|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mechanisms of Hormone Action |
Department of Veterinary Pathobiology,3 College of Veterinary Medicine
Department of Pharmacology,4 College of Medicine, University of Minnesota, St. Paul, Minnesota 55108
| ABSTRACT |
|---|
|
|
|---|
estradiol, pregnancy, progesterone, steroid hormones, uterus
| INTRODUCTION |
|---|
|
|
|---|
45 kDa in size. CD38 is expressed in many different cell types, such as lymphocytes [9], pancreatic ß cells [4], neurons [10], and smooth muscle cells, including that of the myometrium [1113]. CD38 expression is regulated by many factors such as hormones, retinoic acid, and cytokines [1114]. In this context, we demonstrated in a previous study that estrogen increases CD38 expression. The increased CD38 expression is associated with augmented ADP-ribosyl cyclase, but not cADPR hydrolase, activity [11]. This differential regulation of a bifunctional protein would favor the increased production of cADPR. The endocrine profiles during pregnancy and parturition reveal that estrogen remains at relatively low levels during pregnancy and reaches high levels at or near parturition. Similarly, progesterone levels that are high during pregnancy reach low levels at the time of parturition in the rat [15, 16]. The myometrium remains quiescent during pregnancy, while it becomes highly contractile at the time of parturition. Changes in hormonal profile during the late stage of pregnancy and parturition affect many signaling molecules, which lead to uterine contraction. In this context, estrogen is known to induce gap junctions between cells [17, 18] and oxytocin receptors [15] in the myometrium. Recent studies have demonstrated that estrogen alters the expression of a variety of genes in the myometrium [6, 15, 16 21]. This altered gene expression in the myometrium is associated with the changes in uterine contractility during pregnancy and parturition. Elevation of intracellular calcium is required for uterine smooth muscle contraction and studies have demonstrated that the expression of contractile molecules is associated with intracellular calcium regulation. All ryanodine receptor subtypes (types 1, 2, and 3) are expressed in both rat and human myometrium. Expression of type 3 receptor is higher compared with type 1 and type 2 receptors during pregnancy in the rat and human. Although the expression level of type 3 RyR did not change in rat myometrium during pregnancy, it is downregulated in human myometrium at the end of pregnancy [22, 23]. Signaling through CD38/cADPR is involved in the regulation of intracellular calcium concentration. However, changes in the expression of CD38, ADP-ribosyl cyclase, and cADPR hydrolase activities and cADPR levels in the uterine smooth muscle during pregnancy and parturition have not been investigated. In this study, we examined the profile of CD38 expression, ADP-ribosyl cyclase, and cADPR hydrolase enzyme activities during pregnancy in the rat myometrium. We also investigated the effects of different estrogen:progesterone ratios on the enzyme activities and CD38 protein expression in myometrium obtained from ovariectomized rats.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Tris Base, Tris-HCl, Glucose, HEPES, nicotinamide guanine dinucleotide (NGD), cyclic guanosine diphosphoribose (cGDPR), 1,1,2,-trichlorotrifluoroethane, tri-n-octylamine, and other chemicals were purchased from Sigma Chemical Company (St. Louis, MO). Hanks balanced salt solution (HBSS), hexamers, oligo(dT), Taq DNA polymerase, and 100-base pair (bp) DNA ladder were purchased from GibcoBRL (Grand Island, NY). Cellulose polyethyleneimine (PEI) thin-layer chromatography plates were purchased from Fisher Scientific (Pittsburgh, PA). Goat polyclonal anti-rat CD38 antibody, donkey anti-goat IgG, and horseradish peroxidase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Gradient gels and Bio-Rad protein assay kit were purchased from Bio-Rad Laboratories (Hercules, CA). Estrogen detection kit was purchased from Diagnostic Products Corporation (Los Angeles, CA). Protease inhibitor cocktail set III (cat. no. 539134) was obtained from Calbiochem (La Jolla, CA). RNeasy mini kit was obtained from Qiagen (Valencia, CA). SYBR Green Master mix was purchased from Applied Biosystems (Foster City, CA). Resazurin, diaphorase, nicotinamide, nucleotide pyrophosphatase from Crotalus atrox venom, NADase from Neurospora crassa, and alkaline phosphatase from calf intestine were purchased from Boehringer, Roche Applied Science (Indianapolis, IN).
Experimental Animals and Design of Studies
Pregnant and nonpregnant female Sprague-Dawley rats were obtained from Harlan Laboratories (Madison, WI). Pregnant rats used in the investigations were at two different stages of pregnancy: preterm (1417 days of gestation) and at parturition (term). Ovariectomized and thyroparathyroidectomized rats (200225 g) were also used in the studies. The ovariectomized rats were kept in the animal care facilities for 3 wk before the experiments and were given water supplemented with 0.25% calcium gluconate during this period. These rats were randomly divided into five groups: 1) controls, which were injected with sesame oil; 2) estrogen-treated group (E), which received estradiol-17ß dissolved in sesame oil (200 µg kg1 day1); 3) estrogen and 1 mg of progesterone (EP1) group, treated with estrogen and 1 mg of progesterone; 4) estrogen and 10 mg of progesterone (EP10) group, treated with estrogen and 10 mg of progesterone; and 5) estrogen and 20 mg of progesterone (EP20) group, treated with estrogen and 20 mg of progesterone. All the treatments were performed subcutaneously for 5 consecutive days. The doses of progesterone chosen in an attempt to vary the estrogen:progesterone ratios were based on studies described by others [11, 24, 25].
The animals were killed by intraperitoneal injection of sodium pentobarbital (50 mg/kg), followed by exsanguination. The myometrium was removed and kept in ice-cold HBSS, buffered with 10 mM HEPES (pH 7.4) and containing 2.5 mM CaCl2, 1.2 mM MgCl2, and 10 mM glucose. After removing pups, myometrium was cleaned from connective tissues and endometrium, a small piece of myometrium from each rat was removed, frozen immediately in liquid nitrogen, and stored at 80°C. Due to the small size of the uterus for the control and progesterone-treated groups, myometrium from two rats was pooled for preparation of microsomes and referred to as n value of 1. For the estrogen-treated groups and gestational animals, myometrium from individual animals was used for preparation of microsomes and n refers to the number of animals used in the study. All procedures with animals were done under the guidelines and with the approval of the University of Minnesota Institutional Animal Care and Use Committee.
Myometrial Smooth Muscle Membrane Preparation
Myometrial membrane was prepared as described previously [11]. Briefly, myometrial tissues were minced and homogenized in 20 mM Tris-HCl, pH 7.2, containing 0.25 M sucrose and protease inhibitors (sucrose-Tris solution). The homogenate was centrifuged at 10 000 x g for 15 min and the resulting supernatant was centrifuged at 100 000 x g for 60 min. The individual pellets after 10 000 x g and 100 000 x g (microsomes) were suspended separately in sucrose-tris solution. Protein content of the microsomal fractions was determined using the Bio-Rad protein assay kit using bovine serum albumin as standard.
Detection of CD38 Protein in Uterine Microsomes
CD38 protein expression in the uterine microsomes was determined by Western blot as described in our previous study [11]. Briefly, uterine microsomal proteins were electrophoresed on 4%15% polyacrylamide gradient gels and the separated proteins transferred to a polyvinylidene difluoride membrane. The membranes were probed using a polyclonal goat anti-rat CD38 antibody. A horseradish peroxidase-conjugated donkey anti-goat IgG was used as a secondary antibody. The blots were developed using Bio-Rad chemiluminescence detecting system. CD38 protein expression in samples from different groups was compared by densitometry.
Measurement of CD38 mRNA Expression in Rat Myometrium
CD38 mRNA expression in myometrium from different groups of rats was measured as described [11]. Briefly, total RNA was extracted using RNeasy mini kit as per the manufacturer's protocol. Reverse transcription of total RNA to first-strand cDNA was done using random hexamers and oligo (dT) primers. cDNA was amplified by polymerase chain reaction (PCR) using rat CD38-specific primers.
The PCR primers were designed using nucleotide sequence for rat CD38 (GenBank accession number D29646). The following primers were used in the study: sense: 5'TGCAACAAGATTCTTCTTTGGAGCA3' (position between 400 and 425) and anti-sense: 5'CTCAGGATTTTTCACACACTGAAG3' (position between 876 and 900), giving a final 500-bp DNA product. Rat-actin primers producing an approximately 500-bp product were used as internal controls. The intensities of the bands were quantified by densitometry and the results expressed as the ratio of intensity of CD38 to that of ß-actin in sample from the same rat.
Real-Time Quantitative PCR
Quantitative real-time PCR was done using SYBR Green PCR master mix. First-strand cDNA obtained by reverse transcription of total RNA was amplified by PCR using the ABI Prism 7700 sequence detection system and the fluorescence was collected three times during each cycle as described [11]. The data were analyzed using Sequence Detection System version 1.7 software. All the samples were run in triplicate and the readings were normalized using No Template Control and Passive Reference dye included in the SYBR Green Master mix. ß-Actin was used as an internal control in each run. Normalized fluorescence was plotted against cycle number (amplification plot) and the threshold suggested by the software was used to calculate Ct (cycle at threshold). Results of the real-time PCR were expressed as Ct and the level of expression of CD38 was indicated by the number of cycles required to achieve the threshold level of amplification.
Detection of cADPR Levels in Uterine Smooth Muscle
Levels of cADPR in rat uterine smooth muscle were detected using a method described previously [26]. Briefly, uterine tissues were cleaned from connective tissues and endometrium and then frozen in liquid N2. Frozen samples were homogenized in 0.5 M ice-cold perchloric acid (PCA). After removal of protein by centrifugation at 7000 x g for 7 min, PCA was removed by mixing the PCA supernatant with a mixture of 1,1,2,-trichlorotrifluoroethane and tri-n-octylamine (3:1 volume). Following vigorous mixing for 30 sec and centrifugation of the samples at 7000 x g for 5 min, the upper aqueous layer was recovered and adjusted to pH 7.5 by adding Tris-base (25 µl of 2 M). Subsequently, samples were treated with enzymes to remove pyridine nucleotides, and cADPR levels were assayed as described previously [26].
Measurement of ADP-Ribosyl Cyclase Activity in Uterine Microsomes
ADP-ribosyl cyclase activity in the myometrial microsomes was determined by measuring the conversion of NGD, an analog of nicotinamide adenine dinucleotide, to cGDPR using a spectrofluorometer (Shimadzu Corporation, Kyoto, Japan), as described before [11]. The specific ADP-ribosyl cyclase activity was calculated using cGDPR standards, and the results were represented as nanomoles cGDPR per milligram protein per minute.
Ca2+ Release Bioassay for ADP-Ribosyl Cyclase Activity in Uterine Microsomes
ADP-ribosyl cyclase activity in uterine smooth muscle microsomes was also assayed by determining the amount of 3-deaza-NAD converted to 3-deaza-cADPR. Microsomes (50 µg protein) were incubated with 100 µM 3-deaza-NAD in buffer at pH 7.2 at 37°C in a total volume of 100 µl. At various times, 5 µl was removed and quickly added to 5 µl of 100 mM HCl to stop the reaction. Samples were kept frozen until assayed. The amount of 3-deaza-cADPR formed was determined using a sea urchin egg homogenate calcium release bioassay [27]. The 3-deaza-NAD was chosen as the substrate as the 3-deaza-cADPR product is 70 times more potent than cADPR in the calcium release bioassay and it is metabolically stable to enzymatic degradation [28]. Aliquots of the stopped reactions (1.5 µl) were added to wells of a 96-well plate, and calcium release was initiated by adding 150 µl of sea urchin egg homogenate to each well. The preparation of the egg homogenate has been previously described [27]. Calcium release was measured using a BMG FluoStar 96-well fluorescence plate reader. The amount of 3-deaza-cADPR formed during incubations with uterine smooth muscle microsomes was determined by comparing the amount of calcium released with a standard curve generated with 3-deaza-cADPR standards.
Measurement of cADPR Hydrolase Activity in Uterine Microsomes
The cADPR hydrolase activity was measured in the uterine microsomal fraction using 32P-cADPR as substrate, as described earlier [11]. Briefly, microsomal protein was incubated at 37°C in 20 mM Tris-HCl buffer, pH 7.2, containing 32P-cADPR and 600 µM unlabeled cADPR. At different time points, 1 µl of the reaction mixture was spotted on a PEI cellulose plate. The plate was developed in a solution containing 30% ethanol and 0.2 M NaCl, dried, and exposed to a phosphorimage screen. The amount of cADPR hydrolyzed to ADPR in the reaction was calculated by quantifying the densities of the spots corresponding to cADPR and ADPR using the Optiquant Imaging System. The cADPR hydrolase enzyme activity was expressed as nanomoles ADPR (milligram protein)1 (minute)1.
Statistical Analysis
All the data were analyzed by Student t-test or one-way ANOVA with Bonferroni multiple comparison test using the Graph Pad Prizm program. The significance was set at P < 0.05 and values are presented as mean ± SEM. For analysis, n values were used and refer to number of determinations.
| RESULTS |
|---|
|
|
|---|
CD38 mRNA expression was determined in myometrium obtained from preterm and term rats. In uterine smooth muscle obtained from term rats, there was increased CD38 mRNA expression compared with smooth muscle from preterm rats (Fig. 1A). Radiometric analysis of the intensity of the bands showed that samples from term rats had approximately 1.5-fold higher CD38 mRNA expression compared with samples from preterm rats. The intensity of CD38 bands was normalized using corresponding ß-actin bands. Real-time PCR of RNA extracted from myometrium of term rats confirmed increased CD38 mRNA expression. The mean Ct values were 25.8 ± 0.4 and 26.7 ± 0.1, respectively, for samples from term and preterm rats.
|
CD38 protein expression was determined in the microsomes obtained from preterm and term rats. Densitometric analysis showed that there was approximately a 2.5-fold greater CD38 protein expression in microsomes from term rats than from preterm rats (Fig. 1B).
ADP-Ribosyl Cyclase and cADPR Hydrolase Activities in the Rat Myometrium During Gestation
CD38 is a bifunctional protein and has both ADP-ribosyl cyclase and cADPR hydrolase activities. ADP-ribosyl cyclase activity measured in microsomes obtained from term rats was significantly higher than in microsomes from preterm rats (Fig. 2A). This difference in activity was approximately 2-fold and consistent with increased CD38 expression. However, the cADPR hydrolase activity measured in microsomes from the two groups of rats showed no significant difference (Fig. 2B). No significant differences in the enzyme activities were observed between the samples from Days 14 and 17 of gestation.
|
cADPR Levels in the Rat Myometrium During Gestation
We measured cADPR levels in myometrial samples obtained from preterm and term rats using the cycling assay. In myometrium samples obtained from term rats, cADPR levels were significantly (P < 0.05) higher than in myometrium from preterm rats. The levels of cADPR were 1056 and 448 fmoles per milligram protein in myometrium obtained from term and preterm rats, respectively (Fig. 2C).
Effect of Estrogen and Progesterone on CD38 Expression and Function
The differential regulation of ADP-ribosyl cyclase and cADPR hydrolase activities seen in myometrium from term rats was similar to estrogen effects reported in a previous study [24]. We extended these studies in ovariectomized rats to examine the effect of different doses of progesterone on CD38 expression and the enzyme activities in uterine smooth muscle. Consistent with our previous study [11], estrogen resulted in increased CD38 protein expression. Estrogen-induced CD38 protein expression was unaffected by coadministration of 1 mg progesterone (Fig. 3). CD38 protein expression was lower in uterine microsomes obtained from rats treated with estrogen and either 10 or 20 mg progesterone (EP10 and EP20) than in microsomes from estrogen-treated rats (Fig. 3). Progesterone treatment alone had no significant effects on basal CD38 protein expression (data not shown).
|
ADP-ribosyl cyclase activity, measured as the conversion of NGD to cGDPR, in microsomes obtained from rats in E and EP1 groups was significantly higher than in microsomes obtained from the other groups (C, EP10, EP20) (Fig. 4A). Progesterone treatment alone had no significant effects on basal ADP-ribosyl cyclase activity in rat uterine smooth muscle (data not shown). To further confirm the effects of progesterone, ADP-ribosyl cyclase activity was also measured by the calcium release assay using 3-deaza-NAD and uterine microsomes obtained from the five groups of rats (C, E, EP1, EP10, and EP20). The magnitude of calcium release from sea urchin egg homogenates confirmed the results obtained using the NGD assay (data not shown). The cADPR hydrolase activities in microsomes obtained from the five groups of rats were not statistically different from each other (P > 0.05; Fig. 4B).
|
| DISCUSSION |
|---|
|
|
|---|
Changes in hormonal profile and cell signaling during pregnancy lead to increased uterine motility, which initiates labor. The myometrium is quiescent during pregnancy, when progesterone level is high and estrogen level is low. However, uterine motility increases at the end of pregnancy, when estrogen levels sharply increase and progesterone levels decrease. The myometrium is a main target for estrogen action, although effects of estrogen have been shown in other tissues, such as bone marrow, kidney, and adipose tissues [20, 29]. Changes in the estrogen:progesterone ratio are reported to lead to many structural changes, such as increase in number of oxytocin receptors, extracellular matrix deposition, cellular remodeling, and myometrial cell growth [15, 10, 3033]. Furthermore, the expression of proteins such as c-fos, connexin-43, and receptors for oxytocin and prostaglandin F2
in the myometrium is upregulated prior to labor [15, 19, 21, 31, 32, 34]. These studies provide evidence for changes in the expression of genes involved in cell signaling during the onset of labor.
CD38/cADPR signaling is well documented in the regulation of intracellular calcium in a variety of smooth muscle cells [3, 1113, 24, 35]. In the present study, we demonstrated that the expression of CD38 is higher at parturition compared with Days 1417 of pregnancy. The higher CD38 expression would result in increased cADPR production and release of intracellular calcium, which would favor uterine motility. Recently, a study by Barata et al. demonstrated a role for the CD38/cADPR signaling pathway in intracellular calcium release and myometrial contraction in human myometrial cells and muscle strips [12]. The switch from low CD38 expression and enzyme activities to high expression and differential regulation of the two enzyme activities happens very close to term in the rat. In this species, there is a switch from a low estrogen:progesterone ratio during gestation to a sharp increase in the ratio at term. This increase in estrogen level is most likely involved in the regulation of CD38 expression and differential regulation of its enzyme activity. Estrogen palindromic sequences have been identified in the promoter region of the CD38 gene [36], which may account for the estrogen effects in the myometrium.
The mechanism by which progesterone affects the expression of CD38 in uterine smooth muscle is not known. In an attempt to address the effect of progesterone on CD38 expression, we administered different doses of progesterone along with a fixed dose of estrogen. In ovariectomized rats, earlier studies demonstrated that estrogen treatment resulted in higher CD38 expression [11] and ADP-ribosyl cyclase activity in the rat myometrium [11, 24]. Furthermore, we also demonstrated in that study [11] that cADPR hydrolase activity decreases during estrogen treatment, reflecting a posttranslational modification of the CD38 protein. In the present study, we demonstrate that estrogen-induced changes in CD38 protein expression and ADP-ribosyl cyclase activity are inhibited by 10 and 20 mg, but not by 1 mg, of progesterone. In the presence of high doses of progesterone, there were significant decreases in CD38 expression and enzyme activities. These results demonstrate an apparent inhibitory effect of progesterone on estrogen effects. In this context, several studies have reported the inhibitory effects of progesterone on estrogen-induced gene expression, resulting in delayed labor [15, 19, 25, 29, 34]. For example, the expression levels of calcium channel protein, connexin 43, receptors for oxytocin and PGF2
, c-fos, c-jun, junD, and junB are inhibited by progesterone [15, 17, 19, 29, 3134, 3739]. Furthermore, in the presence of a progesterone antagonist, there is increased expression of genes that are normally upregulated during late gestation [19]. The increased CD38 expression, ADP-ribosyl cyclase activity, and cADPR levels and the decreased cADPR hydrolase activity observed in the present study at parturition could also arise from withdrawal of the inhibitory effect of progesterone. Progesterone appears to not only inhibit estrogen stimulation of CD38 expression but also the posttranslational modification that results in the differential regulation of the enzyme activities.
In summary, in the present study, we demonstrate increased CD38 expression and ADP-ribosyl cyclase activity in myometrium from rats at parturition compared with at Days 1417 of pregnancy. These changes are also associated with increased cADPR levels. The effects of progesterone on CD38 expression and function are similar to those seen during midpregnancy, when progesterone levels are relatively high. The precise mechanism by which progesterone inhibits estrogen effects on CD38 expression and the differential regulation of enzyme activities needs further investigation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Timothy F. Walseth, Department of Pharmacology, Medical School, University of Minnesota, 312 Church St. SE, Minneapolis, MN 55455. FAX: 612 625 5203; walseth{at}mail.ahc.umn.edu ![]()
Received: 4 December 2003.
First decision: 18 December 2003.
Accepted: 18 February 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Malavasi, S. Deaglio, A. Funaro, E. Ferrero, A. L. Horenstein, E. Ortolan, T. Vaisitti, and S. Aydin Evolution and Function of the ADP Ribosyl Cyclase/CD38 Gene Family in Physiology and Pathology Physiol Rev, July 1, 2008; 88(3): 841 - 886. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Kang, J. A. Jude, R. A. Panettieri Jr., T. F. Walseth, and M. S. Kannan Glucocorticoid regulation of CD38 expression in human airway smooth muscle cells: role of dual specificity phosphatase 1 Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L186 - L193. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dabertrand, N. Fritz, J. Mironneau, N. Macrez, and J.-L. Morel Role of RYR3 splice variants in calcium signaling in mouse nonpregnant and pregnant myometrium Am J Physiol Cell Physiol, September 1, 2007; 293(3): C848 - C854. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Umesh, M. A. Thompson, E. N. Chini, K.-P. Yip, and J. S. K. Sham Integrin Ligands Mobilize Ca2+ from Ryanodine Receptor-gated Stores and Lysosome-related Acidic Organelles in Pulmonary Arterial Smooth Muscle Cells J. Biol. Chem., November 10, 2006; 281(45): 34312 - 34323. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Deshpande, T. A. White, S. Dogan, T. F. Walseth, R. A. Panettieri, and M. S. Kannan CD38/cyclic ADP-ribose signaling: role in the regulation of calcium homeostasis in airway smooth muscle Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L773 - L788. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |