb-Deficient Mutant Mice

Total RNA was isolated from testis of wild-type and Hrb-deficient mice (generated as described, Kang-Decker et al. [5]) using TRI reagent (Molecular Research Center, Cincinnati, OH). Total RNA (1–5 mg) was used as a template for first-strand cDNA synthesis using oligo (dT) as a primer, in the presence of Superscript II RNase H-Reverse Transcriptase (Life Technologies, GIBCO-BRL, Gaithersburg, MD). One ml of each cDNA was used as a template for the PCR reaction with the following primers: K5: forward (F) 5,GAGCAGATCAAGACCCCTAACAA and reversed (R), 5,ATCTCCACGTCCAGGGCCA [7]; GOPC F, CGGACCGGCGGACATCACTTAT, and R, TGCCGGCCAGCTCCTTATCC [6]; Myo5a F, GGCGCCATCACCCTAAACA, and R, GTGCGGATAAATGAAACTGAGACC [9]. Amplified products were separated on a 1.2% agarose gel and sequenced. Hi-Lo DNA Markers (Minnesota Molecular Inc., Minneapolis, MN) were used for size determination.

Indirect Immunofluorescence

Testes of wild-type mice and Hrb-deficient mouse mutant (Hrb–/–) were analyzed. For immunocytochemistry, seminiferous tubular fragments were used to collect spermatogenic cells as reported [10]. Briefly, segments (3–4 mm in length) sectioned with a surgical blade were placed in a drop of 3.7% paraformaldehyde (electron microscopy grade) in 0.1 M sucrose in phosphate buffer, pH 7.4, on microscope slides coated with Vectabond (Vector Laboratories, Burlingame, CA). Specimens were fixed for 15 min at room temperature and then a coverglass was gently placed on top of the preparation and kept at 4°C for 30 min before removing the coverglass and processing the samples for immunocytochemistry. In some experiments, cells were extracted with 0.5% Triton X-100 in 0.1 M sucrose for 30 sec and then fixed as indicated above. Cells were immunoreacted with {alpha}-tubulin monoclonal antibody (working dilution: 1:100; Sigma, St. Louis, MO), an affinity-purified myosin-Va polyclonal antibody specific for the globular tail region of myosin-Va (AB5887P; working dilution: 1: 50; Chemicon International, Temecula, CA), a Rab27a/b rabbit polyclonal antibody (a generous gift from Miguel C. Seabra, Imperial College School of Medicine, London, UK), and anti-Golgi protein 58K monoclonal antibody (G2404; working dilution: 1:50; Sigma), followed by anti-mouse IgG conjugated with rhodamine, or anti-rabbit IgG conjugated with fluorescein isothiocyanate (working dilution: 1:200; Jackson Immunoresearch Laboratories, West Grove, PA). Acrosomes were decorated with peanut agglutinin (PNA) Alexa Fluor 488 conjugate (Molecular Probes, Eugene, OR) as reported previously [7, 11]. Staining specificity of anti-myosin-Va serum was determined by immunoblotting using rat nervous tissue (hypothalamus), known to contain abundant myosin-Va-bound neuronal synaptic vesicles. Specimens were mounted with Vectashield (Vector Laboratories) containing propidium iodide to detect nucleic acids.

Transmission and Immunogold Electron Microscopy

Testis samples were used for transmission electron microscopy and immunogold electron microscopy. For transmission electron microscopy, samples were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 6.9), postfixed in 2% osmium tetroxide in the same buffer, and embedded in a plastic resin according to a standard procedure. Sections were stained with 5% uranyl acetate in methanol followed by lead citrate. For immunogold electron microscopy, samples were fixed in a mixture of 1.5% glutaraldehyde and 3.4% paraformaldehyde (electron microscope grade) in 0.1 M phosphate buffer, pH 7.2, embedded in Lowicryl K4M (Polysciences, Warrington, PA), and processed for immunogold microscopy as recently updated [7]. Anti-K5 polyclonal affinity-purified sera (generated against the peptide KAQYEDIAQK, corresponding to the 2A region of the {alpha}-helical rod domain, and peptide LEGQECRLSGEGVG, corresponding to the beginning of the tail domain (see [7] for additional details) and ß-actin monoclonal (mouse) antibodies (Sigma) were used at working dilutions of 1:100 in PBS containing 0.1% Tween-20, 1% bovine serum albumin, and 1% goat serum. Affinity-purified anti-myosin-Va antiserum (rabbit; Chemicon) was used at a working dilution of 1:50. Bound antibody was detected by incubating the sample overnight at 4°C with goat anti-rabbit IgG or anti-mouse IgG conjugated with 10-nm gold particles (Amersham, Arlington Heights, IL), using a 1:50 working dilution. Sections were stained for 5 min with 5% uranyl acetate in deionized water, and specimens were examined using a JEM-100CX transmission electron microscope (JEOL, Tokyo, Japan) operated at an accelerating voltage of 60 kV.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Acroplaxome of the Hrb-Deficient Mouse Mutant Is K5 Deficient

We have previously shown that the acroplaxome anchors the acrosome to the spermatid nuclear envelope in wild- type mice and normal rats [7]. The components of the acroplaxome and its marginal ring in a wild-type mouse spermatid are illustrated in Figure 1A. The marginal ring of the acroplaxome displays an intermediate filament bundle anchored to a dense plaque associated with the inner acrosomal membrane. Acrosomeless spermatids of the Hrb–/– mutant display an acroplaxome plaque associated with a flat sac (designated pseudoacrosome). The acroplaxome- pseudoacrosome complex is attached to the spermatid nuclear envelope, the inner membrane of which is lined by a relatively thin nuclear lamina (15–20 nm thick; Fig. 1, B and C) when compared with wild-type spermatids (50 nm thick). A striking difference with the wild-type is that the marginal ring of the acroplaxome in the Hrb–/– mutant lacks both the K5-containing filament bundle and associated dense plaque (compare Fig. 1A with Fig. 1, B and C). In some spermatids, the length of the pseudoacrosome exceeds the length of the acroplaxome and diverges from it, creating a space where the microtubule-nucleating element of the manchette is housed (Fig. 1C). In other spermatids, the pseudoacrosome length is shorter than the acroplaxome (see Fig. 7I). In contrast, the length of the acrosome and underlying acroplaxome is essentially equal in wild-type spermatids [7].



View larger version (149K):
[in this window]
[in a new window]
 
FIG. 1. Structure of the acroplaxome in wild-type and Hrb-deficient mutant mice. A) The acroplaxome (Apx) of a wild-type mouse spermatid links the acrosome (Acr) to the spermatid nucleus. The dashed box indicates the marginal ring of the acroplaxome. The black arrowheads point to cross- sectioned intermediate filaments attached to the dense acrosome plaque associated with the inner acrosome membrane (IAM). Note that the marginal ring occupies a shallow depression in the nuclear envelope bordered by a dense nuclear plate, continuous with the nuclear lamina (associated with the inner membrane of the nuclear envelope). OAM, Outer acrosome membrane. White arrowheads, microtubules in cross-section. B) Hrb-deficient spermatid. The acroplaxome (Apx) links a flat and narrow sac, the pseudoacrosome (p-Acr) to the spermatid nuclear envelope. The dashed box indicates the expected position of the marginal ring of the acroplaxome. Note that the acrosome plate, the inserted intermediate filaments, and the shallow depression in the nuclear envelope are not present. The nuclear lamina is thinner. C) Hrb-deficient spermatid. The length of the pseudoacrosome (white arrowhead) extends beyond the boundary of the acroplaxome (black arrowhead, Apx). The dashed box indicates the expected location of the marginal ring. The circle indicates a microtubule nucleating density corresponding to the manchette.



View larger version (126K):
[in this window]
[in a new window]
 
FIG. 7. Nuclear indentation and ectopic manchette in the Hrb-deficient mouse mutant. AD) An {alpha}-tubulin-stained manchette microtubule bundle (white arrow) emerges from the nuclear indentation (dashed white arrow) in correlation with an equivalent transmission electron microscopy view shown in E. The arrowheads indicate a nucleopode cluster. E) Apx, Acroplaxome extending between arrowheads. The dashed arrow indicates the nucleating region of the manchette microtubule bundle. The circle indicates a cross-section of a cytoplasmic-embedded developing tail. FH) The {alpha}-tubulin-decorated manchette microtubules (dashed arrow) surround the round-shaped spermatid nucleus (arrowhead) and extend into the caudal cytoplasm. Note the significant length of the manchette (arrows). I) Like in E, a nuclear indentation houses manchette microtubules extending from a diffuse nucleating zone (dashed arrow). The length of the pseudoacrosome (between arrowheads) is shorter than the length of the underlying acroplaxome (between white arrows). The head-to-tail coupling apparatus (HTCA) is linked at an angle to the implantation fossa. The oval indicates the manchette microtubule nucleating density at the plasma membrane. Microtubules are descending lateral to the nucleus, in correlation with the image seen in G and H

Myosin-Va Decorates Golgi-Derived Proacrosomal Vesicles, Which Tether to the Acroplaxome

Figure 2, A and B, displays a step 4 spermatid of a Hrb–/– mouse. The Golgi apparatus consists of a cortical region (designated the cortex, containing a stack of saccules [3]) and an inner region (designated the medulla [3]) with abundant proacrosome vesicles. A string of Golgi-derived proacrosome vesicles, some of them with a dense content, are aligned along the acroplaxome plaque. A detailed view of the vesicle-acroplaxome relationship at the marginal ring demonstrates a single vesicle settled in a nuclear depression corresponding to the marginal ring of the acroplaxome (Fig. 2B). Neither the inner acrosome membrane-bound dense plate nor the associated intermediate filaments bundle are visualized. Like in the wild-type mouse (Fig. 1A), the acroplaxome in the Hrb–/– mutant appears anchored to a subjacent nuclear lamina lining the inner side of the nuclear envelope (Fig. 2B). However, the nuclear lamina in the mutant is thinner.



View larger version (158K):
[in this window]
[in a new window]
 
FIG. 2. Tethering of proacrosomal vesicles along the acroplaxome. A) Hrb-deficient spermatid with a well-developed Golgi complex consisting of a stack of saccules (the cortex) and clustered vesicles (the medulla) in the juxtanuclear face of Golgi. Some of the vesicles, with or without dense content, are aligned along the acroplaxome. B) Enlarged view of the area indicated with a dashed box in A. The white arrowheads indicate proacrosomal vesicles bound to the acroplaxome (Apx) or coalescing with a large proacrosome vesicle. A large vesicle with dense content occupies a shallow depression in the nucleus (indicated by an arrow). A narrow nuclear lamina is observed under the Apx and differs in density with chromatin associated with the adjacent nuclear envelope (ne).

Next, we investigated whether myosin-Va and its receptor Rab27a/b could be involved in the mobilization of proacrosome vesicles from the inner region of the Golgi apparatus to the acroplaxome. To explore this possibility, we disrupted, by sucrose hypotonic treatment and brief Triton X-100 extraction, the cytoplasm of wild-type and Hrb–/– spermatids collected from seminiferous tubules. With this procedure, most of the cytoplasm is removed, leaving relatively intact the Golgi apparatus, proacrosomal vesicles, acrosome, and acroplaxome attached to the spermatid nucleus [7]. With phase-contrast microscopy, the Golgi apparatus in wild-type and Hrb mutant spermatids display a cortical dense region (corresponding to the stack of saccules) and a less dense inner region (where proacrosome vesicle accumulate; see Fig. 3, C, G, K, O, S, and W). Figure 3, A to D, illustrates the presence of myosin- Va immunoreactivity restricted to the inner region of the Golgi apparatus of a Hrb–/– step 3 spermatid. During step 4 of spermiogenesis, the inner region of the Golgi, as well as a linear immunoreactive pattern along the acroplaxome, stain strongly with anti-myosin-Va (Fig. 3, E–H). During step 5, the linear immunoreactive pattern in Hrb mutant spermatids extended further along the acroplaxome (Fig. 3, I–L). Insets in Figure 3L illustrate a step 5 wild-type spermatid stained with anti-myosin-Va serum. Contrasting with the linear immunoreactive pattern in the Hrb mutant, the wild-type spermatid displays an arrangement compatible with the early stage of acrosome biogenesis. Rab27a/b immunoreactive sites in the inner region of the Golgi and the proximal site of the developing acrosome correlated with the distribution of myosin Va immunoreactivity (step 6 spermatid; Fig. 3, M–P).



View larger version (80K):
[in this window]
[in a new window]
 
FIG. 3. Myosin-Va- and Rab27a/b immunoreactivity of the Golgi and proacrosomal vesicles in wild-type and Hrb-mutant mouse spermatids. Sucrose hypotonic-Triton X-100-treated samples (see Materials and Methods). AL) Spermatid of a Hrb-deficient mutant mouse stained with affinity-purified anti-myosin-Va polyclonal antibody and propidium iodide to visualize nucleic acids. AD) Step 3 spermatid. A) Diffuse staining predominant in the medullary region of the Golgi complex (denoted by a dotted linear outline). The cortical (denser) region is indicated by a white arrowhead. B) Propidium iodide staining of the nucleus. C) Phase-contrast microscopy. D) Merge of A and C. EH) Step 4 spermatid. E) Shows that the juxtanuclear portion of the medullary region of the Golgi and a linear immunoreactive pattern, presumably a pseudoacrosome (p-Acr). IL) Step 5 spermatid. As in EH. Insets to L illustrate a step 5 wild-type spermatid displaying the early stages of acrosome (Acr) biogenesis. MP) Wild-type mouse spermatid (step 6) showing Rab27a/b immunoreactivity in the Golgi and the adjacent portion of the developing acrosome. The arrow with an open circle points to a proacrosomal vesicle in transit. The arrowheads in O and P point to the edge of the acrosome (Acr). QT) Wild-type mouse spermatid (step 6) displaying a PNA-stained acrosome (Acr). The Golgi apparatus is not stained. The arrowheads in S and T point to the edge of the acrosome (Acr). UY) Wild-type mouse spermatid (step 5) stained with anti-Golgi 58K protein. The cortical region of the Golgi is preferentially decorated (white arrowhead). The acrosome is not significantly stained. Scale bars = 1 µm

The microscopic characteristics of the acrosome and cortical and medullary region of the Golgi apparatus were determined by labeling with PNA Alexa Fluor 488 conjugate (step 6 wild-type spermatids; Fig. 3, Q–T), known to selectively label the acrosome [7, 11]. A step 6 wild-type spermatid displays a relatively conspicuous PNA-stained acrosome sac (Fig. 3Q) not observed in the Hrb mutant (data not shown). Anti-Golgi 58K protein monoclonal antibody decorates the cortical region of the Golgi of a step 5 wild-type spermatid (Fig. 3, U–Y). In contrast, the medullary region, where proacrosome vesicles accumulate, is less stained. We concluded that hypotonic-treated and briefly Triton X-100-extracted spermatids provide both adequate resolution and a convenient approach for tracing the possible pathway of myosin-Va and Rab27a/b-decorated proacrosomal vesicles by combined phase-contrast and fluorescence microscopy.

F-actin, But Not K5 Immunoreactive Sites, Is Visualized in the Acroplaxome of the Hrb-Deficient Mutant

Previously reported immunogold electron microscopy data indicated that the spermatid acroplaxome of wild-type mice and normal rats contains both F-actin and K5 [7]. Figure 4A shows that, in wild-type mice, the acroplaxome and the F-actin-containing Sertoli cell ectoplasmic region are adjacent to each other and both display ß-actin immunoreactivity. The ß-actin immunoreactive acroplaxome and Sertoli cell F-actin bundles can also be detected in the Hrb–/– mutant (Fig. 4C). However, F-actin bundles of the Sertoli cell ectoplasmic region are less conspicuous when compared with the wild-type mouse (Fig. 4A). Furthermore, Sertoli cell F-actin-containing bundles are separated from the acroplaxome by a relatively wide spermatid cytoplasm. In correlation with immunofluorescence data, Figure 4E illustrates a linear distribution of myosin-Va immunoreactivity along the pseudoacrosome of a Hrb-deficient spermatid. In a step 3 wild-type spermatid, myosin- Va predominates in proacrosome vesicles clustered in the medullary region of the Golgi and along the membrane of the developing acrosome (Fig. 4F).



View larger version (138K):
[in this window]
[in a new window]
 
FIG. 4. Immunogold electron microscope localization of ß-actin, K5, and myosin-Va in wild-type and Hrb-deficient mutant spermatids. A) Wild-type spermatid displaying ß-actin immunoreactive sites in F-actin bundles present in Sertoli cell ectoplasmic region (white arrows) and the acroplaxome (Apx; black arrowheads). The asterisks indicate the perinuclear ring of the manchette. B) Hrb-deficient mutant. ß-Actin localization in the acroplaxome (arrowheads). C) ß-Actin localization in a condensing Hrb-deficient spermatid nucleus. The white arrows indicate the immunoreactive F-actin bundles in the Sertoli cell ectoplasm. The double-headed arrows indicate the space between the spermatid nucleus and the ectoplasmic bundles. D) K5 localization in a Hrb-deficient spermatid. The acroplaxome (Apx) is not immunoreactive. The manchette displays immunoreactivity. E) Myosin-Va immunoreactive sites are visualized along the pseudoacrosome (p- Acr) and vesicles (arrowheads) associated with the acroplaxome (Apx) in an Hrb-deficient spermatid. F) Step 3 wild-type spermatid. Myosin-Va immunoreactive sites predominate in vesicles of the medullary region of the Golgi and along the membrane of a developing acrosome (Acr)

An unforeseen finding was the lack of K5 immunoreactivity in the acroplaxome of the Hrb–/– mutant, yet the affinity-purified K5 antibody stained microtubules of the manchette (Fig. 4D), as previously reported [12]. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrates that the epidermis and testis of the Hrb–/– mutant express K5 transcripts (Fig. 5A). Therefore, we disregarded the possibility that the absence of K5 in the acroplaxome was determined by defective gene expression in the Hrb- deficient mutant. Because spermatids of both GOPC- and Hrb-mutant mice lack an acrosome due to a vesicle fusion defect [5, 6], we searched for the expression of GOPC transcripts in the Hrb–/– mutant. Figure 5B demonstrates that GOPC mRNA is present. The expression of myosin-Va transcripts in wild-type and Hrb-mutant testes was also determined by RT-PCR (Fig. 5C). The specificity of the affinity purified anti-myosin-Va serum was verified by detecting a 190-kDa band in immunoblots of rat hypothalamus lysate, known to contain neuronal vesicles enriched with myosin-Va (Fig. 5D). A similar, yet weak, myosin-Va immunoreactive band was observed in testicular lysates (data not shown).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. RT-PCR of K5, GOPC, and myosin-Va and immunoblotting verifying anti-myosin-Va-specific immunoreactivity. A) K5 transcripts are present in the epidermis and testis of Hrb-deficient mutant mice. B) GOPC transcripts are present in testis of the Hrb-deficient mutant. C) Myosin-Va transcripts are present in both wild-type and Hrb-deficient mouse testis. D) Immunoblotting of hypothalamus lysate showing a distinct 190-kDa protein band corresponding to myosin-Va

Nucleopodes in the Hrb-Deficient Mutant Are Restricted to the Acroplaxome

The pseudoacrosome-acroplaxome region of late spermatids of the Hrb–/– mutant displays a variable number of peglike nucleopodes extending from the spermatid nucleus into the cytoplasm. The expanded portion of each nucleopode is covered by the acroplaxome-pseudoacrosome complex (Fig. 6, A and B). In sections with a favorable orientation, nucleopodes can be seen connected to the main nucleus by a narrow stalk (Fig. 6B). About 90% of the propidium iodide-stained spermatid nuclei collected from seminiferous tubules display nucleopodes adjacent to the round-shaped spermatid nucleus (Fig. 7, B–D). Nucleopodes are still visible in epididymal sperm (our unpublished observation).



View larger version (142K):
[in this window]
[in a new window]
 
FIG. 6. Nucleopodes in spermatids of the Hrb-deficient mutant mouse. A) The asterisks indicate portions of nucleopodes facing the acroplaxome- pseudoacrosome complex (between arrows). Crossed arrows indicate F-actin bundles in the Sertoli cell ectoplasmic region. B) Similar to A, except that two of the three nucleopodes (asterisks) display stalks continuous with the spermatid nucleus. The acroplaxome-pseudoacrosome complex (between arrows) is associated with the nucleopodes

Microtubules of the Manchette Extendfrom a Pronounced Nuclear Indentation Oppositeto the Acroplaxome

An additional abnormality of the Hrb–/–-mutant spermatid nucleus is a deep indentation in the pole opposite to the acroplaxome (Fig. 7). {alpha}-Tubulin-stained manchette microtubule bundles extend from the nuclear notch into the spermatid cytoplasm (Fig. 7, A–E; see also Figs. 4D and 7I). The manchette in Hrb–/– spermatids is remarkably long (average length: 25 ± 2.3 µm, as compared with the average length of 10 ± 1.3 µm in wild-type mice, [9]). The manchette assembles ectopically; with its dense microtubule insertion ring anchored to the plasma membrane and microtubule bundles occupying a nuclear lateral position (Fig. 7I), partially caging the spermatid nucleus (Fig. 7, F– H). Both the abnormal assembly site of the manchette and its substantial length appear to displace the attachment of the head-to-tail connecting apparatus (HTCA) to the implantation fossa (Fig. 7I). The HTCA consists of the centrosome and associated components of the connecting piece. This displacement results in the angular position of the developing axoneme as well as a disruption of its axial growth as denoted by cross-sectioned axonemes embedded in the cytoplasm (denoted by a circle in Fig. 7E). Figure 8 is a summary diagram of the major alterations observed in Hrb-deficient spermatids.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 8. Diagrammatic representation of the acroplaxome and Sertoli cell-derived F-actin-containing hoops during nuclear elongation of wild-type and Hrb-mutant spermatids. In wild-type spermatids, F-actin-containing hoops, derived from the adjacent Sertoli cell, embrace the apical region of the spermatid elongating nucleus. The position of the perinuclear ring of the manchette, seen just below the acrosome-acroplaxome complex, is demarcated by the belt groove. The arrows in the hoops and perinuclear ring indicate the direction of the clutching forces. In acrosomeless Hrb-deficient mutant spermatids, the F-actin-containing hoops are less developed and rather distant from the spermatid nucleus. The following abnormalities are relevant: 1) nucleopodes capped by the K5-deficient acroplaxome-pseudoacrosome complex, 2) a nuclear indentation housing a manchette microtubule bundle, 3) ectopic development of the manchette, 4) failure of the belt groove to develop, and 5) angular orientation of the developing spermatid tail. Probable clutching forces generated by the acroplaxome may give raise to nucleopodes and the nuclear indentation. Diagram not to scale


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous observations in wild-type spermatids suggested a role of the acrosome-acroplaxome complex in the shaping of the mammalian spermatid nucleus as well as a determinant of the location of the manchette [7]. F-actin first appears in the cytoskeletal acroplaxome plate early in spermiogenesis (steps 3–4). K5 appears later (steps 4–5), when proacrosomal vesicles dock to the acroplaxome and coalesce to initiate acrosome biogenesis [7]. An acrosome- dense plaque, associated to the inner acrosome membrane, and a nuclear-dense plaque, continuous with the nuclear lamina, organize an acroplaxome marginal ring. The ring mimics a belt desmosomelike junction in which an actin- keratin-myosin-Va complex is present.

There are two aspects that merit discussion: the role of the acroplaxome during elongation of the spermatid nucleus and the mechanism by which Golgi-derived proacrosomal vesicles are streamed to the acroplaxome region. A convenient approach for approaching the functional significance of the acroplaxome relies on mouse mutants displaying defects in acrosome biogenesis and spermatid nuclear shaping. The Hrb mutant is a convenient model because sperm lack an acrosome and the nucleus does not elongate. Three distinct abnormalities observed in the acroplaxome of the Hrb mutant strengthen the view that the acroplaxome may participate in nuclear elongation. First, the acroplaxome marginal ring in the mutant is not apparent; it lacks both the nuclear and acrosome-dense plaques and the K5- containing intermediate filament bundles. The acrosome- dense plaque may be necessary for recruiting K5-intermediate filaments and organize, together with the nuclear- dense plaque, the marginal ring of the acroplaxome. K5 immunoreactivity was not visualized throughout the acroplaxome but was detected in the manchette as previously reported [11]. K5 transcripts were found in testes and epidermis of the Hrb mutant, thus suggesting that the K5 gene is expressed in the Hrb mutant.

Second, the thickness of the nuclear lamina, to which the acroplaxome appears to anchor, is considerably thinner. The nuclear lamina is composed of type V intermediate filaments, designated nuclear lamins, the composition of which varies according to cell type and stage of differentiation (reviewed in [13]). A reduction in the thickness of the spermatid nuclear lamina may imply that the assembly and function of the lamina may be dependent on transmembrane proteins interacting with K5. A lamin B variant in the round spermatid nuclear lamina has been reported [14] but additional components, including possible acroplaxome actin linkers to the lamina, need to be determined.

Third, the length of the pseudoacrosome does not correlate with the length of the acroplaxome (e.g., see Fig. 1C). Presumably, the length of the pseudoacrosome may be determined by the number of proacrosomal vesicles tethering to the acroplaxome. Eps15 and Ap1, two transport vesicle adaptor proteins with a role in vesicle sorting, are associated with Golgi-derived proacrosome vesicles in the Hrb mutant, [5]. Hrb and Eps15 form a complex in testis, and the medullary region of the Golgi contains subsets of proacrosomal proteins displaying different assortments of Hrb, Eps15, and Ap1. It is likely that proacrosomal vesicles establishing contact with the acroplaxome flatten into a membranous flat sac. It is not clear whether proacrosomal vesicles contain Eps15 or Ap1 or both and how these vesicles merge into the pseudoacrosome.

The second aspect relates to the transport mechanism of Golgi-derived proacrosomal vesicles. Myosin-Va-decorated proacrosomal vesicles in the medullary region of the Golgi apparatus and in vesicles aligned along the acroplaxome region in Hrb mutant and wild-type spermatids suggest a molecular motor-mediated vesicle transport. An F-actin- based myosin Va motor-driven mechanism may coexist with a microtubule-based motor, KIFC1, which was recently reported to be involved in acrosome biogenesis and vesicle transport [15]. Analogous to the microtubule motor kinesin, certain myosins, in particular class-V myosins, can mobilize a vesicular cargo along actin filaments [16]. We reasoned that the most likely candidate for actin-based proacrosomal vesicle transport might be myosin-Va. In the myosin-Va-assisted vesicle transport pathway, proacrosomal vesicles, derived from the Golgi apparatus, can be streamed and tether to the F-actin-containing acroplaxome, and finally fuse to organize the acrosome. Members of the membrane-bound Rab GTPase protein family, in particular Rab27a and Rab27b, are known to facilitate the interaction of myosin-Va with the vesicles (reviewed by Langford [17]). Rab27a is ubiquitously expressed in several tissues, but Rab27b transcripts are present in a significant amount in testis [18]. Rab27a and Rab27b transcripts are expressed in testes of wild-type [12] and Hrb-deficient mutant mice (our unpublished observation). Rab27a/b immunoreactive sites can be seen in the medullary region of the Golgi and the adjacent acrosomal sac (see Fig. 3M). Essentially, the transport of proacrosome vesicles during acrosome biogenesis may share intracellular traffic features of melanosomes in mouse melanocytes (reviewed in [19]). Like in melanosomes, myosin-Va binding to proacrosomal vesicles takes place through Rab27a and Rab27b, two isoforms that may fulfill similar functions [20]. It appears that the Hrb- deficient condition does not interfere with the myosin-Va- dependent transport of proacrosomal vesicles.

The round-head shaped and acrosomeless Hrb spermatids and the finding of nucleopodes at the acroplaxome site are significant counterparts. A potential mechanical role of the acroplaxome in spermatid nuclear shaping emerged from examination of spermatids of the azh mouse mutant [7] and offspring generated by intracytoplasmic sperm injection of azh sperm into normal adult eggs [21]. In both cases, spermatid nuclear indentations can be seen restricted to the acroplaxome. Here we report that nucleopodes develop along the K5-deficient acroplaxome in the Hrb mouse mutant. Nucleopodes may result from the failure of a malleable defective acroplaxome to restrain endogenous and/ or exogenous contractile forces operating during spermatid nuclear elongation. F-actin-containing bundles in the Sertoli cell ectoplasmic region of the Hrb-deficient mutant seem less developed when compared with the wild-type mouse (compare Fig. 4A and 4C) and are relatively distant from the acroplaxome-pseudoacrosome complex. The Sertoli cell-spermatid spatial relationship in the Hrb mutant is unaffected and transcripts of the actin-linked afadin-nectin complex (bridging the Sertoli cell-spermatid space [22]) are expressed in the mutant (our unpublished observation). In wild-type mouse spermatids, the stress-resistant acroplaxome can transmit clutching forces produced by Sertoli cell ectoplasmic F-actin hoops embracing the apical elongating spermatid nucleus (Fig. 7). In the Hrb-deficient mutant, the limited mass of the F-actin hoops, the relatively wide distance separating the hoops from the acroplaxome-pseudoacrosome complex, and the weakened nature of the K5- deficient acroplaxome could hamper the balance of clutching forces. Consequently, nuclear elongation does not occur, and round-shaped nuclei with nucleopodes and pronounced nuclear indentations arise.

Another significant observation is the ectopic assembly of considerably long manchettes in Hrb-deficient spermatids. Bundles of manchette microtubules can consistently be seen extending from deep nuclear invaginations. In wild- type mouse spermatids, microtubules of the manchette are inserted in a dense perinuclear ring, which contains keratin 9 [23] and presumably other proteins. During nuclear elongation, the perinuclear ring is located just under the descending leading edge of the acrosome-acroplaxome complex. A belt groove demarcates the boundaries between the perinuclear ring of the manchette and the acrosome-acroplaxome complex. Sertoli cell ectoplasmic F-actin bundles form contractile hoops capping the elongating spermatid head and ending at the belt groove (see Fig. 4A). In the Hrb-deficient mutant, the belt groove is missing and Sertoli cell F-actin bundles are underdeveloped (see Fig. 4C). It is not known whether the manchette assembles caudally to the acrosome in response to signaling cues derived from the already assembling acrosome. In the Hrb-deficient mutant, an ectopic manchette precludes a perinuclear clutching effect, which may account for a lack of elongation leading to the round-shaped spermatid nucleus in the mutant. In summary, we have shown that the Golgi apparatus of wild- type and Hrb mutant mouse spermatids give rise to myosin- Va-decorated proacrosomal vesicles, which tether to an F- actin-containing acroplaxome. Proacrosomal vesicles along the acroplaxome form a flat pseudoacrosome associated with an F-actin-containing but K5-deficient acroplaxome lacking a marginal ring. This sequence suggests that the assembly of the acroplaxome is independent of acrosome biogenesis and that the Hrb-deficient condition does not interfere with the mobilization of proacrosomal vesicles from the Golgi to the acroplaxome. We suggest that a K5- deficient acroplaxome is unable to modulate forces responsible for the elongation of the spermatid nucleus. Consequently, the spermatid nucleus in the mutant remains round- shaped and local nuclear deformities develop.


    ACKNOWLEDGMENTS
 
We thank Dr. Miguel C. Seabra (Department of Cell and Molecular Biology, Division of Biomedical Sciences, Imperial College School of Medicine, London, UK) for providing antibodies to Rab27b and Rab27a/b.


    FOOTNOTES
 
1 Supported by a grant from the National Institutes of Health HD37282 (A.L.K.). Back

2 Correspondence: A.L. Kierszenbaum, Department of Cell Biology and Anatomical Sciences, CUNY Medical School, Harris Hall Suite 306, 138th and Convent Avenue, New York, NY 10031. FAX: 212 650 6812; kier{at}med.cuny.edu Back

Received: 10 November 2003.

First decision: 5 December 2003.

Accepted: 5 January 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sotomayor RE, Handel MA. Failure of acrosome assembly in a male sterile mouse mutant. Biol Reprod 1986 34:171-182[Abstract]
  2. Escalier D. Failure of differentiation of the nuclear-perinuclear skeletal complex in the round-headed human spermatozoa. Int J Dev Biol 1990 34:287-297[Medline]
  3. Clermont Y, Oko R, Hermo L. Cell biology of mammalian spermiogenesis. In: Desjardins C, Ewing L (eds.), Cell and Molecular Biology of the Testis. New York: Oxford University Press; 1993:332–376
  4. Moreno RD, Ramalho-Santos J, Sutovsky P, Chan, EKL Schatten G. Vesicular traffic and Golgi apparatus dynamics during mammalian spermatogeneis: implications for acrosome architecture. Biol Reprod 2000 63:89-98[Abstract/Free Full Text]
  5. Kang-Decker N, Mantchev GT, Juneja SC, McNiven MA, van Deursen JMA. Lack of acrosome formation in Hrb-deficient mice. Science 2001 294:1531-1533[Abstract/Free Full Text]
  6. Yao R, Ito C, Natsume Y, Sugitani Y, Yamanaka H, Kuretake S, Yanagida K, Sato A, Toshimori K, Noda T. Lack of acrosome formation in mice lacking Golgi protein, GOPC. Proc Natl Acad Sci U S A 2002 99:11211-11216[Abstract/Free Full Text]
  7. Kierszenbaum AL, Rivkin E, Tres LL. Acroplaxome, an F-actin-keratin-containing plate, anchors the acrosome to the nucleus during shaping of the spermatid head. Mol Biol Cell 2003 14:4628-4640[Abstract/Free Full Text]
  8. Kierszenbaum AL, Rivkin E, Tres LL. The actin-based motor myosin Va is a component of the acroplaxome, an acrosome-nuclear envelope junctional plate, and of manchette associated vesicles. Cytogenetic Genome Res; (in press)
  9. Mercer JA, Seperack PK, Strobel MC, Copeland NG, Jenkins NA. Novel myosin heavy chain encoded by murine dilute coat colour locus. Nature 1991 349:709-713[CrossRef][Medline]
  10. Mochida K, Tres LL, Kierszenbaum AL. Structural and biochemical features of fractionated spermatid manchettes and sperm axonemes of the azh/azh mutant mouse. Mol Reprod Dev 1999 52:434-444[CrossRef][Medline]
  11. Szász F, Sirivaidyapong S, Cheng FP, Voorhout WF, Marks A, Colenbrander B, Solti L, Gadella BM. Detection of calcium ionophore induced membrane changes in dog sperm as a simple method to predict cryopreservability of dog semen. Mol Reprod Dev 2000 55:289-298[CrossRef][Medline]
  12. Tres LL, Kierszenbaum AL. Sak57, an acidic keratin initially present in the spermatid manchette before becoming a component of paraaxonemal structures of the developing tail. Mol Reprod Dev 1996 44:395-407[CrossRef][Medline]
  13. Shumaker DK, Kuczmarski ER, Goldman RD. The nucleoskeleton: lamins and actin are major players in essential nuclear functions. Curr Opin Cell Biol 2003 15:358-366[CrossRef][Medline]
  14. Moss SB, Burnham BL, Bellve AR. The differential expression of lamin epitopes during mouse sprematogenesis. Mol Reprod Dev 1993 34:164-174[CrossRef][Medline]
  15. Yang WX, Sperry AO. C-terminal kinesin motor KIFC1 participates in acrosome biogenesis and vesicle transport. Biol Reprod 2003 69:1719-1729[Abstract/Free Full Text]
  16. Titus MA. Motor proteins: myosin V, the multipurpose transport motor. Curr Biol 1997; 7:301-304
  17. Langford GM. Myosin-V, a versatile motor for short-range vesicle transport. Traffic 2002 3:859-865[CrossRef][Medline]
  18. Chen D, Guo J, Miki T, Tachibana M, Gahl WA. Molecular cloning and characterization of Rab27a and Rab27b, novel human Rab proteins shared by melanocytes and platelets. Biochem Molec Med 1997 60:27-37[CrossRef][Medline]
  19. Seabra MC, Mules EH, Hume AN. Rab GTPases, intracellular traffic and disease. Trends Molec Med 2002 8:23-30
  20. Ramalho JS, Tolmachova T, Hume AN, McGuigan A, Gregory-Evans CY, Huxley C, Seabra MC. Chromosomal mapping, gene structure and characterization of the human and murine RAB27B gene BMC. Genetics 2001 2:2
  21. Akutsu H, Tres LL, Tateno H, Yanagimachi R, Kierszenbaum AL. Offspring from normal mouse oocytes injected with sperm heads from the azh/azh mouse display more severe sperm tail abnormalities than the original mutant. Biol Reprod 2001 64:249-256[Abstract/Free Full Text]
  22. Takai Y, Nakanishi H. Nectin and afadin: novel organizers on intercellular junctions. J Cell Sci 2003 116:17-27[Abstract/Free Full Text]
  23. Mochida K, Rivkin E, Gil M, Kierszenbaum AL. Keratin 9 is a component of the perinuclear ring of the manchette in rat spermatids. Dev Biol 2000 227:510-519[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
K.-F. Lee, Y.-T. Tam, Y. Zuo, A. W.Y. Cheong, R. T.K. Pang, N. P.Y. Lee, C. K.Y. Shum, P.-C. Tam, A. N.Y. Cheung, Z.-M. Yang, et al.
Characterization of an acrosome protein VAD1.2/AEP2 which is differentially expressed in spermatogenesis
Mol. Hum. Reprod., August 1, 2008; 14(8): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. R. Mountjoy, W. Xu, D. McLeod, D. Hyndman, and R. Oko
RAB2A: A Major Subacrosomal Protein of Bovine Spermatozoa Implicated in Acrosomal Biogenesis
Biol Reprod, August 1, 2008; 79(2): 223 - 232.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
A.H.D.M. Dam, I. Feenstra, J.R. Westphal, L. Ramos, R.J.T. van Golde, and J.A.M. Kremer
Globozoospermia revisited
Hum. Reprod. Update, January 1, 2007; 13(1): 63 - 75.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
W.-X. Yang, H. Jefferson, and A. O. Sperry
The Molecular Motor KIFC1 Associates with a Complex Containing Nucleoporin NUP62 That Is Regulated During Development and by the Small GTPase RAN
Biol Reprod, April 1, 2006; 74(4): 684 - 690.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. C. Juneja and J. M. van Deursen
A mouse model of familial oligoasthenoteratozoospermia
Hum. Reprod., April 1, 2005; 20(4): 881 - 893.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Yu, N. Sanchez-Velar, I. E. Catrina, E. L. W. Kittler, E. B. Udofia, and M. L. Zapp
The cellular HIV-1 Rev cofactor hRIP is required for viral replication
PNAS, March 15, 2005; 102(11): 4027 - 4032.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H. Obermann, I. Raabe, M. Balvers, B. Brunswig, W. Schulze, and C. Kirchhoff
Novel testis-expressed profilin IV associated with acrosome biogenesis and spermatid elongation
Mol. Hum. Reprod., January 1, 2005; 11(1): 53 - 64.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. Stinchcombe, G. Bossi, and G. M. Griffiths
Linking Albinism and Immunity: The Secrets of Secretory Lysosomes
Science, July 2, 2004; 305(5680): 55 - 59.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
70/5/1400    most recent
biolreprod.103.025346v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.
Agricola
Right arrow Articles by Kierszenbaum, A. L.
Right arrow Articles by van Deursen, J. M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS