| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Testis |
Department of Cell Biology and Anatomical Sciences,3 The Sophie Davis School of Biomedical Education/City University of New York Medical School, New York, New York 10031
Department of Pediatrics and Adolescent Medicine,4 Mayo Clinic, Rochester, Minnesota 55905
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
male sexual function, sperm, spermatid, spermatogenesis, testis
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We have recently reported that the acrosome of rat and mouse spermatids is anchored to a cytoskeletal plate, called the acroplaxome [7]. The acroplaxome contains an F-actin- keratin 5/complex and is attached to a nuclear lamina, which is associated with the spermatid inner membrane of the nuclear envelope. The acroplaxome displays a marginal ring at the descending leading edge of the acrosome, which seems to guide the caudal descent of the acrosome. The ring consists of two opposite plaques: the acrosome dense plaque, which is bound to the inner acrosome membrane and is the insertion site of K5-containing filaments, and the nuclear dense plaque, a focal thickening of the nuclear lamina. The molecular nature of the nuclear lamina and plaques has not been determined. The marginal ring also contains myosin-Va, thus suggesting a role of this motor protein in connecting the acrosome to the F-actin network during spermatid nuclear shaping [8]).
Here we report that a K5-deficient acroplaxome develops in the Hrb mutant spermatids and that myosin-Va/Rab27a/ b-bound proacrosomal vesicles, derived from the medullary region of the Golgi apparatus, dock along the acroplaxome of wild-type and Hrb-deficient mutant spermatids. Proacrosomal vesicles coalesce into an acrosome in the wild- type, and a flat pseudoacrosomal sac develops in the Hrb- deficient mutant. As spermiogenesis progresses, two deformities of the round-shaped spermatid nucleus were observed: nuclear peglike projections (designated nucleopodes, from Greek, podos, foot-shaped) at the acroplaxome site and a deep nuclear indentation opposite to the acroplaxome harboring bundles of manchette microtubules.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Experiments using live animals were carried out according to National Research Council animal care and welfare guidelines and were approved by the IACUC committee at the City College of New York/The Sophie Davis School of Biomedical Education.
Reverse Transcription-Polymerase Chain Reaction Analysis of Hrb-Deficient Mutant Mice
Total RNA was isolated from testis of wild-type and Hrb-deficient mice (generated as described, Kang-Decker et al. [5]) using TRI reagent (Molecular Research Center, Cincinnati, OH). Total RNA (1–5 mg) was used as a template for first-strand cDNA synthesis using oligo (dT) as a primer, in the presence of Superscript II RNase H-Reverse Transcriptase (Life Technologies, GIBCO-BRL, Gaithersburg, MD). One ml of each cDNA was used as a template for the PCR reaction with the following primers: K5: forward (F) 5,GAGCAGATCAAGACCCCTAACAA and reversed (R), 5,ATCTCCACGTCCAGGGCCA [7]; GOPC F, CGGACCGGCGGACATCACTTAT, and R, TGCCGGCCAGCTCCTTATCC [6]; Myo5a F, GGCGCCATCACCCTAAACA, and R, GTGCGGATAAATGAAACTGAGACC [9]. Amplified products were separated on a 1.2% agarose gel and sequenced. Hi-Lo DNA Markers (Minnesota Molecular Inc., Minneapolis, MN) were used for size determination.
Indirect Immunofluorescence
Testes of wild-type mice and Hrb-deficient mouse mutant (Hrb–/–) were analyzed. For immunocytochemistry, seminiferous tubular fragments were used to collect spermatogenic cells as reported [10]. Briefly, segments (3–4 mm in length) sectioned with a surgical blade were placed in a drop of 3.7% paraformaldehyde (electron microscopy grade) in 0.1 M sucrose in phosphate buffer, pH 7.4, on microscope slides coated with Vectabond (Vector Laboratories, Burlingame, CA). Specimens were fixed for 15 min at room temperature and then a coverglass was gently placed on top of the preparation and kept at 4°C for 30 min before removing the coverglass and processing the samples for immunocytochemistry. In some experiments, cells were extracted with 0.5% Triton X-100 in 0.1 M sucrose for 30 sec and then fixed as indicated above. Cells were immunoreacted with 
-tubulin monoclonal antibody (working dilution: 1:100; Sigma, St. Louis, MO), an affinity-purified myosin-Va polyclonal antibody specific for the globular tail region of myosin-Va (AB5887P; working dilution: 1: 50; Chemicon International, Temecula, CA), a Rab27a/b rabbit polyclonal antibody (a generous gift from Miguel C. Seabra, Imperial College School of Medicine, London, UK), and anti-Golgi protein 58K monoclonal antibody (G2404; working dilution: 1:50; Sigma), followed by anti-mouse IgG conjugated with rhodamine, or anti-rabbit IgG conjugated with fluorescein isothiocyanate (working dilution: 1:200; Jackson Immunoresearch Laboratories, West Grove, PA). Acrosomes were decorated with peanut agglutinin (PNA) Alexa Fluor 488 conjugate (Molecular Probes, Eugene, OR) as reported previously [7, 11]. Staining specificity of anti-myosin-Va serum was determined by immunoblotting using rat nervous tissue (hypothalamus), known to contain abundant myosin-Va-bound neuronal synaptic vesicles. Specimens were mounted with Vectashield (Vector Laboratories) containing propidium iodide to detect nucleic acids.
Transmission and Immunogold Electron Microscopy
Testis samples were used for transmission electron microscopy and immunogold electron microscopy. For transmission electron microscopy, samples were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 6.9), postfixed in 2% osmium tetroxide in the same buffer, and embedded in a plastic resin according to a standard procedure. Sections were stained with 5% uranyl acetate in methanol followed by lead citrate. For immunogold electron microscopy, samples were fixed in a mixture of 1.5% glutaraldehyde and 3.4% paraformaldehyde (electron microscope grade) in 0.1 M phosphate buffer, pH 7.2, embedded in Lowicryl K4M (Polysciences, Warrington, PA), and processed for immunogold microscopy as recently updated [7]. Anti-K5 polyclonal affinity-purified sera (generated against the peptide KAQYEDIAQK, corresponding to the 2A region of the -helical rod domain, and peptide LEGQECRLSGEGVG, corresponding to the beginning of the tail domain (see [7] for additional details) and ß-actin monoclonal (mouse) antibodies (Sigma) were used at working dilutions of 1:100 in PBS containing 0.1% Tween-20, 1% bovine serum albumin, and 1% goat serum. Affinity-purified anti-myosin-Va antiserum (rabbit; Chemicon) was used at a working dilution of 1:50. Bound antibody was detected by incubating the sample overnight at 4°C with goat anti-rabbit IgG or anti-mouse IgG conjugated with 10-nm gold particles (Amersham, Arlington Heights, IL), using a 1:50 working dilution. Sections were stained for 5 min with 5% uranyl acetate in deionized water, and specimens were examined using a JEM-100CX transmission electron microscope (JEOL, Tokyo, Japan) operated at an accelerating voltage of 60 kV.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We have previously shown that the acroplaxome anchors the acrosome to the spermatid nuclear envelope in wild- type mice and normal rats [7]. The components of the acroplaxome and its marginal ring in a wild-type mouse spermatid are illustrated in Figure 1A. The marginal ring of the acroplaxome displays an intermediate filament bundle anchored to a dense plaque associated with the inner acrosomal membrane. Acrosomeless spermatids of the Hrb–/– mutant display an acroplaxome plaque associated with a flat sac (designated pseudoacrosome). The acroplaxome- pseudoacrosome complex is attached to the spermatid nuclear envelope, the inner membrane of which is lined by a relatively thin nuclear lamina (15–20 nm thick; Fig. 1, B and C) when compared with wild-type spermatids (50 nm thick). A striking difference with the wild-type is that the marginal ring of the acroplaxome in the Hrb–/– mutant lacks both the K5-containing filament bundle and associated dense plaque (compare Fig. 1A with Fig. 1, B and C). In some spermatids, the length of the pseudoacrosome exceeds the length of the acroplaxome and diverges from it, creating a space where the microtubule-nucleating element of the manchette is housed (Fig. 1C). In other spermatids, the pseudoacrosome length is shorter than the acroplaxome (see Fig. 7I). In contrast, the length of the acrosome and underlying acroplaxome is essentially equal in wild-type spermatids [7].
|
|
Myosin-Va Decorates Golgi-Derived Proacrosomal Vesicles, Which Tether to the Acroplaxome
Figure 2, A and B, displays a step 4 spermatid of a Hrb–/– mouse. The Golgi apparatus consists of a cortical region (designated the cortex, containing a stack of saccules [3]) and an inner region (designated the medulla [3]) with abundant proacrosome vesicles. A string of Golgi-derived proacrosome vesicles, some of them with a dense content, are aligned along the acroplaxome plaque. A detailed view of the vesicle-acroplaxome relationship at the marginal ring demonstrates a single vesicle settled in a nuclear depression corresponding to the marginal ring of the acroplaxome (Fig. 2B). Neither the inner acrosome membrane-bound dense plate nor the associated intermediate filaments bundle are visualized. Like in the wild-type mouse (Fig. 1A), the acroplaxome in the Hrb–/– mutant appears anchored to a subjacent nuclear lamina lining the inner side of the nuclear envelope (Fig. 2B). However, the nuclear lamina in the mutant is thinner.
|
Next, we investigated whether myosin-Va and its receptor Rab27a/b could be involved in the mobilization of proacrosome vesicles from the inner region of the Golgi apparatus to the acroplaxome. To explore this possibility, we disrupted, by sucrose hypotonic treatment and brief Triton X-100 extraction, the cytoplasm of wild-type and Hrb–/– spermatids collected from seminiferous tubules. With this procedure, most of the cytoplasm is removed, leaving relatively intact the Golgi apparatus, proacrosomal vesicles, acrosome, and acroplaxome attached to the spermatid nucleus [7]. With phase-contrast microscopy, the Golgi apparatus in wild-type and Hrb mutant spermatids display a cortical dense region (corresponding to the stack of saccules) and a less dense inner region (where proacrosome vesicle accumulate; see Fig. 3, C, G, K, O, S, and W). Figure 3, A to D, illustrates the presence of myosin- Va immunoreactivity restricted to the inner region of the Golgi apparatus of a Hrb–/– step 3 spermatid. During step 4 of spermiogenesis, the inner region of the Golgi, as well as a linear immunoreactive pattern along the acroplaxome, stain strongly with anti-myosin-Va (Fig. 3, E–H). During step 5, the linear immunoreactive pattern in Hrb mutant spermatids extended further along the acroplaxome (Fig. 3, I–L). Insets in Figure 3L illustrate a step 5 wild-type spermatid stained with anti-myosin-Va serum. Contrasting with the linear immunoreactive pattern in the Hrb mutant, the wild-type spermatid displays an arrangement compatible with the early stage of acrosome biogenesis. Rab27a/b immunoreactive sites in the inner region of the Golgi and the proximal site of the developing acrosome correlated with the distribution of myosin Va immunoreactivity (step 6 spermatid; Fig. 3, M–P).
|
The microscopic characteristics of the acrosome and cortical and medullary region of the Golgi apparatus were determined by labeling with PNA Alexa Fluor 488 conjugate (step 6 wild-type spermatids; Fig. 3, Q–T), known to selectively label the acrosome [7, 11]. A step 6 wild-type spermatid displays a relatively conspicuous PNA-stained acrosome sac (Fig. 3Q) not observed in the Hrb mutant (data not shown). Anti-Golgi 58K protein monoclonal antibody decorates the cortical region of the Golgi of a step 5 wild-type spermatid (Fig. 3, U–Y). In contrast, the medullary region, where proacrosome vesicles accumulate, is less stained. We concluded that hypotonic-treated and briefly Triton X-100-extracted spermatids provide both adequate resolution and a convenient approach for tracing the possible pathway of myosin-Va and Rab27a/b-decorated proacrosomal vesicles by combined phase-contrast and fluorescence microscopy.
F-actin, But Not K5 Immunoreactive Sites, Is Visualized in the Acroplaxome of the Hrb-Deficient Mutant
Previously reported immunogold electron microscopy data indicated that the spermatid acroplaxome of wild-type mice and normal rats contains both F-actin and K5 [7]. Figure 4A shows that, in wild-type mice, the acroplaxome and the F-actin-containing Sertoli cell ectoplasmic region are adjacent to each other and both display ß-actin immunoreactivity. The ß-actin immunoreactive acroplaxome and Sertoli cell F-actin bundles can also be detected in the Hrb–/– mutant (Fig. 4C). However, F-actin bundles of the Sertoli cell ectoplasmic region are less conspicuous when compared with the wild-type mouse (Fig. 4A). Furthermore, Sertoli cell F-actin-containing bundles are separated from the acroplaxome by a relatively wide spermatid cytoplasm. In correlation with immunofluorescence data, Figure 4E illustrates a linear distribution of myosin-Va immunoreactivity along the pseudoacrosome of a Hrb-deficient spermatid. In a step 3 wild-type spermatid, myosin- Va predominates in proacrosome vesicles clustered in the medullary region of the Golgi and along the membrane of the developing acrosome (Fig. 4F).
|
An unforeseen finding was the lack of K5 immunoreactivity in the acroplaxome of the Hrb–/– mutant, yet the affinity-purified K5 antibody stained microtubules of the manchette (Fig. 4D), as previously reported [12]. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrates that the epidermis and testis of the Hrb–/– mutant express K5 transcripts (Fig. 5A). Therefore, we disregarded the possibility that the absence of K5 in the acroplaxome was determined by defective gene expression in the Hrb- deficient mutant. Because spermatids of both GOPC- and Hrb-mutant mice lack an acrosome due to a vesicle fusion defect [5, 6], we searched for the expression of GOPC transcripts in the Hrb–/– mutant. Figure 5B demonstrates that GOPC mRNA is present. The expression of myosin-Va transcripts in wild-type and Hrb-mutant testes was also determined by RT-PCR (Fig. 5C). The specificity of the affinity purified anti-myosin-Va serum was verified by detecting a 190-kDa band in immunoblots of rat hypothalamus lysate, known to contain neuronal vesicles enriched with myosin-Va (Fig. 5D). A similar, yet weak, myosin-Va immunoreactive band was observed in testicular lysates (data not shown).
|
Nucleopodes in the Hrb-Deficient Mutant Are Restricted to the Acroplaxome
The pseudoacrosome-acroplaxome region of late spermatids of the Hrb–/– mutant displays a variable number of peglike nucleopodes extending from the spermatid nucleus into the cytoplasm. The expanded portion of each nucleopode is covered by the acroplaxome-pseudoacrosome complex (Fig. 6, A and B). In sections with a favorable orientation, nucleopodes can be seen connected to the main nucleus by a narrow stalk (Fig. 6B). About 90% of the propidium iodide-stained spermatid nuclei collected from seminiferous tubules display nucleopodes adjacent to the round-shaped spermatid nucleus (Fig. 7, B–D). Nucleopodes are still visible in epididymal sperm (our unpublished observation).
|
Microtubules of the Manchette Extendfrom a Pronounced Nuclear Indentation Oppositeto the Acroplaxome
An additional abnormality of the Hrb–/–-mutant spermatid nucleus is a deep indentation in the pole opposite to the acroplaxome (Fig. 7). -Tubulin-stained manchette microtubule bundles extend from the nuclear notch into the spermatid cytoplasm (Fig. 7, A–E; see also Figs. 4D and 7I). The manchette in Hrb–/– spermatids is remarkably long (average length: 25 ± 2.3 µm, as compared with the average length of 10 ± 1.3 µm in wild-type mice, [9]). The manchette assembles ectopically; with its dense microtubule insertion ring anchored to the plasma membrane and microtubule bundles occupying a nuclear lateral position (Fig. 7I), partially caging the spermatid nucleus (Fig. 7, F– H). Both the abnormal assembly site of the manchette and its substantial length appear to displace the attachment of the head-to-tail connecting apparatus (HTCA) to the implantation fossa (Fig. 7I). The HTCA consists of the centrosome and associated components of the connecting piece. This displacement results in the angular position of the developing axoneme as well as a disruption of its axial growth as denoted by cross-sectioned axonemes embedded in the cytoplasm (denoted by a circle in Fig. 7E). Figure 8 is a summary diagram of the major alterations observed in Hrb-deficient spermatids.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
There are two aspects that merit discussion: the role of the acroplaxome during elongation of the spermatid nucleus and the mechanism by which Golgi-derived proacrosomal vesicles are streamed to the acroplaxome region. A convenient approach for approaching the functional significance of the acroplaxome relies on mouse mutants displaying defects in acrosome biogenesis and spermatid nuclear shaping. The Hrb mutant is a convenient model because sperm lack an acrosome and the nucleus does not elongate. Three distinct abnormalities observed in the acroplaxome of the Hrb mutant strengthen the view that the acroplaxome may participate in nuclear elongation. First, the acroplaxome marginal ring in the mutant is not apparent; it lacks both the nuclear and acrosome-dense plaques and the K5- containing intermediate filament bundles. The acrosome- dense plaque may be necessary for recruiting K5-intermediate filaments and organize, together with the nuclear- dense plaque, the marginal ring of the acroplaxome. K5 immunoreactivity was not visualized throughout the acroplaxome but was detected in the manchette as previously reported [11]. K5 transcripts were found in testes and epidermis of the Hrb mutant, thus suggesting that the K5 gene is expressed in the Hrb mutant.
Second, the thickness of the nuclear lamina, to which the acroplaxome appears to anchor, is considerably thinner. The nuclear lamina is composed of type V intermediate filaments, designated nuclear lamins, the composition of which varies according to cell type and stage of differentiation (reviewed in [13]). A reduction in the thickness of the spermatid nuclear lamina may imply that the assembly and function of the lamina may be dependent on transmembrane proteins interacting with K5. A lamin B variant in the round spermatid nuclear lamina has been reported [14] but additional components, including possible acroplaxome actin linkers to the lamina, need to be determined.
Third, the length of the pseudoacrosome does not correlate with the length of the acroplaxome (e.g., see Fig. 1C). Presumably, the length of the pseudoacrosome may be determined by the number of proacrosomal vesicles tethering to the acroplaxome. Eps15 and Ap1, two transport vesicle adaptor proteins with a role in vesicle sorting, are associated with Golgi-derived proacrosome vesicles in the Hrb mutant, [5]. Hrb and Eps15 form a complex in testis, and the medullary region of the Golgi contains subsets of proacrosomal proteins displaying different assortments of Hrb, Eps15, and Ap1. It is likely that proacrosomal vesicles establishing contact with the acroplaxome flatten into a membranous flat sac. It is not clear whether proacrosomal vesicles contain Eps15 or Ap1 or both and how these vesicles merge into the pseudoacrosome.
The second aspect relates to the transport mechanism of Golgi-derived proacrosomal vesicles. Myosin-Va-decorated proacrosomal vesicles in the medullary region of the Golgi apparatus and in vesicles aligned along the acroplaxome region in Hrb mutant and wild-type spermatids suggest a molecular motor-mediated vesicle transport. An F-actin- based myosin Va motor-driven mechanism may coexist with a microtubule-based motor, KIFC1, which was recently reported to be involved in acrosome biogenesis and vesicle transport [15]. Analogous to the microtubule motor kinesin, certain myosins, in particular class-V myosins, can mobilize a vesicular cargo along actin filaments [16]. We reasoned that the most likely candidate for actin-based proacrosomal vesicle transport might be myosin-Va. In the myosin-Va-assisted vesicle transport pathway, proacrosomal vesicles, derived from the Golgi apparatus, can be streamed and tether to the F-actin-containing acroplaxome, and finally fuse to organize the acrosome. Members of the membrane-bound Rab GTPase protein family, in particular Rab27a and Rab27b, are known to facilitate the interaction of myosin-Va with the vesicles (reviewed by Langford [17]). Rab27a is ubiquitously expressed in several tissues, but Rab27b transcripts are present in a significant amount in testis [18]. Rab27a and Rab27b transcripts are expressed in testes of wild-type [12] and Hrb-deficient mutant mice (our unpublished observation). Rab27a/b immunoreactive sites can be seen in the medullary region of the Golgi and the adjacent acrosomal sac (see Fig. 3M). Essentially, the transport of proacrosome vesicles during acrosome biogenesis may share intracellular traffic features of melanosomes in mouse melanocytes (reviewed in [19]). Like in melanosomes, myosin-Va binding to proacrosomal vesicles takes place through Rab27a and Rab27b, two isoforms that may fulfill similar functions [20]. It appears that the Hrb- deficient condition does not interfere with the myosin-Va- dependent transport of proacrosomal vesicles.
The round-head shaped and acrosomeless Hrb spermatids and the finding of nucleopodes at the acroplaxome site are significant counterparts. A potential mechanical role of the acroplaxome in spermatid nuclear shaping emerged from examination of spermatids of the azh mouse mutant [7] and offspring generated by intracytoplasmic sperm injection of azh sperm into normal adult eggs [21]. In both cases, spermatid nuclear indentations can be seen restricted to the acroplaxome. Here we report that nucleopodes develop along the K5-deficient acroplaxome in the Hrb mouse mutant. Nucleopodes may result from the failure of a malleable defective acroplaxome to restrain endogenous and/ or exogenous contractile forces operating during spermatid nuclear elongation. F-actin-containing bundles in the Sertoli cell ectoplasmic region of the Hrb-deficient mutant seem less developed when compared with the wild-type mouse (compare Fig. 4A and 4C) and are relatively distant from the acroplaxome-pseudoacrosome complex. The Sertoli cell-spermatid spatial relationship in the Hrb mutant is unaffected and transcripts of the actin-linked afadin-nectin complex (bridging the Sertoli cell-spermatid space [22]) are expressed in the mutant (our unpublished observation). In wild-type mouse spermatids, the stress-resistant acroplaxome can transmit clutching forces produced by Sertoli cell ectoplasmic F-actin hoops embracing the apical elongating spermatid nucleus (Fig. 7). In the Hrb-deficient mutant, the limited mass of the F-actin hoops, the relatively wide distance separating the hoops from the acroplaxome-pseudoacrosome complex, and the weakened nature of the K5- deficient acroplaxome could hamper the balance of clutching forces. Consequently, nuclear elongation does not occur, and round-shaped nuclei with nucleopodes and pronounced nuclear indentations arise.
Another significant observation is the ectopic assembly of considerably long manchettes in Hrb-deficient spermatids. Bundles of manchette microtubules can consistently be seen extending from deep nuclear invaginations. In wild- type mouse spermatids, microtubules of the manchette are inserted in a dense perinuclear ring, which contains keratin 9 [23] and presumably other proteins. During nuclear elongation, the perinuclear ring is located just under the descending leading edge of the acrosome-acroplaxome complex. A belt groove demarcates the boundaries between the perinuclear ring of the manchette and the acrosome-acroplaxome complex. Sertoli cell ectoplasmic F-actin bundles form contractile hoops capping the elongating spermatid head and ending at the belt groove (see Fig. 4A). In the Hrb-deficient mutant, the belt groove is missing and Sertoli cell F-actin bundles are underdeveloped (see Fig. 4C). It is not known whether the manchette assembles caudally to the acrosome in response to signaling cues derived from the already assembling acrosome. In the Hrb-deficient mutant, an ectopic manchette precludes a perinuclear clutching effect, which may account for a lack of elongation leading to the round-shaped spermatid nucleus in the mutant. In summary, we have shown that the Golgi apparatus of wild- type and Hrb mutant mouse spermatids give rise to myosin- Va-decorated proacrosomal vesicles, which tether to an F- actin-containing acroplaxome. Proacrosomal vesicles along the acroplaxome form a flat pseudoacrosome associated with an F-actin-containing but K5-deficient acroplaxome lacking a marginal ring. This sequence suggests that the assembly of the acroplaxome is independent of acrosome biogenesis and that the Hrb-deficient condition does not interfere with the mobilization of proacrosomal vesicles from the Golgi to the acroplaxome. We suggest that a K5- deficient acroplaxome is unable to modulate forces responsible for the elongation of the spermatid nucleus. Consequently, the spermatid nucleus in the mutant remains round- shaped and local nuclear deformities develop.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: A.L. Kierszenbaum, Department of Cell Biology and Anatomical Sciences, CUNY Medical School, Harris Hall Suite 306, 138th and Convent Avenue, New York, NY 10031. FAX: 212 650 6812; kier{at}med.cuny.edu
Received: 10 November 2003.
First decision: 5 December 2003.
Accepted: 5 January 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K.-F. Lee, Y.-T. Tam, Y. Zuo, A. W.Y. Cheong, R. T.K. Pang, N. P.Y. Lee, C. K.Y. Shum, P.-C. Tam, A. N.Y. Cheung, Z.-M. Yang, et al. Characterization of an acrosome protein VAD1.2/AEP2 which is differentially expressed in spermatogenesis Mol. Hum. Reprod., August 1, 2008; 14(8): 465 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Mountjoy, W. Xu, D. McLeod, D. Hyndman, and R. Oko RAB2A: A Major Subacrosomal Protein of Bovine Spermatozoa Implicated in Acrosomal Biogenesis Biol Reprod, August 1, 2008; 79(2): 223 - 232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A.H.D.M. Dam, I. Feenstra, J.R. Westphal, L. Ramos, R.J.T. van Golde, and J.A.M. Kremer Globozoospermia revisited Hum. Reprod. Update, January 1, 2007; 13(1): 63 - 75. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-X. Yang, H. Jefferson, and A. O. Sperry The Molecular Motor KIFC1 Associates with a Complex Containing Nucleoporin NUP62 That Is Regulated During Development and by the Small GTPase RAN Biol Reprod, April 1, 2006; 74(4): 684 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. C. Juneja and J. M. van Deursen A mouse model of familial oligoasthenoteratozoospermia Hum. Reprod., April 1, 2005; 20(4): 881 - 893. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Yu, N. Sanchez-Velar, I. E. Catrina, E. L. W. Kittler, E. B. Udofia, and M. L. Zapp The cellular HIV-1 Rev cofactor hRIP is required for viral replication PNAS, March 15, 2005; 102(11): 4027 - 4032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Obermann, I. Raabe, M. Balvers, B. Brunswig, W. Schulze, and C. Kirchhoff Novel testis-expressed profilin IV associated with acrosome biogenesis and spermatid elongation Mol. Hum. Reprod., January 1, 2005; 11(1): 53 - 64. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Stinchcombe, G. Bossi, and G. M. Griffiths Linking Albinism and Immunity: The Secrets of Secretory Lysosomes Science, July 2, 2004; 305(5680): 55 - 59. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
