|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Embryo |
Department of Animal Sciences, University of Missouri-Columbia, Columbia, Missouri 65211
| ABSTRACT |
|---|
|
|
|---|
implantation, placenta, trophoblast, uterus
| INTRODUCTION |
|---|
|
|
|---|
The Kunitz family of polypeptides is large, ubiquitous, but apparently, absent in prokaryotes. The best-investigated member of this family is bovine pancreatic trypsin inhibitor (BPTI; aprotinin), which was crystallized by Kunitz and Northrup [3] in 1936. Most Kunitz family members are inhibitors of serine proteinases [35], and they have assumed crucial roles in processes, such as blood coagulation and tissue remodeling, in which the extent of proteolysis must be carefully limited. However, the Kunitz module also has been utilized for other functions that require protein-protein interactions but not necessarily proteinase inhibition [6, 7]. Kunitz domains are of low molecular weight (
60 amino acids), basic, and characterized by the placement of six conserved cysteine residues that form three disulfide linkages that contribute to the compact and stable nature of the folded polypeptide [4]. The P1 residue in the proteinase-inhibitory loop provides the primary specificity determinant and dictates much of the inhibitory activity that a particular Kunitz protein has toward a targeted proteinase. However, other residues, particularly in the inhibitor loop region, contribute to the strength of binding. In most cases, lysine or arginine occupy the P1 position to inhibit proteinases that cleave adjacent to those residues in the protein substrate.
Two features of the TKDP family are particularly notable. First, the family members display a range of amino acids in the P1 position [2]. Second, three TKDPs (ovTKDP-3, boTKDP-3, and boTKDP-4) are distinct from any other known mammalian Kunitz proteins in that they lack one of the three disulfide bonds (Cys-14 and Cys-38; BPTI numbering) that hold the Kunitz module in its classically rigid conformation [35]. Bovine TKDP-3 and -4, as well as ovTKDP-3, might therefore be expected to have a looser conformation than other Kunitz proteins, and this might be expected to be evident in their inhibitory properties.
The present study involved experiments to assess the proteinase-inhibitory specificity of several TKDP Kunitz domains to gain some insight regarding the type of proteinases they might inhibit. An additional goal was to determine if the atypical Kunitz domains, which lack one of the conserved disulfides, are indeed capable of forming a typical Kunitz fold.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Bovine trypsin, bovine chymotrypsin, bovine thrombin, human leukocyte elastase, human plasmin, human plasma kallikrein, N-benzoyl-DL-arginine p-nitroanilide, N-benzoyl-L-Ala-Pro-Phe p-nitroanilide, N-p-Tosyl-Gly-Pro-Lys p-nitroanilide, N-t-BOC-L-Ala-Ala-Val p-nitroanilide, tosyllysyl chloromethyl ketone (TLCK), and BPTI were from Sigma (St. Louis, MO).
Production of Recombinant TKDP-Inhibitor Proteins
The region encoding the Kunitz domain for each TKDP protein was amplified by polymerase chain reaction (PCR) and engineered to include in-frame, flanking EcoRI and BamHI restriction sites for directional cloning into the pGEX2T bacterial expression vector (Pharmacia, Piscataway, NJ). For ovTKDP-1 Kunitz construction, the oligonucleotides corresponded to cDNA bases 631648 (P125, GCGGGATCCATGGCTTCTAAGCCTGCCCTT) and 808825 (P135, GCGGAATTCTTATCACAGAGACCCTGCCTC). For boTKDP-3 and ovTKDP-3 Kunitz construction, the oligonucleotides corresponded to cDNA bases 361378 (P122, GCGGGATCCGCAGATTCTAGGCCTGCC) and 541558 (P123, GCGGAATTCTTATCACAGGGAACCAGCCCC). The P122 and P123 oligonucleotides were also used for amplification of boTKDP-4 Kunitz domain and corresponded to cDNA bases 334354 and 514530, respectively. For boTKDP-2 Kunitz construction, the oligonucleotides corresponded to cDNA bases 330347 (GCGGGATCCCATGCAGCTTCTAAGCCT) and 513 530 (GCGGGATCCTTATCACATGGTCACAGGCAC). For boTKDP-5 Kunitz construction, the oligonucleotides corresponded to cDNA bases 140157 (GCGGGATCCACTTCTAGGCCTGCTTTC) and 317334 (GCGGAATTCTTATCACGGGGACCCTGCCCC). The original cDNA subclones [2] were used as template. The PCR products were generated under the following conditions: denaturing, 95°C for 30 sec; annealing, 42°C for 30 sec; and extension, 72°C for 60 sec for 36 cycles. The PCR products were digested with EcoRI and BamHI in Multicore buffer (Promega, Madison, WI) for 4 h at 37°C. The digested products were separated by agarose gel electrophoresis. Bands of the proper size were excised, purified by QiaEX extraction (Qiagen, Santa Clara, CA), and directionally cloned into the EcoRI/BamHI cut vector. The resulting plasmids were sequenced to verify the proper orientation and reading frame and to confirm that mutations had not been introduced during the PCR.
For protein expression, TKDP-Kunitz-glutathione S-transferase (GST) constructs or GST parent plasmids were transformed into bacterial strain BL21 (De3) pLysS. Bacterial cultures were grown at 37°C to an optical density of 0.5 at 600 nm, then equilibrated to 25°C before induction of protein expression by 10 mM isopropyl ß-D-thiogalactoside. Cells were harvested after 6 h at 25°C and broken in a French press. Soluble lysate, containing GST fusion proteins, was filtered (pore size, 0.45 µm) and supplemented with 0.02% PMSF, 0.02 mM sodium azide, and 5 mM EDTA. The GST fusion proteins were purified from the soluble lysate by batch binding to glutathione sepharose 4B [8]. After several washes with PBS containing 5 mM EDTA at 4°C, fusion proteins were eluted from the matrix with 100 mM reduced glutathione in PBS. The eluted fractions were concentrated using Centriprep centrifugal filters with 3000 molecular weight cut-off membranes (Millipore, Billerica, MA) and dialyzed against 4000 volumes of PBS to remove the majority of the reduced glutathione. Purification of the proper size protein was verified by SDS-PAGE, and protein yields were determined [9].
Isolation of Free Kunitz Proteins
The domains of each fusion protein are joined by a bridging sequence that contained a thrombin cleavage site to allow removal of the GST-affinity tag. For assays involving free inhibitor, Kunitz-GST fusions were diluted in PBS to 5 mg/ml and digested by thrombin overnight at 25°C in 25 mM Tris (pH 8.0) and 100 mM NaCl. After the incubation, NaCl and glycerol were added to provide final concentrations of 1 M and 5%, respectively. The mixture was then purified over a Superose 12 column (Pharmacia) at a flow rate of 0.5 ml/min in the high salt/glycerol buffer. The size and purity of the free Kunitz domain was assessed by SDS-PAGE and quantified by bicinchoninic acid assay (Pierce, Rockford, IL) by following the manufacturer's instructions.
Circular Dichroism Measurements
Purified Kunitz domain polypeptides were dialyzed against 10 000 volumes of chloride-free buffer (10 mM potassium phosphate [pH 7.5] and 50 mM potassium fluoride). Circular dichroism spectra (CD) were recorded with an AVIV model 202 spectrapolarimeter (AVIV Inc., Lakewood, NJ) in cuvettes of 0.1-cm path length. The CD signals were recorded in the far ultraviolet (UV) range in 0.5-nm increments from 260 to 195 nm. Each reported spectrum is the consensus of four spectra determinations with an averaging time of 5 sec at each wavelength tested. The spectra are expressed in mean residue elipticity (deg cm2/dmol). Mean residue concentrations were calculated by using the following data for each protein: native BPTI, 56 residues, Mr 6513; boTKDP-4, 66 residues, Mr 7196; and ovTKDP-1, 66 residues, Mr 7216.
Proteinase-Inhibition Assays
The activities of elastase, plasmin, trypsin, chymotrypsin, kallikrein, and thrombin were assayed by modifying a procedure described previously [10]. These proteinases represent a range of protein substrate preferences and are commercially available. For these assays, 1 µg of target proteinase (representing protein concentrations of 2.2 x 107 to 5.9 x 108 M) was preincubated with 75 µg of Kunitz inhibitor-GST fusion protein (1.1 x 105 M) in a total volume of 50 µl at 25°C for 30 min. The reaction volume was brought to 190 µl by the addition of water and 20 µl of 10x assay buffer to produce a final concentration of 25 mM Tris-HCl (pH 8.0) and 100 mM NaCl. The reaction was initiated by the addition of 10 µl of the synthetic substrate dissolved in dimethyl sulfoxide (Table 1). The change in absorbance was monitored continuously at 405 nm by using a Tecan Rainbow (Tecan, Durham, NC) microplate reader for 30 min at 25°C. The proteinases and synthetic substrates were as follows: bovine trypsin, N-benzoyl-DL-arginine p-nitroanilide; bovine chymotrypsin, N-benzoyl-L-Ala-Pro-Phe p-nitroanilide; human plasmin, human plasma kallikrein, and bovine thrombin, N-p-Tosyl-Gly-Pro-Lys p-nitroanilide; and human elastase, N-t-BOC-L-Ala-Ala-Val p-nitroanilide. Samples were prepared in triplicate and results reported as the mean change in absorbance following correction for background hydrolysis and differences in sample absorbance at time zero. The greater the inhibitory capacity of the inhibitors, the lower the amount of product that is produced. The effects of inhibitors on enzymatic activity were analyzed by least-squares procedure using the general linearized model of the Statistical Analysis System (SAS Institute, Cary, NC). When significant interactions were indicated, the Duncan multiple-range test and Student-Newman-Keuls test were used to assign comparison groups.
|
Measurement of Inhibition Equilibrium Constants
To determine the inhibition equilibrium constants, it was necessary to know the concentration of "active" inhibitor in the purified recombinant proteins. The concentration of active sites within trypsin, plasmin, and chymotrypsin proteinases were determined by using the burst titrant p-nitrophenyl guanidinobenzoate (pNPGB) [11]. Cleavage of the pNPGB by the enzyme results in dead-end inhibition of the active site with only one turnover of product per trypsin active site. The concentration of active enzyme was calculated from the amount of product released (
= 16 595 M1). The molar concentrations of the Kunitz proteins were then determined by titration with known concentrations of active trypsin [12]. Trypsin/proteinase-inhibitor complex formation was assumed to be 1:1. Inhibitor stocks were diluted to 10 nM (according to total protein determination) in assay buffer. Trypsin stocks were serially diluted in assay buffer to provide a range of concentrations (final assay, 050 nM). Inhibitor and trypsin were preincubated at 25°C for 30 min, and residual enzymatic activity was determined after the addition of substrate. The linear portion of the titration curve was extrapolated to the x-axis, and the concentration of enzyme at that point was taken as the concentration of active inhibitor.
The Ki was determined as follows: Proteinases were prepared in 50 mM Tris (pH 8.0), 150 mM NaCl, and 0.1% bovine serum albumin to a final concentration of 10 nM as determined by active site titration. The presence of the albumin provided greater reproducibility to the assays and did not affect final values of inhibitory constants. Proteinase samples were incubated with increasing concentrations of Kunitz protein for 30 min at 25°C. Enzyme reactions were initiated by addition of colorimetric substrate at a final concentration near the determined Km, because excessive free substrate may disrupt proteinase-inhibitor complexes [12, 13]. Enzymatic activity toward substrate was measured as the rate of optical density change per hour at 405 nm. Resulting rates were then converted to the fraction of enzymatic activity remaining and plotted against the log of inhibitor concentration. The concentration of inhibitor at which 50% proteinase activity remained (IC50) was determined by nonlinear regression (GraphPad Prism for Windows, Version 3.00; GraphPad Software, San Diego, CA; http://www.graphpad.com). The IC50 was then used to obtain the apparent Ki (Ki(app)) value by fitting the single binding site competition model included with the software package. The true Ki value was obtained after correction for the concentration of substrate (S) used in the assay by the following equation:

| RESULTS |
|---|
|
|
|---|
To explore the proteinase-inhibitory capacity of the TKDP fusion proteins, the Kunitz domains of ovTKDP-1, ovTKDP-3, boTKDP-2, boTKDP-3, boTKDP-4, and boTKDP-5 (Fig. 1A) were expressed as GST fusion proteins (Fig. 1B). The BPTI was expressed similarly to serve as a positive control in the experiments. The GST system has been demonstrated by others to be an effective method for the production of functional Kunitz proteins [14, 15]. These Kunitz domains represent a range of different P1 residues and comprise both typical and atypical Kunitz proteins in terms of conserved cysteines. For the most part, only one member of an orthologous pair was chosen [2]. Both ovTKDP-1 and boTKDP-2 were expressed as representatives for the boTKDP-1/ovTKDP-1 and boTKDP-2/ovTKDP-2 orthologues, respectively. An exception was for the boTKDP-3/ovTKDP-3 pair; they possess different P1 residues and were predicted to have different specificities. Both boTKDP-4 and boTKDP-5 do not have obvious ovine orthologues, and ovTKDP-4 and ovTKDP-5, which have identical amino acid sequences in the Kunitz domain, were unavailable. However, they were assumed to have specificities similar to that for ovTKDP-1 because of an Asn in the P1 position of each of these proteins. All the fusion proteins prepared in this manner remained soluble when expressed at 25°C and could be purified from bacterial proteins by passage over GST-affinity columns. Although the yields of the different TKDPs were adequate for preparing material for structural studies, BPTI was consistently difficult to produce as a GST fusion protein, with recovered amounts typically being less than 2 mg/L of fermentation medium (Fig. 1B). The lower Mr bands in some preparations of recombinant proteins (Fig. 1B) contained an intact glutathione-binding cleft, because they copurified with the full-length forms on the affinity column and also reacted with anti-GST antiserum on Western blots (data not shown). It is assumed that these products were partially degraded by bacterial proteinases.
|
Purification of Free Kunitz Proteins by Superose 12 Chromatography and Analysis of Their Folding
For some, but not all, studies, the Kunitz domains of BPTI, ovTKDP-1, and boTKDP-4 were cleaved from the GST moiety using thrombin. Reaction products were separated by Superose 12 column chromatography. Addition of high salt (1 M) and 5% glycerol to the chromatography buffer (PBS) greatly reduced aggregation within these samples and typically produced two well-defined peaks (Fig. 2A). The first eluted peak contained GST and some fusion protein that had remained undigested. The second peak represented the free Kunitz protein. The nature of the trailing shoulder on this second peak is unclear, but it could represent either protein that was improperly folded or aggregates of cleavage products.
|
To confirm the extent of proper folding of the recombinant proteins, the structural conformations of three Kunitz domainsthose for boTKDP-4, ovTKDP-1, and native BPTI (purchased commercially and titered before analysis for antitrypsin activity)were examined by CD. Native BPTI, approximately 50% of which reacted with trypsin, was included in the analysis to provide a reference spectrum. The CD spectrum for each protein was determined by scanning in the far UV range (195260 nm). The spectra for all three proteins exhibited the same general shape (Fig. 2B). A pronounced minimum was observed at 205 nm, a shoulder between 215 and 225 nm, and a flattening of the spectrum after 235 nm. Despite the fact that each protein was analyzed at approximately the same concentration, the minimum at 205 nm was markedly lower for BPTI than for either boTKDP-4 or ovTKDP-1. The data suggested that the boTKDP-4 and ovTKDP-1 preparations contained properly folded Kunitz domains but were accompanied by material that had not folded correctly.
Proteinase-Inhibition Assays
To gain insight regarding the possible inhibitory specificity of these Kunitz proteins, a known amount of recombinant fusion protein (75 µg; 1.1 x 105 M) was preincubated with 1 µg of either trypsin, chymotrypsin, elastase, plasma kallikrein, thrombin, or plasmin, and the residual amidolytic activity was determined using synthetic peptide substrates in a colorimetric assay. Glutathione S-transferase protein was included as one of the no-inhibitor controls; BPTI, a Kunitz inhibitor of known specificity, was used as a positive control and, as expected, inhibited trypsin, plasmin, and chymotrypsin (Fig. 3). Recombinant boTKDP-4 and ovTKDP-3, both of which possess Lys at their P1 positions, inhibited trypsin and plasmin under the same assay conditions (Fig. 3). None of the TKDP Kunitz proteins was found to significantly inhibit plasma kallikrein, elastase, thrombin, or chymotrypsin. Furthermore, ovTKDP-1 (P1, Asn), boTKDP-2 (P1, Lys), boTKDP-3 (P1, Thr), and boTKDP-5 (P1, Ile) failed to exhibit antiproteolytic activity against any of the proteinases used in the assay.
|
Calculation of Inhibitory Constants
In preliminary experiments designed to measure TKDP-inhibitory constants (Ki) against serine proteinases, inhibitory constants were calculated using inhibitor concentrations determined as total protein in the preparation (data not shown). It became apparent, however, that the presence of contaminating GST and Kunitz-GST proteolytic fragments, which varied in amounts between protein preparations (Fig. 1B), inflated the protein concentrations of potential inhibitors. Additionally, the dye-binding methods used for determination of protein concentrations did not distinguish between properly folded and misfolded Kunitz proteins. Data obtained from the CD spectra (Fig. 2B) suggested that only approximately a third of the ovTKDP-1 and half the boTKDP-4 Kunitz domains had folded into the conformation that would provide a minimum at 205 nm in the CD spectrum. In addition, preparations of proteinases always contain a proportion of inactive enzyme. Because these ambiguities existed, it was first necessary to estimate the amount of active enzyme in the commercial preparations used (Fig. 4A) and the concentration of active inhibitor present in each sample of recombinant Kunitz protein (Fig. 4B) before attempting to determine a Ki value. Figure 4, C and D, shows typical equilibrium activities of trypsin and plasmin (each 10 nM) in the presence of increasing concentrations of boTKDP-4. Data for all assays are summarized in Table 2.
|
|
Inhibitory constants for ovTKDP-3 and boTKDP-4 against trypsin were 2.60 ± 0.8 (mean ± SEM) and 1.65 ± 0.2 nM, respectively. The corresponding values for inhibition of plasmin were 4.99 ± 0.8 and 1.50 ± 0.3 nM, respectively. The control inhibitor, BPTI, inhibited trypsin, plasmin, and chymotrypsin with inhibitory constants of 0.63 ± 0.2, 0.16 ± 0.1, and 2.5 ± 0.4 nM, respectively. The Ki (1.54 ± 0.1 nM) of the Kunitz domain of boTKDP-4, after it had been cleaved from its GST fusion product and purified, was not significantly different from that obtained with the intact fusion protein (Table 2).
BoTKDP-4 Forms Stable Complexes with Trypsin and Plasmin and Are Not Cleaved by the Proteinases
Kunitz proteins are not usually cleaved by their target proteinases. However, it seemed possible that the Kunitz domains of boTKDP-4 and ovTKDP-3, which lack one of the conserved disulfides, might be susceptible to proteolysis because of their potentially loose conformation. An SDS-stable complex was formed when boTKDP-4 was incubated with an approximately threefold molar excess of either trypsin or TLCK-treated trypsin (Fig. 5A, lanes 2 and 3, respectively). The complex was dissociated in the presence of both SDS and ß-mercaptoethanol (Fig. 5B, lanes 2 and 3) to provide a form identical in size to the protein that had not been exposed to trypsin. This experiment is also consistent with the calculation made from the CD spectra (Fig. 2B) that only approximately half the boTKDP-4 Kunitz protein is folded properly. For example, Figure 5B clearly shows that the intensity of staining within the Kunitz band is reduced by approximately half after the incubation with trypsin. Presumably, excess trypsin destroyed improperly folded protein. A similar stable complex was formed between plasmin and boTKDP-4. In this experiment, the boTKDP-4 was in excess (Fig. 5A, lane 6) so that improperly folded protein was probably not as readily destroyed by the proteinase. Therefore, the intensity of the stained Kunitz band was not markedly reduced after reduction and SDS-PAGE (Fig. 5B, lane 6).
|
| DISCUSSION |
|---|
|
|
|---|
The present study used CD spectroscopy to show that some of the recombinant proteins, including one that lacked the Cys14-Cys38 disulfide bond, were capable of folding into a typical Kunitz conformation (Fig. 2B). The minimum seen at 202 nm in the CD spectrum is unusual for most proteins, but it is a hallmark of Kunitz proteins, including BPTI and the Kunitz ion channel-blocker dendrotoxin [16, 17]. It is caused by the rigid conformations of Tyr-21 and Phe-22 within the hydrophobic core of the properly folded Kunitz domain [18]. These residues are conserved in both ovTKDP-1 and boTKDP-4 and, therefore, would contribute to the observed spectra. The minimum at 202 nm exhibits a 510% loss in intensity on selective chemical destruction of either the Cys14-Cys38 or Cys30-Cys51 disulfide bonds [17, 19]. Therefore, the minimum at 202 nm was anticipated in boTKDP-4, as well as in the other TKDPs, provided that the molecules assumed the typical Kunitz conformation. The shoulder in the CD spectrum between 215 and 225 nm is also characteristic of Kunitz proteins [16]. When all six cysteine residues in BPTI were carboxylated, the characteristic minimum at 202 nm was maintained, but the shoulder was lost [16]. The second contribution to negative elipticity in the 215- to 225-nm region of the properly folded protein is the backbone conformations of proline residues. The BPTI has prolines at positions 2, 8, 9, and 13, all of which are in the trans-conformation in the native state [16]. Refolding in air, following reduction of the three disulfides, allows the proline residues to adopt either cis- or trans-conformations and reduces the intensity of the 215- to 225-nm shoulder. In both boTKDP-4 and ovTKDP-1, other amino acids replace prolines at positions 9 and 13 and cannot contribute to this feature. Consequently, calculations of the extent to which boTKDP-4 and ovTKDP-1 had folded into a proper Kunitz structure, based on the intensity of the 205-nm minimum relative to the shoulder, can only be approximations. The strong positive elipticity seen at 195 nm in the CD spectrum of both the refolded Kunitz domains is a feature of polypeptides that exhibit strong secondary and tertiary structural features, as opposed to random coils [20]. In short, the data in Figure 2B provide strong evidence that a significant portion of the recombinant proteins had folded into a proper Kunitz configuration.
The most common P1 residues among all Kunitz proteins are lysine and arginine [21]. Kunitz proteins with these P1 residues generally inhibit plasmin-like and trypsin-like proteinases that have cleavage specificity for basic residues [21]. Both ovTKDP-3 and boTKDP-4 carry a lysine P1 residue, and it was not surprising to find that their Kunitz domains inhibited both trypsin and plasmin. However, The lack of antitrypsin activity of boTKDP-2, which also possesses a P1 lysine, was unexpected and may result from an aspartic acid residue at position 16 (BPTI numbering) adjacent to the P1 lysine. The presence of a negative charge so close to the basic P1 residue might interfere with binding of the inhibitory loop at the proteinase active site. Only one other known Kunitz protein has an aspartic acid at this position, namely
-dendrotoxin from green mamba venom [22], one of several Kunitz neurotoxins that block ion-channel function. In general, such snake venom proteins are poor inhibitors of proteinases [23, 24].
The ability of boTKDP-4 and ovTKDP-3 to inhibit both trypsin and plasmin was of particular interest, because these two gene products are the only known examples of naturally occurring mammalian Kunitz inhibitors that lack the Cys14-Cys38 disulfide bond. Although their inhibitory activities toward trypsin and plasmin were an order of magnitude lower than those of BPTI at pH 8.0, both Kunitz proteins were nevertheless potent inhibitors, with Ki values in the nanomolar range. Our initial hypothesis regarding the two-disulfide Kunitz domains was that their inhibitory range might be broader than that of three-disulfide forms, because the increased flexibility within the inhibitory loops might provide a greater range of conformations for protein-protein interaction. However, this idea was not supported by the data. Whereas BPTI was able to inhibit chymotrypsin in addition to trypsin and plasmin, the two-disulfide Kunitz proteins inhibited chymotrypsin poorly, and their inhibitory activity was confined to trypsin and plasmin. It was also hypothesized that the less rigid structure of the two-disulfide forms might provide more solvent accessibility to the inhibitory loop, leading to cleavage of the inhibitor by proteinases. A few single-disulfide variants of BPTI produced by site-directed mutagenesis, including a form that lacked the Cys14-Cys38 bond, retained an ability to bind trypsin but was highly susceptible to proteolysis [25, 26]. However, neither trypsin nor plasmin cleaved boTKDP-4 (Fig. 5).
The Ki values reported here for BPTI against trypsin is much higher (in the 1010 M range rather than approximately 1013 M) than those reported by Vincent and Lazdunski [25], Castro and Anderson [13], Venturini et al. [26], and Helland et al. [27] and was found regardless of the source of the BPTI used (native or recombinant) and despite the fact that pains were taken to assess accurately the precise amount of inhibitory protein in the preparation and the quantity of active proteinase assayed. However, values comparable to ours have been reported by others [28, 29]. It is not clear why such discrepancies exist in the literature, but they could relate, in part, to conditions employed in the assays and by the curve-fitting procedures used to extract values from the raw data.
The hypothesis underlying the experiments in the present study was that the TKDPs likely were serine proteinase inhibitors targeted either to proteinases of maternal origin, such as lymphocyte-derived granzymes or tissue kallikreins, or to those derived from pathogens [3037]. The kallikreins comprise a multimembered family of serine proteinases with distinct substrate specificity [3739]. Members of the kallikrein family have been described in the uteri of rats, humans, and swine [4043]. In all likelihood, they act to modulate prostaglandin production, to increase blood flow, and to increase vascular permeability via the kininogen-kinin system [44]. In swine, they have also been suggested to participate in remodeling of the extracellular matrix and in degradation of insulin-like growth factor-binding proteins [43, 45].
Other potential target proteinases are the granzymes products of cytotoxic T lymphocytes and natural killer cellsthat are capable of inducing apoptosis in target cells [46]. Granzyme B has a preference for Asp in the P1 position, although it also has activity toward substrates with Asn and Ser as well [31]. The other granzymes have substrate specificities distinct from granzyme B [30]. For example, granzyme A prefers Arg or Lys in the P1 position [47], whereas rat granzyme C is predicted to cleave after Asn or Gln. Other granzymes (e.g., F and G) prefer large hydrophobic residues such as Phe in the P1 position [33]. Elevated numbers of T cells are present in the uterus of pregnant mice and pigs, but not in the uterus of pseudopregnant animals [48]. Clearly, the presence of a conceptus increases the migration of maternal lymphocytes into the uterus. In ruminants, large granular cells morphologically similar to natural killer cells are present in the uterus as well [49]. Because of the local scrutiny by such potentially cytotoxic cells, the conceptus might be anticipated to have evolved mechanisms to help it avoid destruction by the maternal immune system. The TKDPs could form part of such a protective system. However, the fact that it was only possible to demonstrate proteinase-inhibitory activities by two forms, which themselves were atypical in structure, raise questions as to whether our hypothesis is correct. Therefore, the role of TKDPs role in vivo may not be as proteinase inhibitors at all.
As mentioned above, the Kunitz domain has clearly evolved functions not necessarily restricted to proteinase inhibition [50]. Perhaps the best known is an ability to interact with voltage-gated potassium ion channels [5052]. The snake venom Kunitz toxins, like the TKDPs, display a variety of P1 residues, but they are often poor proteinase inhibitors, even when an amino acid is present at P1 that typically would target a particular proteinase. For example, as noted above,
-dendrotoxin, like boTKDP-2, has a P1 Lys [50] but is a poor inhibitor of trypsin. Several other venom-derived Kunitz inhibitors possess unusual P1 residues that have implied specificity toward chymotrypsin but have exhibited weak inhibitory activity on testing. Interestingly, the so-called chymotrypsin inhibitors from Bungarus fasciatus [51] and Ophiofagus hannah (King Cobra) [52] possess a P1 Asn, thereby resembling ovTKDP-1. Finally, Hollecker et al. [17] studied the effects of disulfide bond ablation on the toxin, dendrotoxin I, and found that loss of the Cys14-Cys38 disulfide increased channel-blocking activity. It is too early to know whether the TKDPs have any ability to bind to one or more of the many mammalian potassium channels to modulate ion fluxes, but the possibility is intriguing.
It is not uncommon for Kunitz venom toxins to possess a secondary protein component, usually a phospholipase, that is guided to the channel by the targeting Kunitz component, and it is the combination of the two proteins that provides the destructive power of the toxin [51, 52]. The present study focused on characterization of the Kunitz portion of each TKDP, but the majority of these proteins possess one or more amino terminal domains of approximately 80 amino acids and have roles that are unclear. Although these sequences do not correspond to any other known sequence in the protein databases, they likely are a functional part of the molecules, and future studies will address their roles.
In summary, the work reported here indicates that the highly unusual Kunitz variants in the TKDP family are capable of acting as proteinase inhibitors. However, antiproteolytic activity was not observed for most of the proteins tested, suggesting either that some of these Kunitz proteins have evolved a good deal of specificity toward their target proteinases or that the TKDP are not acting as proteinase inhibitors at all.
| FOOTNOTES |
|---|
2 Correspondence: Jonathan A. Green, 163 ASRC, 920 E. Campus Dr., University of Missouri-Columbia, Columbia, MO 65211. FAX: 573 882 6827; greenjo{at}missouri.edu ![]()
3 Current address: Department of Immunology, The University of Texas, M.D. Anderson Cancer Center, Houston TX 77054 ![]()
Received: 25 November 2003.
First decision: 11 December 2003.
Accepted: 18 March 2004.
| REFERENCES |
|---|
|
|
|---|
-chymotrypsin. Biochemistry 1996 35:11435-11446[CrossRef][Medline]
subunits. Eur J Biochem 1999 263:222-229[Medline]
-dendrotoxin. The functional topographies of dendrotoxins are different but share a conserved core with those of other Kv1 potassium channel-blocking toxins. J Biol Chem 1998 273 25393-25403This article has been cited by other articles:
![]() |
K. A. Berghorn, P. A. Clark-Campbell, L. Han, M. McGrattan, R. S. Weiss, and M. S. Roberson Smad6 Represses Dlx3 Transcriptional Activity through Inhibition of DNA Binding J. Biol. Chem., July 21, 2006; 281(29): 20357 - 20367. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Larson, C. G. Kumar, R. E. Everts, C. A. Green, A. Everts-van der Wind, M. R. Band, and H. A. Lewin Discovery of eight novel divergent homologs expressed in cattle placenta Physiol Genomics, May 16, 2006; 25(3): 405 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bayrhuber, V. Vijayan, M. Ferber, R. Graf, J. Korukottu, J. Imperial, J. E. Garrett, B. M. Olivera, H. Terlau, M. Zweckstetter, et al. Conkunitzin-S1 Is the First Member of a New Kunitz-type Neurotoxin Family: STRUCTURAL AND FUNCTIONAL CHARACTERIZATION J. Biol. Chem., June 24, 2005; 280(25): 23766 - 23770. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |