|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gamete Biology |
Departments of Pathology,3
Molecular and Human Genetics,4
and
Molecular and Cellular Biology,5 Baylor Collegeof Medicine, Houston, Texas 77030
| ABSTRACT |
|---|
|
|
|---|
erm cell-specific gene encoding a protein containing four
nkyrin repeats, a
terile-
motif, and a basic leucine
ipper) in six mammalian species. Here, we report GASZ orthologs in pufferfish (Fugu rubripes), zebrafish (Danio verio), and frog (Xenopus laevis). Sequences of the three Gasz cDNAs were determined by database mining and 5'- and 3'-rapid amplification of cDNA ends (RACE) followed by sequencing. The three orthologous vertebrate genes encode proteins structurally similar to mammalian GASZ and contain the characteristic four ankyrin repeats (ANKs) and sterile-
motif (SAM). Their ANK and SAM domains share 55 74% and 3855% amino acid identity with those in human GASZ, respectively. Similar to human and mouse Gasz genes, pufferfish Gasz is composed of 13 exons, spanning approximately 12 kilobases, and flanked by Cftr at its 5'-end and Wnt2 at its 3'-end. Northern and Western blot analyses detect frog Gasz expression only in testis and ovary. In situ hybridization and immunohistochemical analyses show that frog Gasz mRNA and protein expression is confined to pachytene spermatocytes in the testis and to oocytes in the ovary. In frog oocytes, GASZ protein appears to localize to a cytoplasmic structure resembling the Balbiani body, a postulated mRNA transport organizer in the cytoplasm. The high evolutionary conservation and germ cell specificity suggest that GASZ plays an essential role in gametogenesis. The data presented here are important for future studies of the physiological roles of GASZ using fish and amphibians as animal models.
gamete biology, meiosis, oocyte development, spermatogenesis
| INTRODUCTION |
|---|
|
|
|---|
We previously identified a germ cell-specific mouse gene called Gasz (a
erm cell-specific gene encoding a protein containing four
nkyrin repeats, a
terile-
motif, and a leucine
ipper domain) and orthologous genes in five other mammalian species including rat, cow, baboon, chimpanzee, and human [2]. In mice, both Gasz mRNA and protein are expressed exclusively in spermatocytes and early round spermatids in the testis and oocytes of all growing follicles in the ovary, as well as early embryos at two-cell through eight-cell stages. These mammalian GASZ proteins share a high amino acid identity (85 99%), and their gene structures are nearly identical (composed of 13 exons of similar sizes) and flanked by Cftr and Wnt2 genes at the 5'-end and 3'-end, respectively [2]. The exact molecular events that GASZ mediates remain unclear. However, we proposed that GASZ act as a signaling molecule in germ cells during gametogenesis, given that ANK and SAM domains function as protein-protein- interacting modules [3, 4].
To further extend our search of GASZ orthologs to lower vertebrates, we took advantage of publicly available databases and identified a number of expression tags (ESTs) derived from pufferfish, zebrafish, and frogs. Rapid amplification of cDNA ends (RACE) enabled us to obtain full- length cDNA sequences, and genomic database mining allowed us to determine the gene structure. In the present study, we report the cDNA and protein sequences, phylogenetic comparison, expression, and localization of these GASZ orthologs.
| METHODS AND MATERIALS |
|---|
|
|
|---|
Using standard nucleotide-nucleotide, protein-protein, and protein- translated Blast Search programs at the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST), mouse Gasz cDNA or protein sequences were searched against nonredundant or EST databases. Homologous sequences from pufferfish, zebrafish, and frog were selected and examined for the tissue sources. Only sequences derived from the testis or ovary were further analyzed. The putative Gasz cDNAs were further verified by searching the pufferfish and zebrafish genomic databases at the Wellcome Trust Sanger Institute (http://www.ensembl.org/) and the U.S. Department of Energy Joint Genome Institute (http://www.jgi.doe.gov/).
Rapid Amplification of cDNA Ends
RNA was prepared from sexually mature frog oocytes (a gift from Dr. Larry Etkin [M.D. Anderson Cancer Center, Houston, TX]) and zebrafish ovaries (generously provided by Dr. Mary Ellen Lane [Rice University, Houston, TX]) using RNA STAT-60 (Leedo Medical Laboratories, Inc., Houston, TX) according to the manufacturer's instructions. The 5'- and 3'-end RACE analyses were performed using the SMART RACE cDNA Amplification Kit (Clontech Laboratories, Inc., Palo Alto, CA) according to the manufacturer's instructions. An 848-base pair (bp) zebrafish partial Gasz cDNA (GenBank accession BM141492) was used to design gene- specific primers for amplifying the 5'-end and the 3'-end. The primers for zebrafish 5'-RACE were 5'-ATCGCAGTGCAGTATGGACA (PZ627u) and 5'-ACGGGAGTAGTGACGAATGG (PZ105u); the primers for zebrafish 3'-RACE were 5'-TCTCGGGGAAAATTGAACAC (PZ754d) and 5'-GACATTTCCTGCGGTTATGG (PZ238d). A 569-bp partial frog Gasz cDNA derived from frog eggs (AW641841) was used to design gene- specific primers for RACE. Primers for frog 5'-RACE were 5'- TGCAAGGCTTGAGGAGTTTT (PF14u) and 5'-CTAGAGCGGTTAATGACCAA (PF121u); primers for frog 3'RACE were 5'-TTCAGCAGCCCATACTTCCT (PF358d) and 5'-TGCGTATAGTCCCACTCCAA (PF187d). The RACE products were subcloned into pGEM-T vector (Promega, Madison, WI) and then sequenced from both directions using T7 and SP6 primers. The sequences were assembled using the SeqMan program of the DNASTAR software package (DNASTAR, Inc., Madison, WI).
Protein Domain Structure and Alignment Analyses
We used the protein homology motif searching tool Pfam (http://www.sanger.ac.uk/Software/Pfam/search.shtml), located at the Wellcome Trust Sanger Institute website, to analyze GASZ protein sequences. Alignment of all GASZ proteins of different species was performed using the MEGALIGN program of the DNASTAR (DNASTAR, Inc.) software package. The sequence similarity and phylogenetic analysis were derived from the alignment analysis using the same program.
Northern Blot Analysis
Total RNA was isolated from multiple frog tissues using RNA STAT- 60. Total RNA (15 µg) was fractionated on 1.2% formaldehyde-agarose gels and transferred to Hybond-N nylon membrane (Amersham, Arlington Heights, IL). A 344-bp PCR-generated frog Gasz cDNA fragment was labeled with [
-32P] dATP using a Strip-EZ kit (Ambion, Inc., Austin, TX). The kit provides an easy stripping procedure for rehybridization of blots. Membrane hybridization, washing, and autoradiography, as well as stripping and reprobing, were performed according to the manufacturer's instructions. Blots were stripped and hybridized with a Xenopus laevis 18S rRNA cDNA (X04025) labeled with [
-32P] dATP to control for RNA loading.
Reverse Transcription-Polymerase Chain Reaction Analysis
The reverse transcription (RT) reaction was performed in a 50-µl volume containing 2 µg of total RNA, 1x RT Buffer (Promega), 100 pmol random primer (Promega), 1 mM dNTP, 10 U of RNase inhibitor RNasin (Promega), and 5 U AMV reverse transcriptase (Promega) at room temperature overnight. Aliquots (2 µl) of cDNAs were used as templates for polymerase chain reaction (PCR). For amplifying the frog Gasz cDNA, we used a pair of frog Gasz-specific primers PF14u and PF358d (see RACE section), spanning introns 10 and 11, and yielding a 344-bp PCR product. As a loading control, frog eukaryotic translation initiation factor 1A (Eif1a) was amplified using 5'-TGCCAATTGTTGACATGATCCC-3' (sense) and 5'-TACTATTAAACTCTGATGGCC-3' (antisense) primers, which also span two introns and give an expected product size of 410 bp. Twenty-two cycles were used for amplifying frog Eif1a to ensure that the PCR was within the exponential phase (1525 cycles as tested). Forty cycles were used for frog Gasz.
In Situ Hybridization
In situ hybridization was performed as described previously [2]. Briefly, Bouin-fixed, paraffin-embedded frog ovaries and testes were cut into 5-µm sections, dewaxed, fixed, hybridized, and washed. The 344-bp frog Gasz cDNA fragment was subcloned into pGEM-T vector (Promega). Sense and antisense probes were generated by labeling with [
-35S] UTP using the Riboprobe Labeling System (Promega). Hybridization signals were detected by autoradiography using NTB-2 emulsion (Eastman Kodak Co., Rochester, NY). After development and fixation, the slides were counterstained with hematoxylin and mounted for photography. The sense probe did not generate a signal above background in either testis or ovary sections.
All animal experiments in this study were approved by the Baylor College of Medicine Institutional Animal Care and Use Committee and conducted according to the National Research Council guidelines.
Production of Frog GASZ Protein and Anti-Frog GASZ Polyclonal Antibody
A pET protein production system (Novagen Inc., Madison, WI) was employed to produce mouse GASZ protein. The entire coding region (1308 bp) of frog Gasz cDNA was amplified by PCR using a pair of primers: 5'-GAATTCGGGGGAGAAGCAGTGGTAGTGA-3' (with EcoRI adaptor: GAATTC) and 5'-GTCGACTTTCAGCAGCCCATACTTCCT-3' (with SalI adaptor GTCGAC). The PCR products were subcloned into pGEM-T vector (Promega) and sequenced to confirm the sequence accuracy. The EcoRI/SalI fragment was then subcloned into pET-23b vector (Novagen). Protein induction and purification were performed according to the manufacturer's instructions. The 53-kDa fusion protein, containing the full-length frog GASZ protein, an N-terminal T7 flag, and a C-terminal histidine tag, was used to immunize rabbits to produce the polyclonal antibody (Cocalico Biologicals, Inc., Reamstown, PA).
Immunoblot and Immunohistochemistry Analysis
Proteins were isolated from multiple frog tissues, including brain, heart, liver, lung, stomach, intestine, muscle, testis, and ovary, using T- PER Tissue Protein Extraction Reagent (Pierce, Rockford, IL) according to the manufacturer's instructions. Aliquots of 100 µg protein were fractionated on 412.5% SDS-polyacrylamide gels and transferred onto a nitrocellulose membrane (Schleicher and Schuell, Keene, NH). Immunodetection was performed as described previously [2]. The rabbit anti-frog GASZ polyclonal antibody was used at a dilution of 1:1000. The membrane was subsequently stripped and blotted with an anti-ACTIN monoclonal antibody (Sigma, Milwaukee, WI) to control for protein loading.
Paraformaldehyde (4%)-fixed frog testis and ovary paraffin blocks were sectioned (5 µm), and sections were mounted onto poly-lysine-coated slides. Microwave antigen retrieval was employed as described previously [2]. After blocking, an aliquot of 100 µl primary antibody diluted at 1: 2000 was applied to each section and incubated at 4°C overnight. Incubation with secondary antibody and visualization of positive cells were performed using Vectastain Elite-kit (Vector Laboratories, Burlingame CA) according to the manufacture's instructions. Preimmune serum was used in control sections.
| RESULTS |
|---|
|
|
|---|
By BLAST search, we identified three pufferfish genomic fragments in the NCBI database (GenBank accession AJ271361, AC087333, and AC091727) encoding a putative ankyrin repeat-containing protein similar to GASZ. We used the cDNA sequence deduced from the genomic sequence to search the Fugu rubripes genome database at the Sanger Center (http://www.ensembl.org/Fugu_rubripes/), and the deduced cDNA sequence was identical to a putative transcript predicted by the Sanger Center Fugu genome program. Comparison of the cDNAs from the above-mentioned sources showed identical sequences. The nucleotide and protein sequences for pufferfish Gasz have been deposited into GenBank (AY273804).
Using pufferfish Gasz cDNA to search the nonhuman, nonmouse EST entries, we found four ESTs (BM141492, BM859404, BM141618, and AL916657) that displayed high nucleotide sequencing similarity and were derived from zebrafish testis. Based on these partial cDNAs, we successfully amplified the 5'-end and 3'-end of the zebrafish Gasz cDNA. During our attempt to obtain the full- length zebrafish Gasz cDNA, the sequence of an EST derived from the whole body of zebrafish was released in the NCBI database (BC046081), which is identical to what we obtained by RACE using zebrafish ovary RNA. The full- length zebrafish Gasz cDNA and protein sequences have been deposited into GenBank (AY273805).
Based on the partial Gasz cDNA derived from frog oocytes (CA788822 and CA788802) and eggs (AW641841), we obtained the full-length cDNA using frog oocyte RNA and 5' and 3' RACE assays. The full-length frog Gasz cDNA and protein sequences have been deposited into GenBank (AY273806).
The Domain Structure of the Pufferfish, Zebrafish, and Frog GASZ Proteins
Similar to mammalian GASZ, all three orthologous proteins contain four ankyrin repeats in their N-termini and a SAM domain in the middle, as predicted by the Pfam program (Fig. 1A). The pufferfish and the frog GASZ proteins share 35% and 52% amino acid identity with human GASZ, respectively. Alignment analyses reveal that frog GASZ shares 74% amino acid identity in the ANK domain and 55% amino acid identity in the SAM domain compared with these same domains in human GASZ. Within each ANK repeat, critical residues for forming
-helices and ß- hairpins are conserved (Fig. 1B). In the SAM domain, residues important for arranging the five helices are also conserved (Fig. 1C).
|
Genomic Structure of the Pufferfish Gasz Gene
The pufferfish genomic fragments (one from the Wellcome Trust Sanger Institute Fugu genomic database, the other from the NCBI database with Gene Accession AJ271361) containing the Gasz gene and 20 kilobases (kb) of flanking regions at both ends were downloaded, and the structure of the pufferfish Gasz gene was determined (Fig. 1D). Like Gasz genes in mammalian species, the pufferfish Gasz gene consists of 13 exons. Similar to many pufferfish genes, the Gasz gene is relatively small, spanning
12 kb, compared with the
60 kb mammalian Gasz genes. However, the sizes of exons 26 and 1012 are identical to those in the mammalian Gasz genes (Fig. 1E). Moreover, the Gasz gene in pufferfish lies between the Cftr and Wnt2 genes; the Gasz gene has a similar orientation to Wnt2 but an opposite orientation to Cftr (Fig. 1D), also similar to the mammalian Gasz genes.
Preferential Expression of the Pufferfish, Zebrafish, and Frog Gasz Genes in Gonads
We performed Northern blot analysis on multiple frog tissues. As shown in Fig. 2A, a single transcript with a size of
2.0 kb was exclusively detected in the testis. Given the limited sensitivity of Northern blot analysis, we also used RT-PCR to examine the Gasz mRNA in frog multiple tissues (Fig. 2B). To achieve the maximum sensitivity, we amplified the Gasz gene for 40 cycles. Meanwhile, as a loading control, we amplified frog Eif1a for 20 cycles to keep the reactions in the exponential range (Fig. 2B). Our RT-PCR analyses revealed that frog Gasz is also expressed in the ovary at lower levels than in the testis. This finding is consistent with the data we reported for the mammalian Gasz genes, which can be easily detected by Northern blot analysis in the testis but can only be detected using RT-PCR or Northern blot analysis using poly-A RNA [2].
|
Localization of Gasz mRNA in Frog Testis and Ovary
To further localize the expression site of Gasz in the frog gonads, we performed in situ hybridization analysis. In the frog testis, the hybridization signals were detected in pachytene, diplotene, and meiotically dividing spermatocytes (Fig. 3, AD). Because all germ cells within a spermatogenic cyst are enveloped by a single Sertoli cell, the cytoplasm of the Sertoli cell is widely spread, thus making it difficult to judge if hybridization signals are also present in Sertoli cells. Therefore, lower levels of expression of Gasz mRNA in Sertoli cells cannot be excluded. In the ovary, the signals were confined to oocytes (Fig. 3, EF). The results are also consistent with the mammalian experiment data [2].
|
GASZ Protein Expression in Frog Gonads
Using recombinant frog GASZ protein, we generated rabbit anti-frog GASZ polyclonal antibodies. As shown by Western blot analysis (Fig. 4A), the polyclonal antibodies recognized a GASZ protein with an expected size of
53 kDa exclusively in the testis and ovary. Immunohistochemical analyses revealed that GASZ protein was expressed predominantly in pachytene spermatocytes and Sertoli cells in the frog testis (Fig. 4B and C). Interestingly, cytoplasmic staining was observed in pachytene spermatocytes, while in Sertoli cells, the staining is nuclear (Fig. 4C). In the frog ovary, GASZ immunoreactivity was detected in the cytoplasm of oocytes (Fig. 4D and E). More interestingly, GASZ protein seemed to be confined in an oocyte cytoplasmic structure resembling the Balbiani body (Fig. 4E) [57].
|
| DISCUSSION |
|---|
|
|
|---|
Although the function of GASZ is currently unknown, one can hypothesize its function from the presence of the major motifs, the ANK and SAM domains. There are only a few known proteins that contain a combination of these ANK and SAM domains (i.e., the SHANK family [8, 9], CASK-interacting proteins [10], TANK [11], and SANS [12]). The ANKs are tandem repeats of about 33 amino acids constituting a ß-hairpin and two
-helices that potentially provide a site for protein-protein interaction [4, 13]. The SAM domain is a protein module of
70 amino acids found in a variety of signaling proteins, which mediate the homotypic and heterotypic dimerization of their proteins [3, 14, 15]. For example, the SAM domain of the SHANK protein seems to multimerize as homomers or heteromers to allow cross-linking of several proteins at postsynaptic sites of brain excitatory synapses [16]. It is therefore speculated that SHANKs are candidate master organizers of postsynaptic specialization. Likewise, GASZ might also function as an anchoring/scaffolding protein or a signaling molecule in germ cells during gametogenesis.
Interestingly, GASZ protein appears to be localized to the Balbiani body of frog oocytes. It has been shown that mitochondria, Golgi bodies, endoplasmic reticulum, and other organelles form aggregates or clouds and then congregate within a large structure known as the Balbiani body in the oocyte cytoplasm of many species. The Balbiani body has been proposed to function as a mRNA transport organizer that organizes and mediates the delivery of RNAs and germinal granules to the vegetal pole of the egg [17, 18]. Therefore, GASZ may be involved in these processes during oogenesis and early embryonic development. Frog GASZ protein appears to be expressed not only in spermatocytes and spermatids but in Sertoli cells as well. Because our preimmune sera did not generate immunoreactivity in similar sections, we believe that the staining is specific. This finding may reflect the difference between the frog GASZ and its mammalian orthologs.
In contrast with the ovary, where a follicular-luteal hierarchy is clearly evident, the testis of mammalian animal models possesses a highly complex organization. This makes it difficult to study discrete stages of germ cell progression in vivo [19, 20]. Although progress has been obtained by polarized Sertoli cell cultures using extracellular matrix-coated and uncoated permeable substrates and perifusion techniques [2123], attempts to duplicate in vitro conditions typical of the intact seminiferous tubules have not been very successful. Moreover, spermatogenesis is further regulated by extragonadal signals (e.g., FSH and LH) in intact animals. As a consequence, in vitro treatments may trigger nonphysiological events. Some nonmammalian vertebrates display cystic mode of spermatogenesis and slow progression of germinal stages throughout a year [24]. These features may facilitate analyses of processes underlying spermatogenesis in in vivo models. Frogs have compact ovoid testes and, similar to mammals, the testis is organized in tubules. Spermatogenesis within the tubules is cystic and each cyst is composed of a Sertoli cell that envelops germ cells at the same stage of development. After a winter stasis, the germinal compartment of the frog testis contains only spermatogonia due to the degeneration of the other stages. Spermatogonial multiplication occurs in the late winter-early spring [25, 26] when spermatocytes, spermatids are rare or absent. Spermiation occurs during the breeding season (MarchMay). Progression of spermatogenesis and appearance of spermatids and spermatozoa lasts until autumn. Thus, manipulation of temperature can be used to trigger or halt germ cell progression in laboratory conditions, making the amphibian testis a good model for studying male germ cell maturation [24]. On the other hand, frog oocytes have long been widely used to study oocyte growth and maturation as well as early embryo development. Future studies using the frog may help us to better understand the physiological roles of GASZ during spermatogenesis and oogenesis.
In summary, our data further prove that Gasz genes and proteins are truly evolutionarily conserved and have specific functions during germ cell maturation in both males and females. The basic information on Gasz genes in the three lower vertebrate species reported here will facilitate future efforts to characterize the physiological roles of GASZ during gametogenesis using lower vertebrate animal models.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Martin M. Matzuk, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. FAX: 713 798 5833; mmatzuk{at}bcm.tmc.edu ![]()
Received: 27 October 2003.
First decision: 17 November 2003.
Accepted: 30 January 2004.
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |