Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print April 28, 2004.
Biol Reprod 2004, 10.1095/biolreprod.103.025635
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/2/613    most recent
biolreprod.103.025635v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.
Agricola
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.
BIOLOGY OF REPRODUCTION 71, 613–619 (2004)
DOI: 10.1095/biolreprod.103.025635
© 2004 by the Society for the Study of Reproduction, Inc.


Male Reproductive Tract

Characterization of Epididymal Epithelial Cell-Specific Gene Promoters by In Vivo Electroporation1

Jennifer L. Kirby3, Ling Yang3, Jacquelyn C. Labus3, R. John Lye3, Nelson Hsia5, Richard Day3,4, Gail A. Cornwall5, and Barry T. Hinton2,3

Department of Cell Biology3 Department of Internal Medicine,4 University of Virginia Health System, Charlottesville, Virginia 22908 Department of Cell Biology and Biochemistry,5 Texas Tech University Health Sciences Center, Lubbock, Texas 79430


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The mammalian epididymis plays a critical role in sperm maturation, a function dependent on testicular androgens. However, the function of the initial segment, the most proximal part of the epididymis, is also dependent on luminal factors of testicular origin. Efferent duct ligation (EDL), which prevents luminal testicular fluid from reaching the epididymis, results in changes in gene expression within this region. Cystatin-related epididymal spermatogenic (cres) gene and {gamma}-glutamyl transpeptidase (GGT) mRNA IV are highly expressed in the initial segment and are regulated by luminal testicular factors. EDL results in decreased expression of both genes. To evaluate these promoters in the context of their native physiological state, an in vivo electroporation procedure was used. Significant differences were observed in vivo compared to previous in vitro results. Whereas two C/EBP sites were necessary for transcriptional activity from a 135-base-pair (bp) cres promoter in vitro, only the 5' site displayed functional activity in the in vivo system. A 135-bp GGT promoter IV construct was sufficient for reporter gene expression in vitro. However, in vivo, substantial expression was not observed until the construct was extended to 530 bp. Three polyoma enhancer activator 3 (PEA3) sites were found to be necessary for in vivo reporter gene expression from this construct. A cis-acting negative regulatory element between –530 and –681 bp was also identified that was not previously recognized in the in vitro studies. These studies demonstrate the utility of in vivo electroporation for elucidating promoter elements that may not be identified when traditional in vitro methods are used.

epididymis, gene regulation, male reproductive tract


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue-specific gene expression can be controlled at multiple levels by such elements as cis-acting sequences, tissue-specific expression of transcription factors, and local chromatin structure. Promoter analysis is the foundation for understanding how genes are expressed in specific tissues. However, most promoter analysis experiments are carried out in cell culture, either in cells that express the gene of interest or in heterologous cell lines. These systems may be confounded by multiple problems, including the absence of cell type-specific regulatory proteins necessary for transcription. Promoter analysis of genes expressed in the epididymis has been particularly problematic because of a lack of adequate epididymal cell lines. Only recently have several epidiymal cell lines been generated [13]. However, many genes expressed in the most proximal region of the epididymis, the initial segment, are dependent on testicular factors that reach the epididymis in the luminal fluid, referred to as luminal testicular factors (LTFs). These factors are most likely growth factors, such as fibroblast growth factors (FGFs) [4, 5]. Efferent duct ligation (EDL), which prevents the flow of fluid from the testis into the epididymis, has profound effects on gene expression in the initial segment [6]. Likewise, removal of the initial segment for primary culture of the epithelial cells or generation of cell lines has the same effect, complicating the analysis of initial segment-specific gene promoters in vitro.

One potential method for analyzing initial segment-specific promoters is in vivo electroporation, which avoids the previously described pitfalls. Recently, in vivo electroporation has been used as a means of expressing genes in multiple tissues in the intact animal mostly to overexpress certain proteins [79]. Tissue-specific promoter analysis using this approach is a novel use of the in vivo electroporation method and has recently been used in muscle tissue [10]. In this study, the promoters of two genes, cystatin-related epididymal spermatogenic (cres) and {gamma}-glutamyl transpeptidase (GGT), specifically expressed in the rodent initial segment, have been analyzed using in vivo electroporation and compared to previous results from in vitro analysis [11, 12].

In the mouse, cres expression is restricted to germ cells in the testis, anterior pituitary gonadotrophs, and the initial segment [1315]. When the cres promoter (Fig. 1A) was tested in LTß2 gonadotroph cells, both 1.6 kilobases (kb) and 135 base pairs (bp) of promoter sequence were capable of reporter gene expression [11]. Within the 135-bp promoter sequence were two CCAAT/enhancer binding protein (C/EBP) DNA-binding sites [11]. Mutation of either C/EBP site reduced the expression of the reporter gene, and mutation of both sites essentially eliminated reporter gene expression [11].



View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. A) Schematic representation of the minimal cres promoter. Black boxes denote the two C/EBP sites found within the 135-bp cres promoter. B) Schematic representation of the 2-kb promoter for GGT mRNA IV. Black boxes denote consensus PEA3 sites (5'-AGGAAG-3'). White boxes denote nonconsensus PEA3 sites (5'-AGGAAc/t-3'). Asterisks denote those PEA3 sites that are in the opposite orientation with respect to the GGT locus

In the rat, there are five promoters that control the expression of five GGT mRNAs (I–V) [16]. Each mRNA contains a unique 5' untranslated region (UTR) and a common 5' UTR –144 bp upstream from the translation start site. The remainder of the mRNA is the same for all forms. Each mRNA encodes an identical protein, but each promoter controls the expression of GGT in a tissue-specific manner [16]. GGT mRNA IV is highly expressed in the rat initial segment [17, 18]. Previous studies were carried out to analyze 2 kb of promoter sequence for GGT mRNA IV in rat primary initial segment epithelial cell cultures [12]. This 2-kb promoter sequence contained several polyomavirus enhancer activator 3 (PEA3) DNA-binding sites (Fig. 1B). On cotransfection with PEA3, a 135-bp sequence was capable of transcriptional activity. Deletion of the PEA3 site within this construct substantially decreased reporter gene expression [12].

The present study was designed to compare the results from the previous in vitro promoter analysis with results generated by these in vivo electroporation studies. The differences observed between the two methods suggest that in vivo electroporation is a superior method for evaluating the promoters of genes expressed in a tissue-specific manner.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals

Normal adult male Sprague-Dawley rats (Hilltop Laboratories, Philadelphia, PA) were maintained on a 12L:12D cycle with free access to food and water in the University of Virginia vivarium. All experiments complied with the regulations set forth by the Animal Welfare Act (Public Law 91-579), the Guide for the Care and Use of Laboratory Animals (NRC, 1996) published by the Department of Health and Human Services, and the policies and procedures of the University of Virginia Institutional Animal Care and Use Committee.

Preparation of Plasmids

The cres promoter constructs were derived from the mouse promoter, which is similar in structure to the rat promoter and were previously described [11]. The GGT promoter IV constructs p135LUC, p250LUC, p530LUC, p903LUC, p1976LUC, and p(–16 to –36)135LUC were described previously [12]. The inserts from these vectors were transferred from pGL3-enhancer to pGL3-basic (both from Promega Biosciences Inc., Madison, WI) using an NheI/NarI restriction digest. The resulting plasmids were named pGL3-b135, pGL3-b250, pGL3-b530, pGL3-b903, pGL3-b1976, and pGL3-b135del, respectively. To generate GGT promoter IV-EGFP, pEGFP-C3 (BD Biosciences Clontech, Palo Alto, CA) was restriction digested with NarI and XbaI. The enhanced green fluorescent protein (EGFP) fragment was then ligated into p1976LUC that had been restricted with NarI and XbaI, releasing the luciferase sequence except for 33 bp encoding the first 11 amino acids. To generate pGL3-b681, pGL3-903 was digested with MslI and XmnI to produce a 716-bp fragment that was cloned into pGL3-basic digested with SmaI. To generate pGL3-b6500, a {lambda} phage clone-containing genomic sequence between GGT exon V and GGT promoter IV [19], kindly provided by Dr. Y. Laperche (INSERM, Créteil, France), was digested with XbaI and BglII. A 5-kb fragment was ligated into pGL3-1976 digested with NheI and BglII. The 5-kb {lambda} phage fragment overlapped with approximately 500 bp at the 5' end of pGL3-b1976; thus, pGL3-b6500 contained an additional 4.5 kb of sequence 5' to the 2 kb previously published under Genbank accession number AF218050 [12]. To generate pGL3-b135mut, pGL3-b530m1-3, and pGL3-b530c, approximately 50 ng of pGL3-b135 and pGL3-b530 were subjected to PCR-based mutagenesis using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA). The PCR reactions (14 cycles of 95°C for 30 sec, 55°C for 1 min, and 68°C for 11 min) were done using the following pairs of primers. Bold represents the nucleotides that were mutated with the original nucleotides above the sequence.

  1. TC
  2. 135MUT sense: GGCTGGACTCTGGTCTCTGAGGCTGGTAAG
  3. AG
  4. 135MUT antisense: GATCCTTACCAGCCTCAGAGACCAGAGTCCAGC
  5. GA
  6. 530MUT1 sense: CAGAGTTTGGCAGAGAGAGTAAGAAGTGACAGTT
  7. TC
  8. 530MUT1 antisense: AACTGTCACTTCTTACTCTCTCTGCCAAACTCTG
  9. GA
  10. 530MUT2 sense: CAAAGAAAGGTTTAGAGAGGTGTCATAAGGTAGC
  11. TC
  12. 530MUT2 antisense: GCTACCTTATGACACCTCTCTAAACCTTTCTTTG
  13. GA
  14. 530MUT3 sense: GGTAGCAGAGTTTGAAGAGAGACTACTTAAGACC
  15. TC
  16. 530MUT3 antisense: GGTCTTAAGTAGTCTCTCTTCAAACTCTGCTACC
  17. GT
  18. ControlMUT sense: GAAGGTGTCATAAGAGAGCAGAGTTTGAAGGAAG
  19. AC
  20. ControlMUT antisense: CTTCCTTCAAACTCTGCTCTCTTATGACACCTTC

All plasmids were confirmed by sequencing (Biomolecular Research Facility, University of Virginia, Charlottesville, VA). All plasmids used for in vivo electroporation were purified by EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA) or CsCl density gradient ultracentrifugation.

In Vivo Electroporation

Rats were anesthetized with an intraperitoneal pentobarbital sodium injection (Nembutal; Abbott Laboratories, Chicago, IL). The scrotal contents were reached by a midline abdominal incision. Micropipettes made from R-6 glass with an outer diameter of 0.9 mm and an inner diameter of 0.6 mm (Drummond Scientific Company, Broomall, PA) were pulled on a Flaming/Brown micropipette puller (Model P-97; Sutter Instrument Company, Novato, CA). The pipettes were then sharpened on soapstone to a tip diameter of 20–30 µm. For intraluminal injections, 2–5 µl of either pEGFP-N1 (BD Biosciences Clontech) or GGT promoter IV-EGFP at 2 µg/µl were injected into the lumen of an initial segment tubule. For GGT promoter IV analysis, 15 µl of DNA were injected into zones 1a and 1b (see [20] for characterization of zones) of the initial segment interstitium underneath the capsule. For cres promoter analysis, 25µl of DNA were injected into zones 1a, 1b, and 1c of the initial segment. Following the injection, the tissue was grasped between the plates (7-mm diameter) of a pair of tweezertrodes (BTX, San Diego, CA), and 8 x 50-msec pulses of 21–24 V were delivered to the tissue using an Electro Square Porator ECM 830 (BTX). The distance between the electrodes was kept constant at 0.2 cm. The testis and epididymis were returned to the scrotum, and the body wall and skin were sutured. At the indicated times, the rats were euthanized with carbon dioxide gas, and the tissue was removed, frozen in liquid nitrogen, and stored at –80°C until use. The entire initial segment was taken from rats injected with cres promoter constructs, whereas only the proximal half of the initial segment was taken from rats injected with GGT promoter IV constructs.

To examine the different length GGT promoter IV constructs, equimolar amounts of DNA were used as follows: pGL3-b135 at 2.5 µg/µl, pGL3-b250 at 2.6 µg/µl, pGL3-b530 at 2.7 µg/µl, pGL3-b681 at 2.8 µg/ µl, pGL3-b903 at 2.9 µg/µl, and pGL3-b1976 at 3.4 µg/µl. For the experiments comparing pGL3-b530 and pGL3-b6500, 2.5 µg/µl of pGL3-b6500 and 1.2 µg/µl of pGL3-b530 were used. Linearized pUC18 was added to make the total DNA mass equivalent for each injection within an experiment. To control for electroporation efficiency, 1 ng/µl of pRL-SV40 was included with every injection. To examine the cres promoter constructs, 3 µg/µl of the different cres constructs in pGL3-basic were coinjected with 50 ng/µl of pRL-TK (electroporation efficiency control).

Fluorscence Microscopy

Following electroporation, tissues were removed at 72 h and frozen in liquid nitrogen. Five-micron frozen sections were prepared by the University of Virginia Cell Science Core, and sections were analyzed with a Zeiss 410 Laser Scanning Confocal Microscope (Carl Zeiss Optical, Inc., Thornwood, NY). Integrated black-and-white images were captured and then pseudocolored.

Dual Luciferase Assay

Assays were performed with the Dual Luciferase Assay kit from Promega according to the manufacturer's instructions with minor modifications. Previously collected and frozen tissues were ground with a mortar and pestle under liquid nitrogen. Once the liquid nitrogen had evaporated, the pellets were resuspended in Luciferase Assay Reagent II. Protein determinations were made using the Bradford method (Bio-Rad Laboratories, Hercules, CA), and 50 µg of protein in 20 µl were assayed. Measurements were taken on an FB-15 luminometer (Zylux Corporation, Maryville, TN). For GGT experiments, background values were determined on the contralateral initial segments that were uninjected and unelectroporated. Background values were then subtracted from each sample, and the ratio of firefly to renilla luciferase was calculated by dividing the firefly value of each sample with the respective renilla value. For cres experiments, background values from age-matched controls were subtracted, and then ratios were calculated as described for GGT.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Localization of EGFP Expression after In Vivo Electroporation in the Initial Segment

To test the ability of the in vivo electroporation method to express genes in the initial segment, a plasmid-encoding EGFP under the control of the cytomegalovirus (CMV) promoter was injected intraluminally into the initial segment and electroporated. After 72 h, the initial segments were removed and analyzed with integrated confocal immunofluorescence to assess the expression of EGFP. As seen in Figure 2B, intense fluorescence was observed in the cytoplasm of the epithelial cells. This expression was observed in all tubules that had been injected with the plasmid and could be visualized as much as 1 wk after electroporation (data not shown). Next, a plasmid containing the full 1976-bp GGT promoter IV controlling EGFP expression was used. Intense staining was observed in what appeared to be a vesicular compartment (Fig. 2C). This construct contains the first 11 amino acids of firefly luciferase attached to EGFP, which may be responsible for the vesicular targeting in these cells. Minor background fluorescence can be seen in the sections in which no DNA was injected (Fig. 2A). With the intraluminal injection method, we frequently experienced tubule blockages that would result in little or no flow of fluid from the testis to the epididymis. As this defeated the purpose of analyzing these promoters by this method, we adopted an interstitial method of plasmid injection. Results from the interstitial injection of the GGT promoter IV-EGFP construct are shown in Figure 2D and reveal a similar fluorescence pattern as seen with the intraluminal injection. To avoid the complications with the intraluminal injections, the remainder of the experiments were carried out with interstitial injections.



View larger version (152K):
[in this window]
[in a new window]
 
FIG. 2. Integrated confocal fluorescence images of initial segments injected with no DNA control (A), intraluminal CMV-EGFP (B), intraluminal GGT promoter IV-EGFP (C), and interstitial GGT promoter IV-EGFP (D). The scale bars represent 50 µm in all panels

Analysis of Initial Segment-Specific Promoters by In Vivo Electroporation

GGT promoter IV and the cres promoter have been analyzed previously in primary initial segment epithelial cell culture and anterior pituitary cell lines, respectively [11, 12]. However, because of their dependence on LTFs for expression in the initial segment, analysis of these promoters in the context of the whole tissue was performed utilizing the in vivo electroporation method. Electroporation of the previously characterized minimal cres promoter (Fig. 1A) resulted in transcriptional activity from the parental plasmid (135 in Fig. 3A). Mutation of the 3' C/EBP site (1M) had no effect on transcriptional activity, whereas mutation of the 5' C/EBP site (2M) resulted in a 54% reduction of transcriptional activity. Mutation of both sites (DM) produced no statistically significant difference in luciferase expression compared to the 2M construct even though there may have been a significant decrease with a larger number of experiments.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. In vivo electroporation of initial segment-specific promoters. A) Equal concentrations of the cres promoter constructs 135, 1M, 2M, or DM were coinjected with pRL-TK into the initial segment and electroporated. Dual luciferase assays were performed 72 h after electroporation. B) Equal concentrations of the GGT promoter IV constructs pGL3-b135, pGL3-b135del, or pGL3-b135mut were coinjected with pRL-SV40 into the proximal half of rat initial segments and electroporated. Dual luciferase assays were performed 24 h after electroporation. Results from both experiments are expressed as the ratio of firefly luciferase units (FLU) to renilla luciferase units (RLU). Each promoter construct was tested in three to five rats and expressed as the mean FLU-to-RLU ratio ± SEM. Mean ratios with different numbers are significantly different (P < 0.05) as assessed by one-way ANOVA followed by Tukey test

Next, equal concentrations of the 135-bp GGT promoter IV construct (pGL3-b135), the 135 construct with a deleted PEA3 site (pGL3-b135del), and the 135 construct with a mutated PEA3 site (pGL3-b135mut) were electroporated into the tissue. Whereas deletion of 20 bp containing a putative PEA3 site abrogated luciferase expression, specific mutation of the PEA3 site had no significant effect on the expression from the 135-bp GGT promoter IV construct (Fig. 3B).

Analysis of the 2-kb GGT Promoter IV by In Vivo Electroporation

Because of the unexpected results obtained with pGL3-b135, experiments were carried out with the 2-kb promoter to determine if sequences 5' to the 135 bp were responsible for GGT promoter IV activity in vivo. Equimolar concentrations of pGL3-b1976 and the 5' deletion constructs of pGL3-b1976 (Fig. 1B) were electroporated into the proximal half of the initial segment. Although each construct was able to generate some level of transcriptional activity, electroporation of the pGL3-b530 construct resulted in a significant increase in transcriptional activity compared to the other constructs (Fig. 4). Truncation of pGL3-b530 to –250 bp decreased the activity of the promoter by almost 95%, indicating the presence of a positive cis-acting regulatory element(s) between –250 and –530 bp. Additionally, when the promoter region was extended to –903 and –1976 bp, transcriptional activity decreased by 94% and 97%, respectively, suggesting the presence of a cis-acting negative regulatory element between –530 and –903 bp. To further define the region containing the cis-acting negative regulatory sequence, an additional construct, pGL3-b681, was created. When this construct was used for in vivo electroporation, expression was reduced by 79% compared to pGL3-b530, suggesting that the major repressor activity was between –530 and –681 bp (Fig. 4). This sequence (–530 to –681 bp) was then subcloned in front of the SV40 early promoter in pGL3-control to determine if it could function as a general repressor. No difference was observed between pGL3-control with and without this sequence in in vivo electroporations (data not shown).



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 4. In vivo electroporation of GGT promoter IV constructs. Equimolar concentrations of the various GGT promoter IV constructs were coinjected with pRL-SV40 into the proximal half of rat initial segments and electroporated. Dual luciferase assays were performed 24 h after electroporation. Results are expressed as the ratio of FLU to RLU. Each promoter construct was tested in at least five rats and expressed as the mean FLU to RLU ± SEM. Mean ratios with different numbers are significantly different (P < 0.001) as assessed by one-way ANOVA followed by Tukey test

Analysis of pGL3-b530 Mutants

Analysis of the sequence between –250 and –530 bp reveals the presence of three consensus PEA3 DNA-binding motifs found at –452 to –447 bp, –399 to –394 bp, and –369 to –364 bp in GGT promoter IV (Fig. 1B). To determine if any of these PEA3 sites were responsible for the activity of the pGL3-b530 construct in vivo, PCR-based mutagenesis was performed to change the consensus 5'-AGGAAG-3' to 5'-AGAGAG-3' beginning with the most 5' site, yielding pGL3-b530m1, pGL3-b530m2, and pGL3-b530m3, respectively. In vivo, mutation of any one of the three PEA3 sites resulted in an 88%–90% decrease in promoter activity (Fig. 5). An additional construct, pGL3-b530c, was made by mutating the sequence 5'-AGGTAG-3' at –385 to –380 bp, which closely resembles a PEA3 DNA-binding site, to 5'-AGAGAG-3'. When this construct was used for in vivo electroporation, no significant difference compared to the wild-type pGL3-b530 construct was observed (Fig. 5).



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 5. In vivo electroporation of pGL3-b530 and pGL3-b530m1-3 constructs. Equal amounts of either pGL3-b530, pGL3-b530m1-3, or pGL3-b530c were coinjected with pRL-SV40 and electroporated into the proximal half of rat initial segments. Dual luciferase assays were performed 24 h after electroporation. Results are expressed as the ratio of FLU to RLU. Each promoter construct was tested in five rats and expressed as the mean FLU-to-RLU ratio ± SEM. Mean ratios with different numbers are significantly different (P < 0.001) as assessed by one-way ANOVA followed by Tukey test

Cloning and Analysis of Additional GGT Promoter IV Sequence

The results shown in Figure 3 suggested that pGL3-b1976 does not represent the entire GGT promoter IV. To examine more 5' sequences, a 4.5-kb fragment from a {lambda} phage clone-containing rat genomic DNA between exon V and promoter IV [19] was cloned into pGL3-b1976. In vivo electroporations were carried out with this construct, pGL3-b6500, and compared to electroporations done with equimolar concentrations of pGL3-b530. As shown in Figure 6, pGL3-b6500 expression was only 7% of pGL3-b530. These results were similar to pGL3-b1976, which had only 3% the expression of pGL3-b530 (Fig. 5), suggesting that additional 5' sequences may be involved in the control of GGT promoter IV.



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 6. In vivo electroporation of pGL3-b6500. Equimolar concentrations of either pGL3-b530 or pGL3-b6500 were coinjected with pRL-SV40 and electroporated into the proximal half of the initial segment. Dual luciferase assays were performed 24 h after electroporation. Results are expressed as the ratio of FLU to RLU. Each promoter construct was tested in four rats and expressed as the FLU-to-RLU ratio ± SEM. The mean ratio difference between pGL3-b530 and pGL3-b6500 is statistically significant (P < 0.0001) as assessed by an unpaired, two-tailed t-test


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this paper, studies were done to show that an in vivo electroporation is an effective way to study promoters in the rodent epididymis, particularly in the initial segment, which is unique in its dependence on LTFs for normal gene expression and function. Control experiments using a plasmid encoding EGFP under the control of the CMV promoter showed expression targeted to the epithelial cells in the initial segment (Fig. 2B). These control experiments also showed that GGT promoter IV could target protein expression to the epithelial cells where this promoter is normally expressed regardless of the method of DNA injection (intraluminal vs. interstitial; Fig. 2, C and D). The in vivo electroporation method was then used to evaluate two previously characterized initial segment specific gene promoters: the cres promoter and GGT promoter IV.

Analysis of the cres promoter had been carried out previously in LTß2 gonadotroph cells, which normally express cres [11]. The transcriptional activity of the 135-bp minimal promoter was dependent on two C/EBP DNA-binding sites found within this sequence. The same promoter was used in this study. Although the promoter is derived from the mouse sequence, the rat promoter is similar to the mouse, and the expression of cres is restricted to the rat initial segment as it is in the mouse (unpublished observations). In this study, only the 5' C/EBP element in the cres promoter was necessary for promoter activity in vivo in the initial segment, suggesting that only the 5' site may be necessary for the activity of this promoter in vivo (Fig. 3A). In addition, there may be differences in the transcriptional control of the cres promoter in the anterior pituitary compared to the initial segment that are revealed by these in vivo studies.

Substantial differences were observed when GGT promoter IV was analyzed in vivo. In primary cell cultures of initial segment epithelial cells, cotransfection of PEA3 with the various GGT promoter IV constructs was able to activate a promoter truncated at –135 bp [12]. In vivo, the 135-bp construct had some transcriptional activity, which was equivalent to expression from the longer pGL3-b250 construct. However, the activity of both pGL3-b135 and pGL3-b250 was approximately 10% of that observed when the promoter was extended to –530 bp (Fig. 4), indicating the presence of a site or sites between –250 and –530 bp that result in increased transcriptional activity. Three consensus PEA3 sites are found within this region (Fig. 1B). When the core GGAA was mutated within any one of these sites, promoter activity decreased to approximately 10% of that seen with pGL3-b530, suggesting that all three of these sites are necessary for the increased activity seen with pGL3-b530 (Fig. 5). A control mutation made in a similar site within this region had no effect on promoter activity. These studies are in agreement with previous data from electrophoretic mobility shift assays that showed a protein from initial segment nuclear extracts bound an oligonucleotide containing the PEA3 site at –399 to –394 bp [21]. Binding of this protein was blocked when a PEA3 monoclonal antibody was added to the extracts [21]. Of particular interest is the fact that all three PEA3 sites appear to be necessary for pGL3-b530LUC activity, suggesting a coordinated regulation of this construct through these sites. This pattern of PEA3 DNA-binding sites appears to be unique to GGT promoter IV. PEA3 DNA-binding sites have been demonstrated to play roles in the regulation of urokinase plasminogen activator, matrix metalloproteinase 1, and gelatinase B promoters [2224]. However, in these promoters, PEA3 acts in conjunction with adjacent AP-1 sites. Interestingly, there is an AP-1 site in the b135 construct, which, when mutated, has no effect on transcriptional activity (data not shown). Future studies are aimed at identifying which of the PEA3 family members binds to these sites and the stoichiometry of binding. Variable binding to these sites may play a role in the regulation of the level of GGT mRNA IV expression.

When GGT promoter IV was extended to –681 and –903 bp, a 79% and 95% decrease in promoter activity was observed, respectively, suggesting the presence of one or more negative cis-regulatory elements within this region (Fig. 4). However, when the sequence between –530 and –681 bp was cloned in front of the SV40 promoter of pGL3-control, no change in transcriptional activity of the SV40 promoter was observed (data not shown), suggesting that this sequence does not act as a general repressor. The action of this repressor sequence may be context dependent. For example, the PEA3 sites between –250 and –530 bp may be necessary for repressor activity. Analysis of the sequence between –530 and –903 bp reveals a highly AT-rich region. Some homeodomain proteins, which bind to AT-rich sequences, act as repressors of transcription. The homeodomain protein, Nkx3.1, represses the activity of the prostate-derived Ets factor (PDEF), another Ets family member, on the prostate-specific antigen promoter in prostate cells [25]. Several other potential transcription factor binding sites are found within this region, including two GATA-1 sites. GATA-1 can interact with Ets family member, PU.1, and interfere with its ability to transactivate myeloid target genes [26]. Alternatively, these experiments raise the possibility that perhaps structural hindrance from the increasing size of the promoter rather than a repressor may be the cause of the decreased transcriptional activity. This idea is reinforced by the results obtained with pGL3-b6500 (Fig. 6) and raises the question about what happens to this region in vivo when this sequence is found in the context of chromosomal DNA, which is affected by the regulation of chromatin condensation and unwinding. Future studies are aimed at elucidating the mechanism for the decreased transcriptional activity observed with the sequences upstream of –530 bp.

When the 2-kb promoter sequence was used to assay for promoter activity in the in vivo electroporations, minimal expression was observed compared to pGL3-b530, which suggested that perhaps the entire promoter sequence had not been identified (Fig. 4). In an attempt to analyze more 5' promoter sequence, an additional construct was made that contained 4.5 kb of sequence 5' to the 2 kb previously cloned [12]. When this construct was used for in vivo electroporations, no additional promoter activity was observed (Fig. 6). One explanation for these results may be that pGL3-b6500 does not represent the entire promoter sequence. Approximately 10 kb of genomic DNA sequence exist between GGT 5' UTR exon V and the transcriptional start site for GGT mRNA IV. These experiments examined the effects of only 6.5 kb of this sequence. Another explanation for these results may be the existence of additional cis-acting regulatory elements upstream of the GGT gene locus, such as an enhancer or locus control region (LCR). These elements would not be identified by these in vivo electroporation studies. LCRs are functionally characterized as DNA sequences that allow for copy number-dependent expression of transgenes in mice regardless of the chromosomal integration site [27]. LCRs have been described for groups of genes that are coordinately regulated, such as the ß-globin gene locus [27], the human growth hormone (hGH) locus [28], and the red and green cone pigment gene locus [29]. Indeed, analysis of the other GGT promoters revealed similar results to those depicted in Figure 3 [19, 3033], suggesting that additional sequences may be necessary for correct expression from the GGT locus. Possibly, these upstream sequences control the general expression from the GGT locus, whereas cell type-specific regulation comes from cis-regulatory elements present within the promoters themselves. Finally, structural hindrance from the increased sequence length as mentioned in the previous paragraph may also be contributing to the decreased expression seen with pGL3-b6500.

One of the most exciting benefits of the in vivo electroporation method for studying initial segment gene expression is the ability to assess the effects of LTFs on initial segment promoter activity by comparing results from experiments done either in the presence or absence of LTFs (±EDL). This type of experiment would allow one to determine if there were additional sites in the promoter sequence that are sensitive to the effects of LTFs. Studies are currently being performed to address these issues.

In conclusion, this report highlights the benefits of using in vivo electroporation as a method to analyze promoters in the rodent epididymis, in particular the initial segment, which is highly dependent on LTFs for the expression of multiple genes. The results of the experiments presented here demonstrate substantial differences compared with results obtained by in vitro cell culture methods [11, 12], emphasizing the importance of evaluating these genes in their native environment. However, this method could be adapted for use in any tissue that can be easily manipulated, and it offers the advantage of testing promoters in the intact tissue rather than cell culture.


    ACKNOWLEDGMENTS
 
The authors acknowledge helpful insight provided by Drs. D. Brautigan, R. Ogle, A. Sutherland, and T. Turner. We would also like to thank the anonymous reviewer who provided the alternative hypothesis that structural hindrance may be acting to decrease transcriptional activity in the longer promoter constructs. We thank Dr. Y. Laperche for kindly providing the {lambda} phage clone-containing genomic GGT sequence.


    FOOTNOTES
 
1 Supported by NIH grants HD32979 to B.T.H. and HD33903 to G.A.C. J.L.K. is supported by a grant from the Medical Scientist Training Program (NIH grant 2T32 GM07267). Back

2 Correspondence: Barry T. Hinton, P.O. Box 800732, University of Virginia Health System, Charlottesville, VA 22908. FAX: 434 982 3912; bth7c{at}virginia.edu Back

Received: 21 November 2003.

First decision: 8 December 2003.

Accepted: 9 April 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Araki Y, Suzuki K, Matusik RJ, Obinata M, Orgebin-Crist MC. Immortalized epididymal cell lines from transgenic mice overexpressing temperature-sensitive simian virus 40 large T-antigen gene. J Androl 2002 23:854-869[Abstract/Free Full Text]
  2. Sipila P, Shariatmadari R, Huhtaniemi IT, Poutanen M. Immortalization of epididymal epithelium in transgenic mice expressing simian virus 40 T antigen: characterization of cell lines and regulation of the polyoma enhancer activator 3. Endocrinology 2004 145:437-446[Abstract/Free Full Text]
  3. Telgmann R, Brosens JJ, Kappler-Hanno K, Ivell R, Kirchhoff C. Epididymal epithelium immortalized by simian virus 40 large T antigen: a model to study epididymal gene expression. Mol Hum Reprod 2001 7:935-945[Abstract/Free Full Text]
  4. Lan ZJ, Labus JC, Hinton BT. Regulation of gamma-glutamyl transpeptidase catalytic activity and protein level in the initial segment of the rat epididymis by testicular factors: role of basic fibroblast growth factor. Biol Reprod 1998 58:197-206[Abstract/Free Full Text]
  5. Kirby JL, Yang L, Labus JC, Hinton BT. Characterization of fibroblast growth factor receptors expressed in principal cells in the initial segment of the rat epididymis. Biol Reprod 2003 68:2314-2321[Abstract/Free Full Text]
  6. Cornwall GA, Lareyre JJ, Matusik RJ, Hinton BT, Orgebin-Crist M-C. Gene expression and epididymal function. In: Robaire B, Hinton BT (eds.), The Epididymis: From Molecules to Clinical Practice. New York: Plenum Publishers; 2002:169–199
  7. Bigey P, Bureau MF, Scherman D. In vivo plasmid DNA electrotransfer. Curr Opin Biotechnol 2002 13:443-447[CrossRef][Medline]
  8. Matsuda T, Cepko CL. Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proc Natl Acad Sci U S A 2004 101 16-22
  9. Trezise AE, Palazon L, Davies WL, Colledge WH. In vivo gene expression: DNA electrotransfer. Curr Opin Mol Ther 2003 5:397-404[Medline]
  10. Bertrand A, Ngo-Muller V, Hentzen D, Concordet JP, Daegelen D, Tuil D. Muscle electrotransfer as a tool for studying muscle fiber-specific and nerve-dependent activity of promoters. Am J Physiol Cell Physiol 2003 285:C1071-C1081[Abstract/Free Full Text]
  11. Hsia N, Cornwall GA. CCAAT/enhancer binding protein ß regulates expression of the cystatin-related epididymal spermatogenic (Cres) gene. Biol Reprod 2001 65:1452-1461[Abstract/Free Full Text]
  12. Lan ZJ, Lye RJ, Holic N, Labus JC, Hinton BT. Involvement of polyomavirus enhancer activator 3 in the regulation of expression of gamma-glutamyl transpeptidase messenger ribonucleic acid-IV in the rat epididymis. Biol Reprod 1999 60:664-673[Abstract/Free Full Text]
  13. Cornwall GA, Orgebin-Crist MC, Hann SR. The CRES gene: a unique testis-regulated gene related to the cystatin family is highly restricted in its expression to the proximal region of the mouse epididymis. Mol Endocrinol 1992 6:1653-1664[Abstract]
  14. Cornwall GA, Hann SR. Transient appearance of CRES protein during spermatogenesis and caput epididymal sperm maturation. Mol Reprod Dev 1995 41:37-46[CrossRef][Medline]
  15. Sutton HG, Fusco A, Cornwall GA. Cystatin-related epididymal spermatogenic protein colocalizes with luteinizing hormone-beta protein in mouse anterior pituitary gonadotropes. Endocrinology 1999 140: : 2721-2732[Abstract/Free Full Text]
  16. Chikhi N, Holic N, Guellaen G, Laperche Y. Gamma-glutamyl transpeptidase gene organization and expression: a comparative analysis in rat, mouse, pig and human species. Comp Biochem Physiol B Biochem Mol Biol 1999 122:367-380[CrossRef][Medline]
  17. Palladino MA, Laperche Y, Hinton BT. Multiple forms of gamma-glutamyl transpeptidase messenger ribonucleic acid are expressed in the adult rat testis and epididymis. Biol Reprod 1994 50:320-328[Abstract]
  18. Palladino MA, Hinton BT. Expression of multiple {gamma}-glutamyl transpeptidase messenger ribonucleic acid transcripts in the adult rat epididymis is differentially regulated by androgens and testicular factors in a region-specific manner. Endocrinology 1994 135:1146-1156[Abstract]
  19. Nomura S, Lahuna O, Suzuki T, Brouillet A, Chobert MN, Laperche Y. A specific distal promoter controls {gamma}-glutamyl transpeptidase gene expression in undifferentiated rat transformed liver cells. Biochem J 1997 326:pt 2311-320
  20. Reid BL, Cleland KW. The structure and function of the epididymis: histology of the rat epididymis. Aust J Zool 1957 5:223-246[CrossRef]
  21. Lan ZJ, Palladino MA, Rudolph DB, Labus JC, Hinton BT. Identification, expression, and regulation of the transcriptional factor polyomavirus enhancer activator 3, and its putative role in regulating the expression of gamma-glutamyl transpeptidase mRNA-IV in the rat epididymis. Biol Reprod 1997 57:186-193[Abstract]
  22. Lengyel E, Klostergaard J, Boyd D. Stimulation of urokinase expression by TNF-alpha requires the activation of binding sites for the AP-1 and PEA3 transcription factors. Biochim Biophys Acta 1995 1268: : 65-72[Medline]
  23. Gum R, Lengyel E, Juarez J, Chen JH, Sato H, Seiki M, Boyd D. Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ ets and AP-1 sequences. J Biol Chem 1996 271:10672-10680[Abstract/Free Full Text]
  24. Newberry EP, Willis D, Latifi T, Boudreaux JM, Towler DA. Fibroblast growth factor receptor signaling activates the human interstitial collagenase promoter via the bipartite Ets-AP1 element. Mol Endocrinol 1997 11:1129-1144[Abstract/Free Full Text]
  25. Chen H, Nandi AK, Li X, Bieberich CJ. NKX-3.1 interacts with prostate-derived Ets factor and regulates the activity of the PSA promoter. Cancer Res 2002 62:338-340[Abstract/Free Full Text]
  26. Zhang P, Behre G, Pan J, Iwama A, Wara-Aswapati N, Radomska HS, Auron PE, Tenen DG, Sun Z. Negative cross-talk between hematopoietic regulators: GATA proteins repress PU.1. Proc Natl Acad Sci U S A 1999 96:8705-8710[Abstract/Free Full Text]
  27. Grosveld F, van Assendelft GB, Greaves DR, Kollias G. Position-independent, high-level expression of the human ß-globin gene in transgenic mice. Cell 1987 51:975-985[CrossRef][Medline]
  28. Jones BK, Monks BR, Liebhaber SA, Cooke NE. The human growth hormone gene is regulated by a multicomponent locus control region. Mol Cell Biol 1995 15:7010-7021[Abstract]
  29. Wang Y, Macke JP, Merbs SL, Zack DJ, Klaunberg B, Bennett J, Gearhart J, Nathans J. A locus control region adjacent to the human red and green visual pigment genes. Neuron 1992 9:429-440[CrossRef][Medline]
  30. Brouillet A, Darbouy M, Okamoto T, Chobert MN, Lahuna O, Garlatti M, Goodspeed D, Laperche Y. Functional characterization of the rat {gamma}-glutamyl transpeptidase promoter that is expressed and regulated in the liver and hepatoma cells. J Biol Chem 1994 269:14878-14884[Abstract/Free Full Text]
  31. Kurauchi O, Lahuna O, Darbouy M, Aggerbeck M, Chobert MN, Laperche Y. Organization of the 5' end of the rat {gamma}-glutamyl transpeptidase gene: structure of a promoter active in the kidney. Biochemistry 1991 30:1618-1623[CrossRef][Medline]
  32. Lahuna O, Brouillet A, Chobert MN, Darbouy M, Okamoto T, Laperche Y. Identification of a second promoter which drives the expression of {gamma}-glutamyl transpeptidase in rat kidney and epididymis. Biochemistry 1992 31:9190-9196[CrossRef][Medline]
  33. Okamoto T, Darbouy M, Brouillet A, Lahuna O, Chobert MN, Laperche Y. Expression of the rat g-glutamyl transpeptidase gene from a specific promoter in the small intestine and in hepatoma cells. Biochemistry 1994 33:11536-11543[CrossRef][Medline]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
W. R. Lagor, R. Heller, E. D. De Groh, and G. C. Ness
Functional Analysis of the Hepatic HMG-CoA Reductase Promoter by In Vivo Electroporation
Experimental Biology and Medicine, March 1, 2007; 232(3): 353 - 361.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. Yang, S. A. Fox, J. L. Kirby, B. V. Troan, and B. T. Hinton
Putative Regulation of Expression of Members of the Ets Variant 4 Transcription Factor Family and Their Downstream Targets in the Rat Epididymis
Biol Reprod, April 1, 2006; 74(4): 714 - 720.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
E. V. Zubkova and B. Robaire
Editorial Commentary
J Androl, September 1, 2005; 26(5): 638 - 640.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/2/613    most recent
biolreprod.103.025635v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.
Agricola
Right arrow Articles by Kirby, J. L.
Right arrow Articles by Hinton, B. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS