| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reproductive Technology |
Department of Veterinary Anatomy and Public Health,4 College of Veterinary Medicine, Texas A&M University, College Station, Texas 77840
Department of Population Health and Pathobiology5
Department of Molecular Biomedical Science,6 College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina 27606
Department of Animal Science,7 College of Agriculture and Life Sciences, North Carolina State University, Raleigh, North Carolina 27695-7621
Viagen Inc.,8 College Station, Texas 77843
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
developmental biology, gene regulation, placenta
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Hill et al. [14] demonstrated in a series of experiments that more than 80% of cloned pregnancies were lost in the bovine between Days 30–60 of gestation, and this was attributed to placental aberrations. Further examination of these animals indicated a reduction in the number of expected cotyledons and a marked decrease in chorio-allantoic blood vessels [14, 17]. These findings are consistent with other reports in cloned cattle where no placentome formation was observed in the placenta of NT fetuses that died in utero between Days 35 and 55 [18]. Nuclear transfer-derived mice also exhibit abnormal placentation, most commonly an increase in placental size, and this has been correlated with an expansion of the spongiotrophoblast layer [19]. Combined, these results suggest that improper establishment of the placenta gives rise, either entirely or partially, to the abnormalities and low rates of pregnancies observed in NT cattle.
Abnormal epigenetic reprogramming of the donor nuclei, resulting in mis-expression of genes needed for proper development and in improper genomic imprinting, has been implicated as a cause for the abnormalities observed in clones [20–25]. Recent evidence suggests these abnormalities may be due to abnormal reprogramming of the donor genome in cloned bovine embryos, which results in reduced demethylation and precocious de novo methylation [22, 26– 28]. This is supported by observations that cloned bovine embryos exhibit aberrant patterns of gene expression at developmentally important loci [29, 30]. Furthermore, improper reprogramming of imprinted genes has been demonstrated in cloned mice [23, 31] and altered patterns of X chromosome inactivation have been observed in bovine clones [32].
To date, a number of experimental models used to investigate imprinted genes consist of interspecies crosses, such as Mus spretus x Mus musculus and Peromyscus polionotus x Peromyscus maniculatius or intersubspecies, such as Mus musculus domesticus x Mus musculus castaneous [33–44]. Villar et al. [45] has outlined the use of interspecies hybrids to facilitate the identification of single nucleotide polymorphisms (SNPs) within coding regions, which are used to discriminate between parental alleles [45]. While there are reports that some interspecific crosses of mice, such as Peromyscus polionotus x Peromyscus maniculatus, result in loss of imprinting at some loci [46], these model systems are still in use for identifying genomic imprinting [33–35, 44].
Previously, we developed a Bos gaurus/Bos taurus interspecies model for the identification of imprinted genes in the bovine. B. gaurus/B. taurus interspecies models have been previously used due to increased levels of genetic heterogeneity between species, which can be used to discern between parental genomes [47–50]. The use of this model allowed the discrimination of parental alleles by the detection of a SNP at the insulin-like growth factor II (IGF2), gene trap locus 2 (GTL2), and X chromosome inactivation-specific transcript (XIST) loci. Analysis of these genes in Day 72 B. gaurus/B.taurus hybrid concepti demonstrated conservation of genomic imprinting at the GTL2 and IGF2 loci in the bovine with humans, mice, and sheep and at the XIST locus with mice (unpublished). In this experiment, we demonstrate the use of this hybrid model for examining the affects of nuclear transfer on the reprogramming of imprinted genes and DNA methylation in the bovine.
Briefly, lung fetal fibroblasts isolated from a Day 72 female B. gaurus/B. taurus hybrid was used as the donor cell line for NT, and resulting concepti were analyzed for fidelity of allelic expression of the imprinted IGF2, GTL2, and XIST loci. In addition, methylation analyses were performed between control and NT concepti at the bovine satellite I repeat element and the epidermal cytokeratin promoter.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Production of Control B. gaurus/B. taurus Hybrids
Heifers and mature (1.5- to 3-yr-old) Angus and Angus-cross cows were used to generate Day 40 and Day 72 control hybrid fetuses. Estrus was synchronized by serial injections of 25 mg Lutalyse (Pharmacia, Exton, PA) administered at 11-day intervals. Twelve hours (h) after detection of estrus, heifers were artificially inseminated with semen from a Gaur bull. Heifers were then checked at Day 28 of gestation for establishment of pregnancy using transrectal ultrasonography.
Isolation of Fetal Fibroblast from B. gaurus/B. taurus Hybrids
A Day 72 B. gaurus/B. taurus hybrid fetus was used as the donor genotype for nuclear transfer in this experiment. The head and viscera were removed, and the lungs were minced with a sterile razor blade. The tissue was added to 10 ml of 0.05% trypsin (Gibco Laboratories, Grand Island, NY), supplemented with 0.9 mM potassium chloride, 0.9 mM dextrose, 0.7 mM sodium bicarbonate, 0.1 mM EDTA (Sigma-Aldrich, St. Louis, MO), and 20 mM sodium chloride. The tissue/trypsin solution was shaken at 37°C for 15 min a total of three times. After incubation, the supernatant was collected, pooled, and pelleted. The cell pellet was resuspended in Dulbecco modified Eagle medium-F12 (DMEM F12; Gibco) supplemented with 10% fetal bovine serum (FBS) and 5% calf serum (CS) (Hyclone, Logan, UT), 30 mM sodium bicarbonate, 0.5 mM pyruvic acid, and 2 mM N-acetyl-L-cysteine (Sigma). In addition, 100 µg penicillin and 250 ng amphotericin (Gibco) were added to inhibit microbe growth. The cells were plated in 10-cm tissue culture plates, placed in a 5% CO2 incubator at 38°C, allowed to attach and grown to confluency and passaged. The cells were trypsinized and frozen in 50% FBS, 40% medium, and 10% DMSO (Sigma), for long-term storage and future use.
Production of Day 40 NT-Derived B. gaurus/B. taurus Hybrids
Ooctye maturation Oocytes were obtained from a commercial supplier (Ovagenix, San Angelo, TX) and matured in Medium 199 (M199; Gibco) supplemented with 10% FBS (Hyclone), 0.1 U/ml LH (Sioux Biochemical, Sioux City, IA), 0.1 U/ml FSH (Sioux Biochemical), and 1% penicillin-streptomycin (Sigma) for 20–22 h.
Preparation of Donor Cells Bovine lung fetal fibroblasts collected from the Day 72 donor fetus was cultured in four-well Nunc plates (Nunc International, Rochester, NY) at 35% confluency and grown in DMEM F12 (Gibco) containing 10% FCS at 37°C in air containing 5% CO2 for 5 days until contact inhibited. Cells were trypsinized and resuspended in DMEM F12 in preparation for reconstruction.
Nuclear Transfer Following 18 h of maturation, cumulus cells were removed from the oocytes by vortexing in 0.1% hyaloranidase (Sigma) in Hepes-M199 (H-M199; Sigma). Denuded oocytes were rinsed through three drops of manipulation medium (H-M199 containing 10% FCS) and then incubated for 10 min in culture medium M199 (Sigma) supplemented with 10% FCS containing 5 µg/ml Hoechst 3342 (Sigma). Oocytes with visible polar bodies were then placed in manipulation medium containing 7.5 µg/ml cytochalasin B (Sigma) and enucleated by aspiration of the first polar body and metaphase plate using a 22-µm beveled glass pipette. Absence of the metaphase plate was visualized by exposure to ultraviolet light.
Reconstruction was conducted in manipulation medium. The cells were placed in a separate drop of manipulation medium and groups of 15–20 cells were loaded in the pipette. A single cell was then placed in the perivitelline space of each enucleated oocyte. Following reconstruction, the oocytes were placed in a 1-mm fusion chamber (BTX, San Diego, CA) and fused by two DC pulses of 220 V/cm for 10 µsec in 275 mM mannitol (Sigma), 0.1 mM CaCl2 (Sigma), and 0.1 mM MgSO4 (Sigma). Following fusion, the oocytes were placed in culture medium for 4 h before activation.
Oocyte activation Reconstructed oocytes were activated by exposure to 5 µm ionomycin (Calbiochem, San Diego, CA) for 4 min, rinsed three times in manipulation medium, and placed in culture medium containing 2 mM 6-dimethylaminopurine (Sigma) for 4 h. Following activation, embryos were placed in G1 culture medium (Vitrolife, Englewood, CO) for 4 days, then transferred to G2 culture medium (Vitrolife) for an additional 2 days. On Day 6, compact morulae were loaded into a tube containing preequilibrated G2 medium and shipped to North Carolina State University for transfer on Day 7.
Synchronization of Recipients Heifers and mature Angus and Angus-cross cows (1.5–3 yr) were used as recipients for the cloned B. gaurus/B. taurus embryos. Cows were synchronized for estrus by serial injections of Lutalyse. Cows were monitored for estrus twice daily and at the onset of estrus, cows were categorized as Day 0 of estrus. At Day 7 of estrus, two cloned blastocysts were transvaginally transferred into the gravid horn.
Embryo Transfer Cloned embryos were placed into 2-ml glass vials containing pre-equilibrated G2 medium and shipped from Genetic Savings and Clone, College Station, TX, by an overnight courier in a 39°C heated incubator on Day 6 of embryo culture and shipped to Raleigh, NC (Day 7). The cloned embryos were maintained in the preequilibrated G2 medium at 39°C until time of transfer. Immediately before transfer, cloned embryos were moved to preheated ViGro Holding medium (AB Technology, Pullman, WA) and washed 2x to remove residual G2 medium. Embryos were maintained in the ViGro loading medium in a 39°C incubator until time of transfer. For transfer, two embryos were drawn into a 0.25-ml embryo transfer straw and nonsurgically transferred into the uterine horn ipsilateral to the corpus luteum.
Isolation of Control and Nuclear Transfer-Derived B. gaurus/B. taurus hybrid fetuses
At Day 40 of gestation, recipient cows containing either control or cloned pregnancies were slaughtered at a local abattoir; reproductive tracts were recovered and then transported on ice to a necropsy laboratory, where tissues were isolated. Weights and measurements were taken to monitor development of hybrid animals. Samples of chorion, allantois, liver, and brain were isolated and flash frozen in liquid nitrogen.
RNA and DNA Extraction
RNA was extracted from frozen samples using the Ambion RNA aqueous kit (Ambion, Austin, TX), resuspended in 10-µg aliquots in DEPC H2O and stored at –80°C. Two micrograms of RNA was DNase I treated using the Ambion DNase I Kit and cDNA was synthesized using the Ambion First Strand Synthesis Kit. DNA was extracted from frozen tissues using the Promega Wizard DNA Extraction Kit, resuspended at 20 ng/µl and stored at –20°C.
Microsatellite Analysis of Cloned B. gaurus/B. taurus Fetuses
Genotyping of clones and donor cells was performed at the DNA Technologies Lab, Department of Veterinary Pathobiology, Texas A&M University, College Station, TX, according to previously published procedures [51]. Results are based on variable nucleotide lengths of polymorphic microsatellites.
Analysis of Allelic Expression of the GTL2, IGF2, and XIST Loci
Reverse transcription polymerase chain reaction (RT-PCR) of the IGF2, GTL2, and XIST loci was performed using primers IGF2 (F, CAAGGCATCCAGCGATTAG; R, TAGGGGGCTGATTGAGTCA), GTL2 (F, CCCACCAGCAAACAAAGCAAC; R, CATCAAGGCAAAAAGCACATCG), and XIST (F, GAACATTTTCCAGACCCCAAC; R, AAACCAGGTATCCACAGCCG). Previously, we identified single nucleotide polymorphisms (SNPs) between Bos gaurus and Bos taurus genomic DNA for the XIST, IGF2, and GTL2 loci. A C/A SNP was detected at +767 in the 3' untranslated region (3' UTR) of IGF2 (C, Gaur; A, Angus). For the GTL2 locus, a C/A SNP was detected at +352 in exon 1 (C, Gaur; A, Angus), and a C/T SNP was detected at +353 in exon 1 of the XIST locus (C, Gaur; T, Angus). Reactions for each locus were performed using cDNA synthesized from chorion, allantois, and liver. Amplicons were resolved on a 2% ethidium bromide (EthBr) agarose gels and were gel extracted (Qiagen Gel Extraction Kit, Qiagen, Valencia, CA) and used directly as sequencing template. Sequencing primers consisted of forward primers used in the amplification of each of the RT-PCR reactions. Sequencing reactions were performed for 25 cycles at 94°C (30 sec), 50°C (30 sec), 60°C (4 min). Cleanup of sequencing reactions was carried out in 800-µl Sephadex columns (Sigma). Sequences were then run on either an ABI 370 or 3700 (Applied Biosystems, Foster City, CA) and sequence chromatograms were visually analyzed for the presence or absence of single nucleotide polymorphisms (SNPs). RT-PCR and sequencing reactions were run in triplicate. To confirm the absence of genomic contamination in cDNA samples, an internal control was used through the IGF2 amplicon (IGF2), which spanned intron 6. Genomic contamination would result in the presence of an additional 1-kilobase band.
Allelic Quantification of the XIST Locus
RT-PCR products from samples of chorion from clones and controls were cloned into TOPO4 sequencing vectors (Invitrogen, Carlsbad, CA) and transformed into TOP10 chemically competent Escherichia coli cells (Invitrogen). Plasmids were purified, sequenced as described above, and results examined individually for the presence or absence of the paternal (C) or maternal (T) SNP. Results are expressed in percentages of individual cloned sequences possessing either a C or T SNP.
Bisulfite Treatment of Genomic DNA
Genomic DNA was isolated (Promega Wizard DNA Isolation Kit) from the chorion and liver of controls (n = 3) and clones (n = 3). The sodium bisulfite reaction was carried out with 1 µg of DNA from each sample using the CpG DNA Conversion Kit (IntergenCo, Norcross, GA). Sodium bisulfite catalyzes the deamination of cytosines to uracils (thymines), whereas methylated cytosines (m5C) are protected. This technique allows for the rapid identification of m5C in genomic DNA. Genomic DNA was denatured through incubation of 3 M NaOH at 37°C. Denatured DNA was then incubated for 16–20 h at 50°C in the presence of 3 M sodium bisulfite and 0.5 mM hydroquinone. Carrier glycogen was added to bisulfite-treated DNA and incubated at room temperature for 5 min. DNA was then washed, centrifuged (13 000 rpm) and vortexed in successive volumes of 90% and 70% ethanol. Samples of DNA were resuspended in 50 µl tris-acetic acid-EDTA, incubated at 60°C for 15 min, centrifuged at 13 000 rpm for 30 sec, and the supernatant containing DNA transferred to a new tube; 1.5 µl of the supernatant was used in subsequent PCR reactions.
DNA Methylation Analysis of the XIST Differentially Methylated Region
DNA methylation analysis of the XIST differentially methylated region (DMR) in exon 1 was performed by digestion of 500 ng of genomic DNA with AciI and BstUI. Enzyme digestions were carried out in 20-µl reactions consisting of 2 µl 10x buffer, 2 µl (10 U) of AciI (TGNC/GCGG) or Bst UI (CGCG), and were digested for 24 h. Digested DNA (1.5 µl) was used as a template in a 50-µl PCR reaction, using primers flanking the CpG island (XIST-1: F, ATGGCGGGCTTTTGTCTCTG; R, GCGAGGTGCTATGCTAACTCAT), consisting of 5 µl 10x PCR buffer (Promega), 4 µl 25 mM MgCl2, 1.25 µl 10 mM dNTPs, 2.5 µl 3 M forward primer, 2.5 µl 3 M reverse primer, 2 µl DNA, and 1 µl Taq (Promega). PCR reactions were performed for 35 cycles at 94°C (5 min), 94°C (30 sec), 60°C (30 sec), 72°C (3 min) (10 cycles); 94°C (30 sec), 60°C (30 sec), 72°C (3 min) (25 cycles). Products were resolved on 2% EthBr agarose gels and analyzed for the presence or absence of bands. Negative controls consisted of undigested DNA and positive controls consisted of sperm DNA, which lacks methylation on the XIST DMR in exon 1 [52– 54].
Bisulfite Sequencing of the Epidermal Cytokeratin and Satellite I Regions
Bisulfite sequencing of the epidermal cytokeratin promoter was performed on samples of chorion and liver obtained from control and cloned pregnancies. Heminested amplification of the epidermal cytokeratin promoter was carried out in two 25-µl reactions consisting of 15.38 µl H2O, 2.5 µl 10x PCR buffer (Promega), 2 µl MgCl2 (25 mM), 0.62 µl dNTP, 1.25 µl forward primer (F, GTGGAYGGTAAGTTATTTAAAA), 1.25 µl reverse primer (R1, CCTCTTTCTACCAAACAAACCA), 1.25 µl Taq (Promega), and 1.25 µl bisulfite-treated DNA (100 ng), and run for 35 cycles at 94°C (10 min); 94°C (30 sec), 55°C (60 sec), 72°C (30 sec). Subsequently, 2 µl of reaction 1 was used as the template for a second reaction containing an internal reverse primer (R2, ACAAACCAAAAACTAATAATACC). PCR parameters were the same for the second reaction. Bisulfite sequencing of the satellite I region was performed on samples of chorion and liver obtained from control and cloned pregnancies essentially as described above using forward primer (F1, AATACCTCTAATTTCAAACT), and reverse primer (R1, TTTGTGAATGTAGTTAATA). For each region amplified, bands were resolved on 2% EthBr agarose gels, gel purified (Qiagen Gel Purification Kit), and cloned into TOPO4 (Invitrogen) for sequencing. Approximately 20 insert-containing plasmids were sequenced as described previously and sequences analyzed on MacVector 6.0 software (Accelrys, San Diego, CA) for presence or absence of methylated CpG dinucleotides.
Statistical Analyses
Mean comparisons of values obtained from bisulfite sequencing and allelic expression analysis were determined using an unpaired t-test with significance level of P < 0.05.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bos gaurus and Bos taurus hybrid fetuses and placentas were obtained at Day 40 and Day 72 of gestation (Fig. 1). A total of three Day 40 hybrid pregnancies were obtained (one female and two males) and six Day 72 hybrid pregnancies (four females and two males). Table 1 summarizes weights and measurements obtained from each of the hybrid fetuses. Additionally, sex of the three Day 40 fetuses was determined by Y chromosome-specific PCR reactions (data not shown).
|
|
Production of Day 40 NT-Derived B. gaurus/B. taurus Hybrids
Two hundred oocytes were fused with B. gaurus/B. taurus lung fetal fibroblast cells derived from the donor fetus and led to the generation of 32 grade-one blastocysts (32/ 211; 15.2%). At Day 28 of gestation, recipient cows were checked for pregnancy and three recipients were determined pregnant (3/15; 20%). At Day 40 of gestation, cloned fetal and placental tissues were isolated (Fig. 1). Monochorionic twins were present in clones 1 and 2 and a singleton was present in pregnancy 3. Gross comparisons of the fetal and placental components revealed an absence of cotyledons in each cloned pregnancy in contrast with Day 40 controls which possessed 4, 16, and 25 cotyledons per pregnancy. No apparent differences were observed in fetal or placental weights or allantoic fluid volumes (not shown). Table 1 summarizes weights and cotyledon numbers obtained from each of the cloned and control pregnancies.
Genotyping of Day 40 NT B. gaurus/B. taurus Hybrids
Microsatellite analysis at five loci (BM1225, BM1706, BM17132, BM1905, BM2113) from the five cloned fetuses (three concepti) indicates all are identical at loci examined and match the genotype of the donor cell line (Table 2). These results indicate all animals generated are genetically identical.
|
Allelic Expression Profiles of the IGF2, GTL2, and XIST Loci
IGF2 RT-PCR was performed using the IGF2 primer set on samples of cDNA obtained from chorion, allantois, and liver from both controls and clones and indicated expression in all tissues. The C/A SNP, which was previously detected in the Day 72 donor fetus, was also detected in the IGF2 amplified from genomic DNA of the three Day 40 control hybrids. Allelic expression analysis of IGF2 in samples obtained from control liver, chorion, and allantois showed preferential expression of the paternal allele (allele C). When analysis of IGF2 was extended to samples from the liver, chorion, and allantois of the three cloned concepti, preferential paternal expression of the locus was also observed. These results indicate fidelity of imprinting at the IGF2 locus in bovine clones (Fig. 2).
|
GTL2 RT-PCR of GTL2 in samples of chorion, allantois, and liver obtained from both controls and clones indicated high levels of expression in all samples. The C/A SNP was identified from genomic DNA samples in controls and clones and allelic expression analysis of cDNA indicated preferential maternal expression in chorion, allantois, and liver, therefore demonstrating maintenance of imprinting at the GTL2 locus in the fetus and placenta of all three concepti (Fig. 3).
|
XIST Using the XIST primer set, expression of the XIST was not detected in Day 40 or Day 72 hybrid males (fetuses E, F, G, and I) but was detected in the hybrid female controls (fetuses A, B, C, D, and H) and in all clones (clones 1, 2, 3). Analysis of XIST expression in controls was performed on female fetuses A, B, C, D (not shown), and H. Allelic expression analysis indicated biallelic expression of the XIST in liver and allantois and monoallelic expression (paternal) in the five female control chorions (not shown). In the clones, biallelic expression was detected in the liver and allantois; however, analysis of sequence chromatograms in clones revealed biallelic expression in the chorion of clones 2 and 3, whereas clone 1 appeared to exhibit monoallelic expression (Fig. 4).
|
In an attempt to quantify the levels of XIST parental expression from the chorion of clones 1–3, RT-PCR products using XIST primers were cloned into TOPO4 sequencing vectors and multiple plasmids were sequenced (45–83 for each reaction) to more accurately determine the ratio of paternal to maternal transcripts. Overall, the expression at the XIST locus was significantly different (P < 0.02) between clones and controls, including clone 1, which was originally determined to be monoallelic, with paternal allele expression equaling 73.6 ± 5.2 and 95 ± 0.8, respectively (Fig. 5). These results indicate abnormal biallelic expression of the XIST locus in each pregnancy deriving from increased expression of the maternal allele in the chorions of cloned fetuses.
|
Methylation Analysis of the XIST DMR in Exon 1
To correlate loss of imprinting at the XIST locus in the chorion of clones with altered methylation at the XIST DMR, genomic DNA isolated from the chorion and livers of cloned animals was digested with the methylation-sensitive restriction enzymes AciI and BstUI and used as template for a PCR reaction spanning the XIST DMR in exon 1 (Fig. 6). Results indicate that the methylation status of clones and controls do not differ. These results demonstrate maintenance of methylation in this region in all of the clones and tissues examined. Digestion with AciI and BstUI encompasses 8 of the 11 CpG dinucleotides present in this region.
|
Methylation Analysis of the Epidermal Cytokeratin Promoter and Satellite I Repeat Element
To understand the effects of nuclear reprogramming, it was essential to assess imprinted gene expression in conjunction with DNA methylation analysis. Because the DNA sequence of the bovine DMR regions regulating imprinting at the IGF2 and GTL2 are not available, the DNA methylation analysis of the epidermal cytokeratin promoter, which is methylated in a tissue-specific manner, and the bovine satellite I repeat element, which is a heavily methylated relic of retrotransposons, were incorporated into the experiment. As shown in Figure 7, bisulfite sequencing of the cytokeratin promoter indicated the level of methylation did not differ between controls and clones in the liver (73.7% ± 0.7% vs. 63.8% ± 6.2%, respectively), while differences were seen in the chorion, with the controls being hypomethylated compared with the clones (11.8% ± 4.0% vs. 37% ± 13.0%). When analysis was extended to the satellite I region (Fig. 7), similar results were observed with no differences in liver methylation levels between controls and clones (56.0% ± 3.5% vs. 65.4% ± 4.5%, respectively) but hypomethylation of the chorion in controls compared with the clones (12.9% ± 2.8% vs. 49.9% ± 8.0%). These results indicate improper reprogramming of DNA methylation in the chorion of clones at the epidermal cytokeratin promoter and the satellite I repeat element.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The interspecies model generated for this experiment is ideal for identifying imprinted genes and subsequent analysis in NT-derived fetuses. Interspecies models have been used extensively in mice for the identification of imprinted genes due to their increased levels of SNPs that facilitate parental discrimination of alleles in the offspring [34, 36– 38, 40, 41, 44, 45]. The described B. gaurus x B. taurus interspecies models is ideal in that it allows identification of SNPs in the absence of any embryonic and fetal abnormalities. Previously, we sequenced the coding regions of 20 genes reported as imprinted in humans and mice in DNA obtained from B. gaurus and B. taurus. This facilitated the identification of SNPs in the IGF2, GTL2, XIST, and Wilms tumor 1 (WT1) loci. Analysis of allelic expression in Day 72 B. gaurus/B. taurus hybrid concepti revealed maternal and paternal imprinting at the IGF2 and GTL2 loci, respectively, in all tissues examined and maternal imprinting at the XIST locus in the chorion of females. No imprinting was detected at the WT1 locus in hybrids. These results indicate high levels of conservation with the mouse, human, and sheep, supporting use of this hybrid model to investigate genomic imprinting in the bovine.
Observations of the three NT-derived pregnancies established indicated that no abnormalities of the fetuses were apparent. However, analysis of the placenta of each clone indicated differences in cotyledon number between the three clones and age-matched controls (clones 1–3 = 0, 0, 0 cotyledons; controls G–I = 25, 16, 4 cotyledons, respectively). These finding are similar to Hill et al. (2000) in that clones between Days 35 and 55 have reduced placentome number and reduction in chorio-allantoic fusion, but the low number of pregnancies produced for this experiment makes it difficult to assess the overall phenotypes of clones generated by this cell line [17].
Allelic expression analysis of the imprinted genes indicated fidelity of expression of IGF2 and GTL2 in the liver and chorion of clones 1–3. This pattern of expression correlates with the expression patterns detected in the donor fibroblast used for NT (data not shown). In contrast, we observed abnormal biallelic expression at the XIST locus in the chorion of clones 1–3, but proper biallelic expression of the locus in the liver. Initially, it appeared that only clones 2 and 3 exhibited biallelic expression of XIST based on the sequence chromatograms, but after analyzing the relative ratios of maternal to paternal transcripts, it was determined that all three fetuses exhibited disrupted, although varying levels, of XIST expression. These results were confirmed after multiple sequences were obtained from different sets of RNA isolations and were additionally confirmed to be free from genomic contamination through monoallelic expression of the IGF2 locus from the same cDNA sample. Additionally, chorion samples were obtained from the ends of the placenta, thus preventing contamination from allantoic tissue, which exhibits biallelic expression of the XIST locus and undergoes fusion with the chorionic membrane
These findings are consistent with other reports of improper X chromosome inactivation (XCI) in cattle and disrupted genomic imprinting in mouse embryo clones, but are the first report of midgestation clones exhibiting LOI [23, 24, 32]. Xue et al. recently demonstrated aberrant patterns of X chromosome inactivation in the placenta and somatic tissue of cloned cattle based on analysis of the X-linked monoamine oxidase type A locus (MAOA) [32]. Their reports indicated that all deceased clones exhibited biallelic expression of MAOA locus in the placenta. Furthermore, two deceased clones lacked expression of the MAOA and XIST loci in tissue isolated from the heart, thus suggesting complete inactivation of both X chromosomes in the soma and activation of both X chromosomes in the placenta in some animals. Their analysis was further extended to include the XIST DMR in exon 1, where hypomethylation was detected in the heart of two deceased clones. However, our analysis of the XIST DMR in the chorion of cloned hybrids revealed no apparent loss of methylation. Additionally, XCI appeared to be normal within the liver of all clones examined. Combined, these results suggest that the degree of dysregulation at the XIST locus is lower in our hybrid clones than those generated by Xue et al. [32].
These findings could be attributed to the state of the epigenetic marks present on the donor cells. Eggan et al. demonstrated that, in mice, the somatic and gametic mark regulating XCI are equivalent, and when disrupted in donor cells used for cloning, result in random XCI in the trophectoderm [58]. These findings are further supported by Mann et al., whose analysis of cloned mouse embryos demonstrated that the switch from monoallelic expression of Igf2R and Ascl2 in the donor cell to biallelic expression in the embryo is dysregulated, further supporting the idea that the epigenomic template of the donor cell affects the outcome of allelic expression [23]. Therefore, it is possible that the donor cells used for cloning of our hybrids possessed epigenetic marks at the X inactivation center sufficient for maintenance of XCI, but compromised for the initiation of XCI, and resulted in random XCI in both the chorion and liver with the clones. However, the somatic imprints present on the IGF2 and GTL2 loci were sufficient for perpetuating the correct imprint.
Analysis of the methylation status of the epidermal cytokeratin promoter and satellite I region further support that dysregulation of reprogramming occurs during cloning, with chorion-derived samples being hypermethylated in clones compared with controls. It also indicates that the level of dysregulation varies between clones, with some clones being more affected than others. This parallels the phenotypes that are observed in cloned cattle, which range from extremely severe to mild. Our results also suggest that hypermethylation, or lack of demethlyation, of the genome occurs in the cells giving rise to the placenta and not the soma and may be associated with the biallelic expression that is observed at the XIST locus through the reprogramming that occurs in this cell lineage. This conclusion is supported by our analysis of the cytokeratin promoter and satellite I region in samples of gaur DNA, which exhibit hypermethylation of the two regions, through reports by Kang et al., whose work demonstrated hypermethylation of the bovine trophectoderm (cells giving rise to chorion) in Day 7 NT-derived embryos, and also reports from Dean et al., whose analysis of cloned bovine genomes demonstrated incomplete reprogramming during early embryonic development [22, 28]. Additionally, experiments have shown that cloned mouse embryos aberrantly express the somatic form of DNA methyltransferase 1 (Dnmt1) [60]. The increased levels of DNA methyltransferase and the lack of proper reprogramming, such as the rapid demethylation of the paternal genome, could both contribute to the hypermethylated state of the chorion in the clones. Whether these events or the epigenome of the donor cell contributed to the LOI of XIST in the chorion is undetermined, but these findings demonstrate the capacity of NT to affect the status of imprinting at a given locus.
In conclusion, our findings suggest that nuclear reprogramming of the cells giving rise to the chorion are improperly reprogrammed during early embryonic development and potentially induce the placental abnormalities that are prevalent in cloned animals. It is, however, possible that there are other areas in which improper reprogramming may occur, such as histone methylation and acetylation, but DNA methylation and genomic imprinting have been shown to be crucial for the development in the early embryo when these lineages are established.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: Jorge A. Piedrahita, Department of Molecular Biomedical Science, College of Veterinary Medicine, North Carolina State University, 611 Hutton St., Raleigh, NC 27606; FAX: 919 515 4237; jorge_piedrahita{at}ncsu.edu
3 Current address: Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030
Received: 6 December 2003.
First decision: 14 January 2004.
Accepted: 16 March 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  H. Niemann, X C. Tian, W A. King, and R. S F Lee Epigenetic reprogramming in embryonic and foetal development upon somatic cell nuclear transfer cloning Reproduction, February 1, 2008; 135(2): 151 - 163. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Sellner, J. W. Kim, M. C. McClure, K. H. Taylor, R. D. Schnabel, and J. F. Taylor BOARD-INVITED REVIEW: Applications of genomic information in livestock J Anim Sci, December 1, 2007; 85(12): 3148 - 3158. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. F. Mastromonaco, L. A. Favetta, L. C. Smith, F. Filion, and W. A. King The Influence of Nuclear Content on Developmental Competence of Gaur x Cattle Hybrid In Vitro Fertilized and Somatic Cell Nuclear Transfer Embryos Biol Reprod, March 1, 2007; 76(3): 514 - 523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos Biol Reprod, October 1, 2006; 75(4): 531 - 538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Constant, M. Guillomot, Y. Heyman, X. Vignon, P. Laigre, J.L. Servely, J.P. Renard, and P. Chavatte-Palmer Large Offspring or Large Placenta Syndrome? Morphometric Analysis of Late Gestation Bovine Placentomes from Somatic Nuclear Transfer Pregnancies Complicated by Hydrallantois Biol Reprod, July 1, 2006; 75(1): 122 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Curchoe, S. Zhang, Y. Bin, X. Zhang, L. Yang, D. Feng, M. O'Neill, and X. C. Tian Promoter-Specific Expression of the Imprinted IGF2 Gene in Cattle (Bos taurus) Biol Reprod, December 1, 2005; 73(6): 1275 - 1281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zhang, C. Kubota, L. Yang, Y. Zhang, R. Page, M. O'Neill, X. Yang, and X. C. Tian Genomic Imprinting of H19 in Naturally Reproduced and Cloned Cattle Biol Reprod, November 1, 2004; 71(5): 1540 - 1544. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
