Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print April 7, 2004.
Biol Reprod 2004, 10.1095/biolreprod.103.025908
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/2/455    most recent
biolreprod.103.025908v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacLean, J. A.
Right arrow Articles by Green, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacLean, J. A., II
Right arrow Articles by Green, J. A.
Agricola
Right arrow Articles by MacLean, J. A.
Right arrow Articles by Green, J. A.
BIOLOGY OF REPRODUCTION 71, 455–463 (2004)
DOI: 10.1095/biolreprod.103.025908
© 2004 by the Society for the Study of Reproduction, Inc.

Embryo

Atypical Kunitz-Type Serine Proteinase Inhibitors Produced by the Ruminant Placenta1

James A. MacLean, II3, R. Michael Roberts, and Jonathan A. Green2

Department of Animal Sciences, University of Missouri-Columbia, Columbia, Missouri 65211


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recently, an unusual family of genes was identified with expression confined to the trophoblast of ruminant ungulate species. The members of this family (the trophoblast Kunitz domain proteins, or TKDPs) are characterized by the presence of one or more similar, approximately 80-residue repeat sequences placed ahead of a Kunitz serine proteinase-inhibitor domain. To examine the specificity of the Kunitz moiety, the Kunitz domains of selected TKDPs and a control Kunitz protein, bovine pancreatic trypsin inhibitor (BPTI), were produced as glutathione S-transferase fusions, and their abilities to inhibit six serine proteinases were examined. Circular dichroism spectroscopy confirmed that the Kunitz fold was intact. Three of the TKDPs had unusual residues at their P1 "warhead" (ovine TKDP-1, Asn; bovine TKDP-3, Thr; and bovine TKDP-5, Ile) and exhibited no measurable inhibitory activity toward any of the proteinases. Three (ovine TKDP-3, bovine TKDP-3, and bovine TKDP-4) lacked the conserved cysteines at residues 14 and 38 that form one of the highly conserved disulfide bonds that are structurally important in all known mammalian Kunitz proteins. Ovine TKDP-3 and bovine TKDP-4 had P1 lysines and inhibited trypsin and plasmin with Ki values only approximately 10-fold higher than that of BPTI. Bovine TKDP-2 had a P1 lysine and the three conserved disulfides, but it possessed an unusual residue (Asp) at P2. It exhibited no inhibitory activity. These data suggest that the function of the TKDP, like certain Kunitz proteins found in snake venoms, may not be in proteinase inhibition.

implantation, placenta, trophoblast, uterus


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A family of secreted Kunitz domain proteins in the trophoblast of cattle and sheep—the so-called trophoblast Kunitz domain proteins, or TKDPs—has recently been described [1, 2]. The inferred sequence of each TKDP contains a secretory signal peptide followed by one or more approximately 80-amino acid N-terminal domains that have no similarity to any known proteins but exhibit 80% or more similarity to each other and, therefore, likely have evolved from a common precursor sequence. The carboxyl terminus of each TKDP contains a single Kunitz domain. So far, five cDNA have been cloned from bovine (bo) and ovine (ov) trophoblast (boTKDP-1 through -5 and ovTKDP-1 through -5) [2]. Individual TKDPs do not exhibit identical patterns of expression during pregnancy. In general, most are expressed maximally around the time of apposition and adhesion of the trophoblast to the uterine luminal epithelium, a stage of pregnancy at which the mother shows uterine responses (e.g., local edema and angiogenesis) to the presence of the adhering conceptus [2].

The Kunitz family of polypeptides is large, ubiquitous, but apparently, absent in prokaryotes. The best-investigated member of this family is bovine pancreatic trypsin inhibitor (BPTI; aprotinin), which was crystallized by Kunitz and Northrup [3] in 1936. Most Kunitz family members are inhibitors of serine proteinases [3–5], and they have assumed crucial roles in processes, such as blood coagulation and tissue remodeling, in which the extent of proteolysis must be carefully limited. However, the Kunitz module also has been utilized for other functions that require protein-protein interactions but not necessarily proteinase inhibition [6, 7]. Kunitz domains are of low molecular weight (~60 amino acids), basic, and characterized by the placement of six conserved cysteine residues that form three disulfide linkages that contribute to the compact and stable nature of the folded polypeptide [4]. The P1 residue in the proteinase-inhibitory loop provides the primary specificity determinant and dictates much of the inhibitory activity that a particular Kunitz protein has toward a targeted proteinase. However, other residues, particularly in the inhibitor loop region, contribute to the strength of binding. In most cases, lysine or arginine occupy the P1 position to inhibit proteinases that cleave adjacent to those residues in the protein substrate.

Two features of the TKDP family are particularly notable. First, the family members display a range of amino acids in the P1 position [2]. Second, three TKDPs (ovTKDP-3, boTKDP-3, and boTKDP-4) are distinct from any other known mammalian Kunitz proteins in that they lack one of the three disulfide bonds (Cys-14 and Cys-38; BPTI numbering) that hold the Kunitz module in its classically rigid conformation [3–5]. Bovine TKDP-3 and -4, as well as ovTKDP-3, might therefore be expected to have a looser conformation than other Kunitz proteins, and this might be expected to be evident in their inhibitory properties.

The present study involved experiments to assess the proteinase-inhibitory specificity of several TKDP Kunitz domains to gain some insight regarding the type of proteinases they might inhibit. An additional goal was to determine if the atypical Kunitz domains, which lack one of the conserved disulfides, are indeed capable of forming a typical Kunitz fold.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials

Bovine trypsin, bovine chymotrypsin, bovine thrombin, human leukocyte elastase, human plasmin, human plasma kallikrein, N-benzoyl-DL-arginine p-nitroanilide, N-benzoyl-L-Ala-Pro-Phe p-nitroanilide, N-p-Tosyl-Gly-Pro-Lys p-nitroanilide, N-t-BOC-L-Ala-Ala-Val p-nitroanilide, tosyllysyl chloromethyl ketone (TLCK), and BPTI were from Sigma (St. Louis, MO).

Production of Recombinant TKDP-Inhibitor Proteins

The region encoding the Kunitz domain for each TKDP protein was amplified by polymerase chain reaction (PCR) and engineered to include in-frame, flanking EcoRI and BamHI restriction sites for directional cloning into the pGEX2T bacterial expression vector (Pharmacia, Piscataway, NJ). For ovTKDP-1 Kunitz construction, the oligonucleotides corresponded to cDNA bases 631–648 (P125, GCGGGATCCATGGCTTCTAAGCCTGCCCTT) and 808–825 (P135, GCGGAATTCTTATCACAGAGACCCTGCCTC). For boTKDP-3 and ovTKDP-3 Kunitz construction, the oligonucleotides corresponded to cDNA bases 361–378 (P122, GCGGGATCCGCAGATTCTAGGCCTGCC) and 541–558 (P123, GCGGAATTCTTATCACAGGGAACCAGCCCC). The P122 and P123 oligonucleotides were also used for amplification of boTKDP-4 Kunitz domain and corresponded to cDNA bases 334–354 and 514–530, respectively. For boTKDP-2 Kunitz construction, the oligonucleotides corresponded to cDNA bases 330–347 (GCGGGATCCCATGCAGCTTCTAAGCCT) and 513– 530 (GCGGGATCCTTATCACATGGTCACAGGCAC). For boTKDP-5 Kunitz construction, the oligonucleotides corresponded to cDNA bases 140–157 (GCGGGATCCACTTCTAGGCCTGCTTTC) and 317–334 (GCGGAATTCTTATCACGGGGACCCTGCCCC). The original cDNA subclones [2] were used as template. The PCR products were generated under the following conditions: denaturing, 95°C for 30 sec; annealing, 42°C for 30 sec; and extension, 72°C for 60 sec for 36 cycles. The PCR products were digested with EcoRI and BamHI in Multicore buffer (Promega, Madison, WI) for 4 h at 37°C. The digested products were separated by agarose gel electrophoresis. Bands of the proper size were excised, purified by QiaEX extraction (Qiagen, Santa Clara, CA), and directionally cloned into the EcoRI/BamHI cut vector. The resulting plasmids were sequenced to verify the proper orientation and reading frame and to confirm that mutations had not been introduced during the PCR.

For protein expression, TKDP-Kunitz-glutathione S-transferase (GST) constructs or GST parent plasmids were transformed into bacterial strain BL21 (De3) pLysS. Bacterial cultures were grown at 37°C to an optical density of 0.5 at 600 nm, then equilibrated to 25°C before induction of protein expression by 10 mM isopropyl ß-D-thiogalactoside. Cells were harvested after 6 h at 25°C and broken in a French press. Soluble lysate, containing GST fusion proteins, was filtered (pore size, 0.45 µm) and supplemented with 0.02% PMSF, 0.02 mM sodium azide, and 5 mM EDTA. The GST fusion proteins were purified from the soluble lysate by batch binding to glutathione sepharose 4B [8]. After several washes with PBS containing 5 mM EDTA at 4°C, fusion proteins were eluted from the matrix with 100 mM reduced glutathione in PBS. The eluted fractions were concentrated using Centriprep centrifugal filters with 3000 molecular weight cut-off membranes (Millipore, Billerica, MA) and dialyzed against 4000 volumes of PBS to remove the majority of the reduced glutathione. Purification of the proper size protein was verified by SDS-PAGE, and protein yields were determined [9].

Isolation of Free Kunitz Proteins

The domains of each fusion protein are joined by a bridging sequence that contained a thrombin cleavage site to allow removal of the GST-affinity tag. For assays involving free inhibitor, Kunitz-GST fusions were diluted in PBS to 5 mg/ml and digested by thrombin overnight at 25°C in 25 mM Tris (pH 8.0) and 100 mM NaCl. After the incubation, NaCl and glycerol were added to provide final concentrations of 1 M and 5%, respectively. The mixture was then purified over a Superose 12 column (Pharmacia) at a flow rate of 0.5 ml/min in the high salt/glycerol buffer. The size and purity of the free Kunitz domain was assessed by SDS-PAGE and quantified by bicinchoninic acid assay (Pierce, Rockford, IL) by following the manufacturer's instructions.

Circular Dichroism Measurements

Purified Kunitz domain polypeptides were dialyzed against 10 000 volumes of chloride-free buffer (10 mM potassium phosphate [pH 7.5] and 50 mM potassium fluoride). Circular dichroism spectra (CD) were recorded with an AVIV model 202 spectrapolarimeter (AVIV Inc., Lakewood, NJ) in cuvettes of 0.1-cm path length. The CD signals were recorded in the far ultraviolet (UV) range in 0.5-nm increments from 260 to 195 nm. Each reported spectrum is the consensus of four spectra determinations with an averaging time of 5 sec at each wavelength tested. The spectra are expressed in mean residue elipticity (deg cm2/dmol). Mean residue concentrations were calculated by using the following data for each protein: native BPTI, 56 residues, Mr 6513; boTKDP-4, 66 residues, Mr 7196; and ovTKDP-1, 66 residues, Mr 7216.

Proteinase-Inhibition Assays

The activities of elastase, plasmin, trypsin, chymotrypsin, kallikrein, and thrombin were assayed by modifying a procedure described previously [10]. These proteinases represent a range of protein substrate preferences and are commercially available. For these assays, 1 µg of target proteinase (representing protein concentrations of 2.2 x 10–7 to 5.9 x 10–8 M) was preincubated with 75 µg of Kunitz inhibitor-GST fusion protein (1.1 x 10–5 M) in a total volume of 50 µl at 25°C for 30 min. The reaction volume was brought to 190 µl by the addition of water and 20 µl of 10x assay buffer to produce a final concentration of 25 mM Tris-HCl (pH 8.0) and 100 mM NaCl. The reaction was initiated by the addition of 10 µl of the synthetic substrate dissolved in dimethyl sulfoxide (Table 1). The change in absorbance was monitored continuously at 405 nm by using a Tecan Rainbow (Tecan, Durham, NC) microplate reader for 30 min at 25°C. The proteinases and synthetic substrates were as follows: bovine trypsin, N-benzoyl-DL-arginine p-nitroanilide; bovine chymotrypsin, N-benzoyl-L-Ala-Pro-Phe p-nitroanilide; human plasmin, human plasma kallikrein, and bovine thrombin, N-p-Tosyl-Gly-Pro-Lys p-nitroanilide; and human elastase, N-t-BOC-L-Ala-Ala-Val p-nitroanilide. Samples were prepared in triplicate and results reported as the mean change in absorbance following correction for background hydrolysis and differences in sample absorbance at time zero. The greater the inhibitory capacity of the inhibitors, the lower the amount of product that is produced. The effects of inhibitors on enzymatic activity were analyzed by least-squares procedure using the general linearized model of the Statistical Analysis System (SAS Institute, Cary, NC). When significant interactions were indicated, the Duncan multiple-range test and Student-Newman-Keuls test were used to assign comparison groups.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Summary of proteinase substrates and assay conditions

Measurement of Inhibition Equilibrium Constants

To determine the inhibition equilibrium constants, it was necessary to know the concentration of "active" inhibitor in the purified recombinant proteins. The concentration of active sites within trypsin, plasmin, and chymotrypsin proteinases were determined by using the burst titrant p-nitrophenyl guanidinobenzoate (pNPGB) [11]. Cleavage of the pNPGB by the enzyme results in dead-end inhibition of the active site with only one turnover of product per trypsin active site. The concentration of active enzyme was calculated from the amount of product released ({varepsilon} = 16 595 M–1). The molar concentrations of the Kunitz proteins were then determined by titration with known concentrations of active trypsin [12]. Trypsin/proteinase-inhibitor complex formation was assumed to be 1:1. Inhibitor stocks were diluted to 10 nM (according to total protein determination) in assay buffer. Trypsin stocks were serially diluted in assay buffer to provide a range of concentrations (final assay, 0–50 nM). Inhibitor and trypsin were preincubated at 25°C for 30 min, and residual enzymatic activity was determined after the addition of substrate. The linear portion of the titration curve was extrapolated to the x-axis, and the concentration of enzyme at that point was taken as the concentration of active inhibitor.

The Ki was determined as follows: Proteinases were prepared in 50 mM Tris (pH 8.0), 150 mM NaCl, and 0.1% bovine serum albumin to a final concentration of 10 nM as determined by active site titration. The presence of the albumin provided greater reproducibility to the assays and did not affect final values of inhibitory constants. Proteinase samples were incubated with increasing concentrations of Kunitz protein for 30 min at 25°C. Enzyme reactions were initiated by addition of colorimetric substrate at a final concentration near the determined Km, because excessive free substrate may disrupt proteinase-inhibitor complexes [12, 13]. Enzymatic activity toward substrate was measured as the rate of optical density change per hour at 405 nm. Resulting rates were then converted to the fraction of enzymatic activity remaining and plotted against the log of inhibitor concentration. The concentration of inhibitor at which 50% proteinase activity remained (IC50) was determined by nonlinear regression (GraphPad Prism for Windows, Version 3.00; GraphPad Software, San Diego, CA; http://www.graphpad.com). The IC50 was then used to obtain the apparent Ki (Ki(app)) value by fitting the single binding site competition model included with the software package. The true Ki value was obtained after correction for the concentration of substrate (S) used in the assay by the following equation:


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of Recombinant Kunitz-GST Fusion Proteins

To explore the proteinase-inhibitory capacity of the TKDP fusion proteins, the Kunitz domains of ovTKDP-1, ovTKDP-3, boTKDP-2, boTKDP-3, boTKDP-4, and boTKDP-5 (Fig. 1A) were expressed as GST fusion proteins (Fig. 1B). The BPTI was expressed similarly to serve as a positive control in the experiments. The GST system has been demonstrated by others to be an effective method for the production of functional Kunitz proteins [14, 15]. These Kunitz domains represent a range of different P1 residues and comprise both typical and atypical Kunitz proteins in terms of conserved cysteines. For the most part, only one member of an orthologous pair was chosen [2]. Both ovTKDP-1 and boTKDP-2 were expressed as representatives for the boTKDP-1/ovTKDP-1 and boTKDP-2/ovTKDP-2 orthologues, respectively. An exception was for the boTKDP-3/ovTKDP-3 pair; they possess different P1 residues and were predicted to have different specificities. Both boTKDP-4 and boTKDP-5 do not have obvious ovine orthologues, and ovTKDP-4 and ovTKDP-5, which have identical amino acid sequences in the Kunitz domain, were unavailable. However, they were assumed to have specificities similar to that for ovTKDP-1 because of an Asn in the P1 position of each of these proteins. All the fusion proteins prepared in this manner remained soluble when expressed at 25°C and could be purified from bacterial proteins by passage over GST-affinity columns. Although the yields of the different TKDPs were adequate for preparing material for structural studies, BPTI was consistently difficult to produce as a GST fusion protein, with recovered amounts typically being less than 2 mg/L of fermentation medium (Fig. 1B). The lower Mr bands in some preparations of recombinant proteins (Fig. 1B) contained an intact glutathione-binding cleft, because they copurified with the full-length forms on the affinity column and also reacted with anti-GST antiserum on Western blots (data not shown). It is assumed that these products were partially degraded by bacterial proteinases.



View larger version (82K):
[in this window]
[in a new window]
  		FIG. 1. TKDP Kunitz domains expressed as GST fusion proteins. A) Aligned sequences of Kunitz proteins expressed as GST fusions. The cDNA encoding BPTI and the Kunitz regions for six TKDP were cloned into the pGEX2T vector for expression as GST fusion proteins. The shaded residues indicate the thrombin recognition sequence and the P1 residue (bold) for each protein. The stars indicate the placement of conserved cysteines that are the hallmarks of the Kunitz structure. The brackets indicate the pairings of these cysteines to form disulfide linkages. Note the alterations in the second and fourth cysteines for boTKDP-3, boTKDP-4, and ovTKDP-3 that would preclude formation of the disulfide bond linking the two inhibitory loops of the Kunitz fold. B) GST and TKDP-GST fusion proteins (2.5 µg/lane) were separated by 12.5% SDS-PAGE and visualized by Coomassie staining. The positions at which the fusion proteins and the GST migrate are indicated with arrows. Those minor bands below the fusion are nonspecific degradation products that contain an intact GST module able to bind to the affinity matrix. The nomenclature is as follows: O (ovine) or B (bovine), clone number, then K (Kunitz). The numbers underneath each lane indicate the typical yields of soluble GST fusion protein per liter of expression culture

Purification of Free Kunitz Proteins by Superose 12 Chromatography and Analysis of Their Folding

For some, but not all, studies, the Kunitz domains of BPTI, ovTKDP-1, and boTKDP-4 were cleaved from the GST moiety using thrombin. Reaction products were separated by Superose 12 column chromatography. Addition of high salt (1 M) and 5% glycerol to the chromatography buffer (PBS) greatly reduced aggregation within these samples and typically produced two well-defined peaks (Fig. 2A). The first eluted peak contained GST and some fusion protein that had remained undigested. The second peak represented the free Kunitz protein. The nature of the trailing shoulder on this second peak is unclear, but it could represent either protein that was improperly folded or aggregates of cleavage products.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Purification and structural analysis of TKDP Kunitz domains. A) Thrombin-cleaved boTKDP-4 Kunitz-GST fusion protein was subjected to Superose 12 column chromatography under optimized conditions to minimize aggregation of GST and free Kunitz domains (see Materials and Methods). The peaks corresponding to the elution of GST and free boTKDP-4 Kunitz protein (B4K) are indicated. The difference in peak heights is consistent with the expected 4:1 mass ratio for GST to B4K. Recombinant BPTI and ovTKDP-1 were purified similarly (data not shown). B) The near-UV spectra for native BPTI and recombinant ovTKDP-1 and boTKDP-4 Kunitz domains are shown. The spectra from four CD experiments were averaged and presented as mean residue elipticity. The concentrations for each protein sample were as follows: BPTI, 1.63 x 10–5 M; ovTKDP-1, 2.48 x 10–5 M; and boTKDP-4, 3.3 x 10–5 M. The nomenclature is as follows: O (ovine) or B (bovine), clone number, then K (Kunitz)

To confirm the extent of proper folding of the recombinant proteins, the structural conformations of three Kunitz domains—those for boTKDP-4, ovTKDP-1, and native BPTI (purchased commercially and titered before analysis for antitrypsin activity)—were examined by CD. Native BPTI, approximately 50% of which reacted with trypsin, was included in the analysis to provide a reference spectrum. The CD spectrum for each protein was determined by scanning in the far UV range (195–260 nm). The spectra for all three proteins exhibited the same general shape (Fig. 2B). A pronounced minimum was observed at 205 nm, a shoulder between 215 and 225 nm, and a flattening of the spectrum after 235 nm. Despite the fact that each protein was analyzed at approximately the same concentration, the minimum at 205 nm was markedly lower for BPTI than for either boTKDP-4 or ovTKDP-1. The data suggested that the boTKDP-4 and ovTKDP-1 preparations contained properly folded Kunitz domains but were accompanied by material that had not folded correctly.

Proteinase-Inhibition Assays

To gain insight regarding the possible inhibitory specificity of these Kunitz proteins, a known amount of recombinant fusion protein (75 µg; 1.1 x 10–5 M) was preincubated with 1 µg of either trypsin, chymotrypsin, elastase, plasma kallikrein, thrombin, or plasmin, and the residual amidolytic activity was determined using synthetic peptide substrates in a colorimetric assay. Glutathione S-transferase protein was included as one of the no-inhibitor controls; BPTI, a Kunitz inhibitor of known specificity, was used as a positive control and, as expected, inhibited trypsin, plasmin, and chymotrypsin (Fig. 3). Recombinant boTKDP-4 and ovTKDP-3, both of which possess Lys at their P1 positions, inhibited trypsin and plasmin under the same assay conditions (Fig. 3). None of the TKDP Kunitz proteins was found to significantly inhibit plasma kallikrein, elastase, thrombin, or chymotrypsin. Furthermore, ovTKDP-1 (P1, Asn), boTKDP-2 (P1, Lys), boTKDP-3 (P1, Thr), and boTKDP-5 (P1, Ile) failed to exhibit antiproteolytic activity against any of the proteinases used in the assay.



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 3. Inhibition of serine proteinases by Kunitz proteins. The bar graphs indicate the residual amidolytic activity following 30-min preincubation of 1 µg of target proteinase and 75 µg of the indicated inhibitor. Each bar represents the mean ± SD of three assays. The GST fusion proteins were left intact for this assay; therefore, GST was included in the first lane as the noninhibited control. Each panel represents the battery of proteins against a single proteinase as indicated. Peptide substrate sequences, concentrations, and buffer conditions are summarized in Table 1. The letters above each bar indicate statistically significant inhibition (P < 0.001) of the target proteinase compared to the uninhibited (GST) control. Those bars with the same letter do not differ significantly from one another. The nomenclature is as follows: O (ovine) or B (bovine), clone number, then K (Kunitz)

Calculation of Inhibitory Constants

In preliminary experiments designed to measure TKDP-inhibitory constants (Ki) against serine proteinases, inhibitory constants were calculated using inhibitor concentrations determined as total protein in the preparation (data not shown). It became apparent, however, that the presence of contaminating GST and Kunitz-GST proteolytic fragments, which varied in amounts between protein preparations (Fig. 1B), inflated the protein concentrations of potential inhibitors. Additionally, the dye-binding methods used for determination of protein concentrations did not distinguish between properly folded and misfolded Kunitz proteins. Data obtained from the CD spectra (Fig. 2B) suggested that only approximately a third of the ovTKDP-1 and half the boTKDP-4 Kunitz domains had folded into the conformation that would provide a minimum at 205 nm in the CD spectrum. In addition, preparations of proteinases always contain a proportion of inactive enzyme. Because these ambiguities existed, it was first necessary to estimate the amount of active enzyme in the commercial preparations used (Fig. 4A) and the concentration of active inhibitor present in each sample of recombinant Kunitz protein (Fig. 4B) before attempting to determine a Ki value. Figure 4, C and D, shows typical equilibrium activities of trypsin and plasmin (each 10 nM) in the presence of increasing concentrations of boTKDP-4. Data for all assays are summarized in Table 2.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 4. Calculation of Kunitz protein inhibition constants. A) The burst titrant pNPGB was used to calculate the concentration of active enzyme used for inhibition assays as described in Materials and Methods. B) The concentration of active proteinase inhibitor was determined by titration with known quantities of trypsin activity. The linear portion of the titration curve was extrapolated to the x-axis, and the concentration of enzyme at that point was taken as the concentration of active inhibitor. C) Determination of Ki for boTKDP-4 against trypsin. To calculate Ki, the log of the inhibitor concentration was graphed against residual activity and the resulting curve fit assessed by nonlinear regression analysis. The Ki(app) value was determined from the concentration of inhibitor that produced 50% inhibition of the enzyme (IC50). D) Determination of Ki for boTKDP-4 against plasmin. The nomenclature is as follows: O (ovine) or B (bovine), clone number, then K (Kunitz)


View this table:
[in this window]
[in a new window]
  		TABLE 2. Summary of inhibition constants (Ki).*

Inhibitory constants for ovTKDP-3 and boTKDP-4 against trypsin were 2.60 ± 0.8 (mean ± SEM) and 1.65 ± 0.2 nM, respectively. The corresponding values for inhibition of plasmin were 4.99 ± 0.8 and 1.50 ± 0.3 nM, respectively. The control inhibitor, BPTI, inhibited trypsin, plasmin, and chymotrypsin with inhibitory constants of 0.63 ± 0.2, 0.16 ± 0.1, and 2.5 ± 0.4 nM, respectively. The Ki (1.54 ± 0.1 nM) of the Kunitz domain of boTKDP-4, after it had been cleaved from its GST fusion product and purified, was not significantly different from that obtained with the intact fusion protein (Table 2).

BoTKDP-4 Forms Stable Complexes with Trypsin and Plasmin and Are Not Cleaved by the Proteinases

Kunitz proteins are not usually cleaved by their target proteinases. However, it seemed possible that the Kunitz domains of boTKDP-4 and ovTKDP-3, which lack one of the conserved disulfides, might be susceptible to proteolysis because of their potentially loose conformation. An SDS-stable complex was formed when boTKDP-4 was incubated with an approximately threefold molar excess of either trypsin or TLCK-treated trypsin (Fig. 5A, lanes 2 and 3, respectively). The complex was dissociated in the presence of both SDS and ß-mercaptoethanol (Fig. 5B, lanes 2 and 3) to provide a form identical in size to the protein that had not been exposed to trypsin. This experiment is also consistent with the calculation made from the CD spectra (Fig. 2B) that only approximately half the boTKDP-4 Kunitz protein is folded properly. For example, Figure 5B clearly shows that the intensity of staining within the Kunitz band is reduced by approximately half after the incubation with trypsin. Presumably, excess trypsin destroyed improperly folded protein. A similar stable complex was formed between plasmin and boTKDP-4. In this experiment, the boTKDP-4 was in excess (Fig. 5A, lane 6) so that improperly folded protein was probably not as readily destroyed by the proteinase. Therefore, the intensity of the stained Kunitz band was not markedly reduced after reduction and SDS-PAGE (Fig. 5B, lane 6).



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 5. Immunoblot analysis of SDS stable B4K-proteinase complexes. Bovine TKDP-4 (B4K; 5.3 µM) was incubated with trypsin (17.4 µM) or plasmin (3.4 µM) for 15 min at 25°C. Samples were separated by 12.5% SDS-PAGE under nonreducing conditions (left) or after boiling in the presence of ß-mercaptoethanol (right). Lane 1: B4K (untreated); lane 2: trypsin-B4K; lane 3: trypsin (TLCK inactivated)-B4K; lane 4: trypsin; lane 5: plasmin; lane 6: plasmin-B4K. Gels were transferred to nitrocellulose for immunoblot detection with anti-boTKDP-4 antiserum. Arrows indicate the following: a, migration of B4K; b, B4K associated with plasmin or trypsin proteinases. The nomenclature is as follows: O (ovine) or B (bovine), clone number, then K (Kunitz)


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We previously reported the cDNA cloning and characterization of TKDP expression during placental development [1, 2]. However, the functional role that these highly expressed genes play in maternal-fetal communication has remained elusive. The major question addressed by the present study was whether the Kunitz domains at the carboxyl termini of each TKDP demonstrated inhibitory activity toward some common serine proteinases. The lack of conservation in P1 residues among the TKDPs suggested that their inhibitory specificities were likely to differ. Moreover, the presence of three members lacking the signature Cys-14 and Cys-38 disulfide bond (BPTI numbering) had suggested that these Kunitz domains might not be inhibitors at all. To address these questions, the Kunitz domains of ovTKDP-1, ovTKDP-3, boTKDP-2, boTKDP-3, boTKDP-4, and boTKDP-5 were expressed as GST fusion proteins. The fusion proteins remained soluble when expressed at 25°C and could be purified in amounts sufficient for structural and inhibition studies (Fig. 1B).

The present study used CD spectroscopy to show that some of the recombinant proteins, including one that lacked the Cys14-Cys38 disulfide bond, were capable of folding into a typical Kunitz conformation (Fig. 2B). The minimum seen at 202 nm in the CD spectrum is unusual for most proteins, but it is a hallmark of Kunitz proteins, including BPTI and the Kunitz ion channel-blocker dendrotoxin [16, 17]. It is caused by the rigid conformations of Tyr-21 and Phe-22 within the hydrophobic core of the properly folded Kunitz domain [18]. These residues are conserved in both ovTKDP-1 and boTKDP-4 and, therefore, would contribute to the observed spectra. The minimum at 202 nm exhibits a 5–10% loss in intensity on selective chemical destruction of either the Cys14-Cys38 or Cys30-Cys51 disulfide bonds [17, 19]. Therefore, the minimum at 202 nm was anticipated in boTKDP-4, as well as in the other TKDPs, provided that the molecules assumed the typical Kunitz conformation. The shoulder in the CD spectrum between 215 and 225 nm is also characteristic of Kunitz proteins [16]. When all six cysteine residues in BPTI were carboxylated, the characteristic minimum at 202 nm was maintained, but the shoulder was lost [16]. The second contribution to negative elipticity in the 215- to 225-nm region of the properly folded protein is the backbone conformations of proline residues. The BPTI has prolines at positions 2, 8, 9, and 13, all of which are in the trans-conformation in the native state [16]. Refolding in air, following reduction of the three disulfides, allows the proline residues to adopt either cis- or trans-conformations and reduces the intensity of the 215- to 225-nm shoulder. In both boTKDP-4 and ovTKDP-1, other amino acids replace prolines at positions 9 and 13 and cannot contribute to this feature. Consequently, calculations of the extent to which boTKDP-4 and ovTKDP-1 had folded into a proper Kunitz structure, based on the intensity of the 205-nm minimum relative to the shoulder, can only be approximations. The strong positive elipticity seen at 195 nm in the CD spectrum of both the refolded Kunitz domains is a feature of polypeptides that exhibit strong secondary and tertiary structural features, as opposed to random coils [20]. In short, the data in Figure 2B provide strong evidence that a significant portion of the recombinant proteins had folded into a proper Kunitz configuration.

The most common P1 residues among all Kunitz proteins are lysine and arginine [21]. Kunitz proteins with these P1 residues generally inhibit plasmin-like and trypsin-like proteinases that have cleavage specificity for basic residues [21]. Both ovTKDP-3 and boTKDP-4 carry a lysine P1 residue, and it was not surprising to find that their Kunitz domains inhibited both trypsin and plasmin. However, The lack of antitrypsin activity of boTKDP-2, which also possesses a P1 lysine, was unexpected and may result from an aspartic acid residue at position 16 (BPTI numbering) adjacent to the P1 lysine. The presence of a negative charge so close to the basic P1 residue might interfere with binding of the inhibitory loop at the proteinase active site. Only one other known Kunitz protein has an aspartic acid at this position, namely {alpha}-dendrotoxin from green mamba venom [22], one of several Kunitz neurotoxins that block ion-channel function. In general, such snake venom proteins are poor inhibitors of proteinases [23, 24].

The ability of boTKDP-4 and ovTKDP-3 to inhibit both trypsin and plasmin was of particular interest, because these two gene products are the only known examples of naturally occurring mammalian Kunitz inhibitors that lack the Cys14-Cys38 disulfide bond. Although their inhibitory activities toward trypsin and plasmin were an order of magnitude lower than those of BPTI at pH 8.0, both Kunitz proteins were nevertheless potent inhibitors, with Ki values in the nanomolar range. Our initial hypothesis regarding the two-disulfide Kunitz domains was that their inhibitory range might be broader than that of three-disulfide forms, because the increased flexibility within the inhibitory loops might provide a greater range of conformations for protein-protein interaction. However, this idea was not supported by the data. Whereas BPTI was able to inhibit chymotrypsin in addition to trypsin and plasmin, the two-disulfide Kunitz proteins inhibited chymotrypsin poorly, and their inhibitory activity was confined to trypsin and plasmin. It was also hypothesized that the less rigid structure of the two-disulfide forms might provide more solvent accessibility to the inhibitory loop, leading to cleavage of the inhibitor by proteinases. A few single-disulfide variants of BPTI produced by site-directed mutagenesis, including a form that lacked the Cys14-Cys38 bond, retained an ability to bind trypsin but was highly susceptible to proteolysis [25, 26]. However, neither trypsin nor plasmin cleaved boTKDP-4 (Fig. 5).

The Ki values reported here for BPTI against trypsin is much higher (in the 10–10 M range rather than approximately 10–13 M) than those reported by Vincent and Lazdunski [25], Castro and Anderson [13], Venturini et al. [26], and Helland et al. [27] and was found regardless of the source of the BPTI used (native or recombinant) and despite the fact that pains were taken to assess accurately the precise amount of inhibitory protein in the preparation and the quantity of active proteinase assayed. However, values comparable to ours have been reported by others [28, 29]. It is not clear why such discrepancies exist in the literature, but they could relate, in part, to conditions employed in the assays and by the curve-fitting procedures used to extract values from the raw data.

The hypothesis underlying the experiments in the present study was that the TKDPs likely were serine proteinase inhibitors targeted either to proteinases of maternal origin, such as lymphocyte-derived granzymes or tissue kallikreins, or to those derived from pathogens [30–37]. The kallikreins comprise a multimembered family of serine proteinases with distinct substrate specificity [37–39]. Members of the kallikrein family have been described in the uteri of rats, humans, and swine [40–43]. In all likelihood, they act to modulate prostaglandin production, to increase blood flow, and to increase vascular permeability via the kininogen-kinin system [44]. In swine, they have also been suggested to participate in remodeling of the extracellular matrix and in degradation of insulin-like growth factor-binding proteins [43, 45].

Other potential target proteinases are the granzymes— products of cytotoxic T lymphocytes and natural killer cells—that are capable of inducing apoptosis in target cells [46]. Granzyme B has a preference for Asp in the P1 position, although it also has activity toward substrates with Asn and Ser as well [31]. The other granzymes have substrate specificities distinct from granzyme B [30]. For example, granzyme A prefers Arg or Lys in the P1 position [47], whereas rat granzyme C is predicted to cleave after Asn or Gln. Other granzymes (e.g., F and G) prefer large hydrophobic residues such as Phe in the P1 position [33]. Elevated numbers of T cells are present in the uterus of pregnant mice and pigs, but not in the uterus of pseudopregnant animals [48]. Clearly, the presence of a conceptus increases the migration of maternal lymphocytes into the uterus. In ruminants, large granular cells morphologically similar to natural killer cells are present in the uterus as well [49]. Because of the local scrutiny by such potentially cytotoxic cells, the conceptus might be anticipated to have evolved mechanisms to help it avoid destruction by the maternal immune system. The TKDPs could form part of such a protective system. However, the fact that it was only possible to demonstrate proteinase-inhibitory activities by two forms, which themselves were atypical in structure, raise questions as to whether our hypothesis is correct. Therefore, the role of TKDPs role in vivo may not be as proteinase inhibitors at all.

As mentioned above, the Kunitz domain has clearly evolved functions not necessarily restricted to proteinase inhibition [50]. Perhaps the best known is an ability to interact with voltage-gated potassium ion channels [50–52]. The snake venom Kunitz toxins, like the TKDPs, display a variety of P1 residues, but they are often poor proteinase inhibitors, even when an amino acid is present at P1 that typically would target a particular proteinase. For example, as noted above, {alpha}-dendrotoxin, like boTKDP-2, has a P1 Lys [50] but is a poor inhibitor of trypsin. Several other venom-derived Kunitz inhibitors possess unusual P1 residues that have implied specificity toward chymotrypsin but have exhibited weak inhibitory activity on testing. Interestingly, the so-called chymotrypsin inhibitors from Bungarus fasciatus [51] and Ophiofagus hannah (King Cobra) [52] possess a P1 Asn, thereby resembling ovTKDP-1. Finally, Hollecker et al. [17] studied the effects of disulfide bond ablation on the toxin, dendrotoxin I, and found that loss of the Cys14-Cys38 disulfide increased channel-blocking activity. It is too early to know whether the TKDPs have any ability to bind to one or more of the many mammalian potassium channels to modulate ion fluxes, but the possibility is intriguing.

It is not uncommon for Kunitz venom toxins to possess a secondary protein component, usually a phospholipase, that is guided to the channel by the targeting Kunitz component, and it is the combination of the two proteins that provides the destructive power of the toxin [51, 52]. The present study focused on characterization of the Kunitz portion of each TKDP, but the majority of these proteins possess one or more amino terminal domains of approximately 80 amino acids and have roles that are unclear. Although these sequences do not correspond to any other known sequence in the protein databases, they likely are a functional part of the molecules, and future studies will address their roles.

In summary, the work reported here indicates that the highly unusual Kunitz variants in the TKDP family are capable of acting as proteinase inhibitors. However, antiproteolytic activity was not observed for most of the proteins tested, suggesting either that some of these Kunitz proteins have evolved a good deal of specificity toward their target proteinases or that the TKDP are not acting as proteinase inhibitors at all.


   FOOTNOTES
 
1 Supported by NIH grants HD21896 and R01 HD35898. Back

2 Correspondence: Jonathan A. Green, 163 ASRC, 920 E. Campus Dr., University of Missouri-Columbia, Columbia, MO 65211. FAX: 573 882 6827; greenjo{at}missouri.edu Back

3 Current address: Department of Immunology, The University of Texas, M.D. Anderson Cancer Center, Houston TX 77054 Back

Received: 25 November 2003.

First decision: 11 December 2003.

Accepted: 18 March 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kramer KK, Duffy JY, Klemann SW, Bixby JA, Low BG, Pope WF, Roberts RM. Selective cloning of cDNA for secretory proteins of early embryos. Identification of a transiently expressed Kunitz domain protein from preimplantation sheep trophoblast. J Biol Chem 1994 269 7255-7261
  2. MacLean JA II, Chakrabarty A, Xie S, Bixby JA, Roberts RM, Green JA. Family of Kunitz proteins from trophoblast: expression of the trophoblast Kunitz domain proteins (TKDP) in cattle and sheep. Mol Reprod Dev 2003 65:30-40[CrossRef][Medline]
  3. Kunitz M, Northrup J. Isolation from beef pancreas of crystalline trypsinogen, trypsin, trypsin inhibitor, and an inhibitor trypsin compound. J Gen Physiol 1936 19:991-1007[Abstract/Free Full Text]
  4. Laskowski M Jr, Kato I. Protein inhibitors of proteinases. Annu Rev Biochem 1980 49:593-626[CrossRef][Medline]
  5. Roberts RM, Mathialagan N, Duffy JY, Smith GW. Regulation and regulatory role of proteinase inhibitors. Crit Rev Eukaryot Gene Expr 1995 5:385-436[Medline]
  6. Callander NS, Rao LV, Nordfang O, Sandset PM, Warn-Cramer B, Rapaport SI. Mechanisms of binding of recombinant extrinsic pathway inhibitor (rEPI) to cultured cell surfaces. Evidence that rEPI can bind to and inhibit factor VIIa-tissue factor complexes in the absence of factor Xa. J Biol Chem 1992 267:876-882[Abstract/Free Full Text]
  7. Wells JM, Strickland S. Aprotinin, a Kunitz-type protease inhibitor, stimulates skeletal muscle differentiation. Development 1994 120: : 3639-3647[Abstract]
  8. Smith DB, Johnson KS. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 1988 67:31-40[CrossRef][Medline]
  9. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976 72:248-254[CrossRef][Medline]
  10. Stallings-Mann ML, Burke MG, Trout WE, Roberts RM. Purification, characterization, and cDNA cloning of a Kunitz-type proteinase inhibitor secreted by the porcine uterus. J Biol Chem 1994 269:24090-24094[Abstract/Free Full Text]
  11. Chase T Jr, Shaw E. Comparison of the esterase activities of trypsin, plasmin, and thrombin on guanidinobenzoate esters. Titration of the enzymes. Biochemistry 1969 8:2212-2224[CrossRef][Medline]
  12. Lindhout T, Willems G, Blezer R, Hemker HC. Kinetics of the inhibition of human factor Xa by full-length and truncated recombinant tissue factor pathway inhibitor. Biochem J 1994 297:131-136
  13. Castro MJ, Anderson S. Alanine point-mutations in the reactive region of bovine pancreatic trypsin inhibitor: effects on the kinetics and thermodynamics of binding to ß-trypsin and {alpha}-chymotrypsin. Biochemistry 1996 35:11435-11446[CrossRef][Medline]
  14. Heibges A, Salamini F, Gebhardt C. Functional comparison of homologous members of three groups of Kunitz-type enzyme inhibitors from potato tubers (Solanum tuberosum L). Mol Gen Genomics 2003; 269:535-541[CrossRef][Medline]
  15. Filippovich I, Sorokina N, Masci PP, De Jersey J, Whitaker AN, Winzor DJ, Gaffney PJ, Lavin MP. A family of textilinin genes, two of which encode proteins with antihemorrhagic properties. Br J Haematol 2002 119:376-384[CrossRef][Medline]
  16. Kosen PA, Creighton TE, Blout ER. Circular dichroism spectroscopy of bovine pancreatic trypsin inhibitor and five altered conformational states. Relationship of conformation and the refolding pathway of the trypsin inhibitor. Biochemistry 1981 20:5744-5754[CrossRef][Medline]
  17. Hollecker M, Marshall DL, Harvey AL. Structural features important for the biological activity of the potassium channel blocking dendrotoxins. Br J Pharmacol 1993 110:790-794[Medline]
  18. Sreerama N, Manning MC, Powers ME, Zhang JX, Goldenberg DP, Woody RW. Tyrosine, phenylalanine, and disulfide contributions to the circular dichroism of proteins: circular dichroism spectra of wild-type and mutant bovine pancreatic trypsin inhibitor. Biochemistry 1999 38:10814-10822[CrossRef][Medline]
  19. Liu Y, Breslauer K, Anderson S. "Designing out" disulfide bonds: thermodynamic properties of 30-51 cysteine substitution mutants of bovine pancreatic trypsin inhibitor. Biochemistry 1997 36:5323-5335[CrossRef][Medline]
  20. Kelly SM, Price NC. The application of circular dichroism to studies of protein folding and unfolding. Biochim Biophys Acta 1997 1338: : 161-185[CrossRef][Medline]
  21. Laskowski M Jr. Protein inhibitors of serine proteinases—mechanism and classification. Adv Exp Med Biol 1986 199:1-17[Medline]
  22. Joubert FJ, Taljaard N. Snake venoms. The amino acid sequences of two Melanoleuca-type toxins. Hoppe Seylers Z Physiol Chem 1980 361 425-436
  23. Smith LA, Reid PF, Wang FC, Parcej DN, Schmidt JJ, Olson MA, Dolly JO. Site-directed mutagenesis of dendrotoxin K reveals amino acids critical for its interaction with neuronal K+ channels. Biochemistry 1997 36:7690-7696[CrossRef][Medline]
  24. Wang FC, Bell N, Reid P, Smith LA, McIntosh P, Robertson B, Dolly JO. Identification of residues in dendrotoxin K responsible for its discrimination between neuronal K+ channels containing Kv1.1 and 1.2 {alpha} subunits. Eur J Biochem 1999 263:222-229[Medline]
  25. Vincent JP, Lazdunski M. Trypsin-pancreatic trypsin inhibitor association. Dynamics of the interaction and role of disulfide bridges. Biochemistry 1972 11:2967-2977[CrossRef][Medline]
  26. Venturini G, Colasanti M, Ascenzi P. Aprotinin, the first competitive protein inhibitor of NOS activity. Biochem Biophys Res Commun 1998 249:263-265[CrossRef][Medline]
  27. Helland R, Leiros I, Berglund GI, Willassen NP, Smalas AO. The crystal structure of anionic salmon trypsin in complex with bovine pancreatic trypsin inhibitor. Eur J Biochem 1998 256:317-324[Medline]
  28. Kiczak L, Koscielska K, Otlewski J, Czerwinski M, Dadlez M. Phage display selection of P1 mutants of BPTI directed against five different serine proteinases. Biol Chem 1999 380:101-105[CrossRef][Medline]
  29. Masci PP, Whitaker AN, Sparrow LG, de Jersey J, Winzor DJ, Watters DJ, Lavin MF, Gaffney PJ. Textilinins from Pseudonaja textilis textilis. Characterization of two plasmin inhibitors that reduce bleeding in an animal model. Blood Coagul Fibrinolysis 2000 11:385-393[CrossRef][Medline]
  30. Smyth MJ, Trapani JA. Granzymes: exogenous proteinases that induce target cell apoptosis. Immunol Today 1995 16:202-206[CrossRef][Medline]
  31. Odake S, Kam CM, Narasimhan L, Poe M, Blake JT, Krahenbuhl O, Tschopp J, Powers JC. Human and murine cytotoxic T lymphocyte serine proteases: subsite mapping with peptide thioester substrates and inhibition of enzyme activity and cytolysis by isocoumarins. Biochemistry 1991 30:2217-2227[CrossRef][Medline]
  32. Garcia-Sanz JA, MacDonald HR, Jenne DE, Tschopp J, Nabholz M. Cell specificity of granzyme gene expression. J Immunol 1990 145: : 3111-3118[Abstract]
  33. Ewoldt GR, Smyth MJ, Darcy PK, Harris JL, Craik CS, Horowitz B, Woodard SL, Powers JC, Hudig D. P-4 and RNKP-7, new granzyme-like serine proteases expressed in activated rat lymphocytes. J Immunol 1997 158:4574-4583[Abstract]
  34. Edwards KM, Kam CM, Powers JC, Trapani JA. The human cytotoxic T cell granule serine protease granzyme H has chymotrypsin-like (chymase) activity and is taken up into cytoplasmic vesicles reminiscent of granzyme B-containing endosomes. J Biol Chem 1999 274: : 30468-30473[Abstract/Free Full Text]
  35. Yousef GM, Diamandis EP. Human tissue kallikreins: a new enzymatic cascade pathway?. Biol Chem 2002 383:1045-1057[CrossRef][Medline]
  36. Yousef GM, Kopolovic AD, Elliott MB, Diamandis EP. Genomic overview of serine proteases. Biochem Biophys Res Commun 2003 305 28-36
  37. Yousef GM, Diamandis EP. Tissue kallikreins: new players in normal and abnormal cell growth?. Thromb Haemost 2003 90:7-16[Medline]
  38. Gauthier F, Moreau T, Gutman N, EL Moujahed A, Brillard-Bourdet M. Functional diversity of proteinases encoded by genes of the rat tissue kallikrein family. Agents Actions Suppl 1992 38:42-50
  39. Yousef GM, Diamandis EP. The new human tissue kallikrein gene family: structure, function, and association to disease. Endocr Rev 2000 22:184-204
  40. Valdes G, Germain AM, Corthorn J, Chacon C, Figueroa CD, Muller-Esterl W. Tissue kallikrein and bradykinin B2 receptor in human uterus in the luteal phase and in early and late gestation. Endocrine 2001 16 207-215
  41. Corthorn J, Figueroa C, Valdes G. Estrogen and luminal stimulation of rat uterine kallikrein. Biol Reprod 1997 56:1432-1438[Abstract]
  42. Corthorn J, Valdes G. Variations in uterine kallikrein during cycle and early pregnancy in the rat. Biol Reprod 1994 50:1261-1264[Abstract]
  43. Vonnahme KA, Fernando SC, Ross JW, Ashworth MD, DeSilva U, Malayer JR, Geisert RD. Porcine endometrial expression of kininogen, factor XII, and plasma kallikrein in cyclic and pregnant gilts. Biol Reprod 2004 70:132-138[Abstract/Free Full Text]
  44. Bhoola KD, Figueroa CD, Worthy K. Bioregulation of kinins: kallikreins, kininogens, and kinases. Pharmacol Rev 1992 44:1-80[Medline]
  45. Geisert RD, Chamberlain CS, Vonnahme KA, Malayer JR, Spicer LJ. Possible role of kallikrein in proteolysis of insulin-like growth factor binding proteins during the estrous cycle and early pregnancy in pigs. Reproduction 2001 121:719-728[Abstract]
  46. Doherty PC. Cell-mediated cytotoxicity. Cell 1993 75:607-612[CrossRef][Medline]
  47. Beresford PJ, Kam CM, Powers JC, Lieberman J. Recombinant human granzyme A binds to two putative HLA-associated proteins and cleaves one of them. Proc Natl Acad Sci U S A 1997 94:9285-9290[Abstract/Free Full Text]
  48. Croy BA, Waterfield A, Wood W, King GJ. Normal murine and porcine embryos recruit NK cells to the uterus. Cell Immunol 1988 115: : 471-480[CrossRef][Medline]
  49. Lee CS, Wooding FB, Morgan G. Quantitative analysis throughout pregnancy of intraepithelial large granular and nongranular lymphocyte distributions in the synepitheliochorial placenta of the cow. Placenta 1997 18:675-681[CrossRef][Medline]
  50. Gasparini S, Danse JM, Lecoq A, Pinkasfeld S, Zinn-Justin S, Young LC, de Medeiros CC, Rowan EG, Harvey AL, Menez A. Delineation of the functional site of {alpha}-dendrotoxin. The functional topographies of dendrotoxins are different but share a conserved core with those of other Kv1 potassium channel-blocking toxins. J Biol Chem 1998 273 25393-25403
  51. Liu CS, Wu TC, Lo TB. Complete amino acid sequences of two protease inhibitors in the venom of Bungarus fasciatus. Int J Pept Protein Res 1983 21:209-215[Medline]
  52. Chang L, Chung C, Huang HB, Lin S. Purification and characterization of a chymotrypsin inhibitor from the venom of Ophiophagus hannah (King Cobra). Biochem Biophys Res Commun 2001 283: : 862-867[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
K. A. Berghorn, P. A. Clark-Campbell, L. Han, M. McGrattan, R. S. Weiss, and M. S. Roberson
Smad6 Represses Dlx3 Transcriptional Activity through Inhibition of DNA Binding
J. Biol. Chem., July 21, 2006; 281(29): 20357 - 20367.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
J. H. Larson, C. G. Kumar, R. E. Everts, C. A. Green, A. Everts-van der Wind, M. R. Band, and H. A. Lewin
Discovery of eight novel divergent homologs expressed in cattle placenta
Physiol Genomics, May 16, 2006; 25(3): 405 - 413.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Bayrhuber, V. Vijayan, M. Ferber, R. Graf, J. Korukottu, J. Imperial, J. E. Garrett, B. M. Olivera, H. Terlau, M. Zweckstetter, et al.
Conkunitzin-S1 Is the First Member of a New Kunitz-type Neurotoxin Family: STRUCTURAL AND FUNCTIONAL CHARACTERIZATION
J. Biol. Chem., June 24, 2005; 280(25): 23766 - 23770.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/2/455    most recent
biolreprod.103.025908v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by MacLean, J. A.
Right arrow Articles by Green, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by MacLean, J. A., II
Right arrow Articles by Green, J. A.
Agricola
Right arrow Articles by MacLean, J. A.
Right arrow Articles by Green, J. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS