| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Pituitary |
Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore 560012, India
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
T3-1 and NIH3T3 cells, but not in HEK 293 cells, suggesting the involvement of a cell-specific factor or mechanism. The presence of a 3'UTR did not influence reporter mRNA stability, but it did decrease its association with polysomes, indicating that the downregulatory effect may be exerted at the translational level. The segment spanning 601–800 bases (U4) of the bovine FSHß 3'UTR was found to be the most effective downregulating segment, its effect being equal to that of the full-length 3'UTR. RNA electrophoretic mobility shift assay with U4 showed the presence of specific transfactors in the cytosolic preparations of bovine pituitary and the cell lines. U4 contained an ARE that appeared to be functional, because the mutated U4 ARE was ineffective in downregulating the reporter expression and inhibiting [32P]-labeled U4-transfactor complex formation. Downregulation of reporter activity by the full-length 3'UTR and U4 could be overcome by overexpression of HuR, a protein known to stabilize ARE-containing mRNAs in NIH3T3 cells, but not in the T3-1 cells, once again indicating that factors other than HuR may also be involved in the regulation of FSHß in the pituitary.
anterior pituitary, follicle-stimulating hormone, gene regulation, pituitary, pituitary hormones
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
subunit noncovalently associated with the hormone-specific ß subunit. Among these, LH, FSH, and TSH are secreted by the pituitary gland, whereas hCG is secreted by the placenta during pregnancy. Glycoprotein hormone expression in the pituitary is an intricate process governed by factors from the hypothalamus, gonads, and the pituitary itself. Under physiological conditions, FSHß mRNA is known to be regulated by GnRH; by steroid hormones such as testosterone and estradiol; and by polypeptide hormones such as activin, inhibin, and follistatin, probably at both transcriptional and posttranscriptional levels [1–3]. Details of such molecular mechanisms are not clearly understood, mainly due to the unavailability of cell lines that express FSH and due to the disparity in regulation of FSH expression between rodents and higher primates [4, 5]. It is interesting that among the gonadotropin hormone subunits, only FSHß mRNA contains an unusually long 3' untranslated region (3'UTR) [6]. This unique 3'UTR is conserved across species, with a high level of sequence identity. The 3'UTRs of many mRNAs, especially those of the early responsive genes (ERGs), are involved in posttranscriptional regulation. Translational control, mRNA instability, and localization are the diverse mechanisms by which 3'UTRs are known to exert their posttranscriptional function in a cis-trans fashion. The cis factors could be the elements or stable stem-loop structures (or both) that might be repositories for one or more transacting proteins [7–9]. AU-rich elements (AREs) present in 3'UTRs of ERGs that have been implicated in posttranscriptional regulatory processes, such as mRNA stability and translatability, are some examples of such cis elements. HuR, an hnRNP belonging to the Hu family of proteins, AUF1 and tristetraprolin, are some of the known transfactors that interact with AREs in a context- (with respect to the mRNA) and cell type-specific manner [10–12].
FSHß mRNA also has a long 3'UTR that is absent in other members of the glycoprotein family. However, the significance of this very long FSHß 3'UTR in the regulation of hormone subunit expression is not known. In the present study, using human growth hormone (hGH) as a reporter, we demonstrate that FSHß 3'UTR downregulates its expression in a cell-specific manner. The presence of the 3'UTR decreased polysome association of the mRNA transcripts, suggesting a translation control. We also identify several AREs in the FSHß 3'UTR and show their importance in the reporter expression. The region of 601–800 bases of the 3'UTR (U4) harboring one ARE retains most of this downregulating activity. We also show that putative transfactors interact specifically at the U4 ARE. Furthermore, an ARE binding protein, HuR, is functionally effective in a cell type-specific manner, highlighting the role of transfactors in the regulation of expression by the bovine FSHß 3'UTR.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Sequences encoding mouse, rat, ovine, bovine, and human FSHß were retrieved from GenBank and alignments were carried out using ClustalW, BOXSHADE, and BLAST tools (http://www.ch.embnet.org/).
Expression Constructs and Mutant Generation
The bovine FSHß (bFSHß) cDNA used in this study was isolated as described earlier [13]. The effect of FSHß 3'UTR on gene expression was investigated by studying its effect on reporter (hGH) expression. In preliminary experiments, the effect of the UTR on FSHß expression itself was investigated. However, FSHß expression using a mammalian expression vector (pcDNA3; Invitrogen, Carlsbad, CA) was so low that it was necessary to use another reporter that yielded consistently high expression in the cells used in this study, and therefore, hGH was used as the reporter. The hGH cDNA with the cognate signal peptide was amplified via polymerase chain reaction (PCR) using human pituitary cDNA as a template (Clontech, Palo Alto, CA) and cloned into pcDNA3 to generate the construct phGH. The 1294-base pair (bp)-long 3'UTR of FSHß was obtained by PCR amplification using the bFSHß cDNA as the template and then cloned into phGH downstream of hGH cDNA to obtain FLUTR (hGH + bFSHß 3'UTR). The bFSHß 3'UTR was further fragmented into five segments of 200 bases each (sequentially designated as U1 to U5), and the last segment of 294 bases (U6) was obtained by PCR amplification and then cloned into hGH downstream of the hGH cassette (U1–U6). Mutation in the U4 ARE (U4M) was generated using overlapping PCR mutagenesis [14].
Cells and Transfections
The T3-1 [2], NIH3T3, and HEK 293 cells were maintained in Dulbecco modified Eagle medium (DMEM) and supplemented with 10% fetal bovine serum (Invitrogen), 100 units/ml penicillin, and 100 µg/ml streptomycin. Approximately 50 000 cells/well were plated in 24-well plates, and transient transfections were carried out using 2 µl of Geneporter (Gene Therapy Systems, San Diego, CA) with 1.5 µg of DNA expression construct and 0.2 µg of DNA luciferase construct, pGL3Basic (Promega, Madison, WI) for normalization using the manufacturer's protocol. Transfections were carried out in triplicate and each experiment was repeated at least three times. Values (nanograms of hGH/RLU) reported in all graphs are the mean ± SD of triplicates of one typical experiment.
Human Growth Hormone Radioimmunoassay and Luciferase Assay
The transfections were terminated after 72 h, and hGH secreted into the medium was assayed by specific RIA using an hGH RIA kit obtained from Dr. A.F. Parlow (National Hormone and Pituitary Program, Torrance, CA). Luciferase activity in the cell lysate was determined using the Promega kit according to the manufacturer's instructions, and was used to normalize hGH secreted into the medium.
RNA Isolation and Real-Time Reverse Transcription-PCR
The NIH3T3 and T3-1 cells were grown to 80% confluency in DMEM with 10% fetal calf serum in 6-well plates and transfected with phGH and FLUTR as described above. After 24 h of recovery, the cells were treated with 10 µg/ml actinomycin D (Sigma, St. Louis, MO) for 0, 3, and 6 h. Total RNA was isolated using TRIzol reagent (Sigma) according to the manufacturer's instructions, and its integrity was ascertained on 1% agarose-formaldehyde gel. One microgram of total RNA was reverse transcribed using Moloney murine leukemia virus reverse transcriptase (RT) (Promega) and random hexamers as the primers in a standard 20-µl reaction. One microliter of the RT product was further used as template for the real-time PCR reaction containing 1x SYBR Green I (Roche Biomedicals, Germany) and primers FP (5'CCGAATTCCCAACCATTCCCTTA3') and RP (5'CCCGCCGGCG CTAGAAGCCACAGCTGCC3'), which allowed amplification of a 531-bp nucleotide fragment of hGH. As an internal control, a 125-bp fragment of cyclophilin using primers FP (5'TTCACCTTCCCAAAGACCAC3') and RP (5'GCATACAGGTCCTGGCATCT3') was also amplified. Both amplifications were carried out in triplicate for each RT product. No-RT control and no-template control were also included. Relative real-time quantifications were carried out on an Opticon2 system (MJ Research, Waltham, MA). Fluorescence threshold values (Ct) were calculated using the manufacturer's software.
Polysome Isolation
Polysome association experiments were performed using the protocol as described [12] with some modifications. Briefly, the transfected cells were lysed in 200 µl of polysome lysis buffer (10 mM N-morpholino propanesulfonic acid pH 7.2, 250 mM NaCl, 2.5 mM MgOAc, 0.5% Nonidet P-40, 0.1 mM phenylmethylsulfonyl fluoride, 200 µg/ml heparin, and 50 µg/ml cycloheximide). The nuclei and cell debris were removed by centrifugation at 12 000 x g for 10 min at 4°C. The polysomes in the supernatant were pelleted by ultracentrifugation at 100 000 x g for 1 h in a 75 Ti rotor (Beckman) at 4°C and resuspended in 200 µl of polysomal buffer. Total RNA was extracted and quantified by real-time PCR analysis as described above.
Cytoplasmic Protein Preparation and Western Blot Analysis
Cytosolic preparation from bovine pituitaries (obtained from a local slaughterhouse) and cultured cells was prepared as follows. The minced bovine pituitaries or cultured cells were suspended in 5 volumes of buffer containing 10 mM Hepes, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol (DTT), and 0.5 mM phenyl methyl sulfonyl fluoride; incubated on ice for 10 min; and homogenized using a Polytron Homogenizer (Brinkmann Instruments). The homogenate was centrifuged at 12 000 x g for 1 h at 4°C and the supernatants (SK12) were immediately frozen at –70°C in aliquots. Protein concentration was determined by the Bradford method.
Western blot analysis of the total cell lysate was carried out using the anti-HuR monoclonal antibody 3A2 [15].
In Vitro Transcription, RNA Electrophoretic Mobility Gel Shift Assay, UV Cross-linking Assay, and Northwestern Blotting
RNA probes labeled with [32P] were generated using an in vitro transcription kit (Promega) with the PCR-amplified U4 fragment as the template. This U4 fragment was generated using the forward primers containing the T7 promoter sequence. The probes were purified by electrophoresis on 6% polyacrylamide gel and extracted in RNase-free water containing 0.1% SDS. The specific activity of the probe was approximately 1.5 x 104 cpm/ng RNA. Labeled RNA probes (15 000 cpm) were incubated with S12k bovine pituitary extracts (approximately 6 µg of protein) in 20 µl of binding buffer containing 1 µg tRNA, 5 mg/ml heparin, 10 mM Hepes pH 7.4, 1 mM DTT, 3 mM MgCl2, 40 mM KCl, 5% glycerol, and 4 units of RNasin (Promega) for 10 min at 4°C. The samples were electrophoresed on a 6% polyacrylamide gel (acrylamide:bisacrylamide 40:1) for 3 h at 150 V at room temperature. The gels were dried and autoradiographed using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). For the UV cross-linking experiment, 6 µg of bovine pituitary cytosolic extract was incubated with 2 x 105 cpm of [32P]-labeled U4 transcript in the binding buffer and exposed to short-wave UV radiation at a distance of 10 cm from the UV source on ice for 15 min. RNase A (20 µg/20 µl) digestion of the resulting complex was carried out at 37°C, and the entire reaction was resolved in a 15% SDS-PAGE. The gel was dried and autoradiography was performed using a PhosphorImager. For Northwestern blotting, purified GST-HuR was electrophoresed on 15% SDS-PAGE, transferred to polyvinylidene difluoride membranes, and allowed to renature by incubation in 10–15 ml of D67NP-40 solution (65% v/v D-Base [100 mM KCl, 0.2 mM K-EDTA pH 8.0], 6.7 mM Tris-EDTA-acetate pH 7.9, 170 mM DTT, and 0.05% NP-40) for 1 h at room temperature. The nonspecific protein and nucleic acid binding sites were blocked by adding 5% heparin and 20 µg/ml of yeast tRNA. [32P]-labeled U4 transcript was added and incubated for an additional 1 h at 30°C. The membranes were washed in D67NP-40 solution and exposed directly to Kodak x-ray film for 1–40 h at room temperature.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Sequence alignment of FSHß 3'UTRs across mouse, rat, bovine, ovine, and human species showed substantial conservation (Fig. 1). While regions of the mouse and rat 3'UTR sequences have similarity to other species, large areas do not; notably, the rat 3'UTR is not as long as the others. The sequence identity between bovine and ovine 3'UTRs was as high as 94% and between bovine and human 3'UTRs it was 87%. The 3'UTR also showed the presence of elements that are implicated in posttranscriptional regulation such as the AREs, which are involved in mRNA instability and translation regulation. The bFSHß 3'UTR shows the presence of six AREs (AUUUA) and one extended ARE (AUUUUUUA) that were located throughout the 3'UTR, suggesting bFSHß 3'UTR to be a type I ARE [10, 11]. The FSHß 3'UTR also showed the presence of four cytidine-rich 15-lipoxygenase differentiation control elements (15-LOX DICE) involved in mRNA translational control [9]. AREs were, interestingly, found in the mouse 3'UTR, whereas none were found in the rat UTR.
|
Bovine FSHß 3'UTR Downregulates Reporter Activity in the T3-1 and NIH3T3 Cell Lines, but Not in HEK 293 Cells
To determine whether the FSHß 3'UTR affected expression of the reporter (hGH), mouse pituitary (T3-1), mouse fibroblast (NIH3T3), and human epithelial (HEK 293) cell lines were transfected with the reporter constructs with and without the bFSHß 3'UTR, hGH secreted into the medium was assayed by RIA and was normalized for transfection efficiencies using luciferase activity. As shown in Figure 2, the presence of the FSHß 3'UTR decreased hGH secretion into the medium in the T3-1 and NIH3T3 cell lines, but not in HEK 293 cells, indicating that the bFSHß 3'UTR affected reporter expression in a cell type-specific manner.
|
Bovine FSHß 3'UTR Does Not Affect Decay of the Reporter mRNA
Whether the downregulatory effect of the 3'UTR on reporter expression was due to altered mRNA stability was investigated by determining the reporter mRNA decay. The T3-1 and NIH3T3 cell lines were transfected with the reporter constructs with and without the bFSHß 3'UTR. Twenty-four hours after the transfection, the cells were treated with actinomycin D to arrest transcription, and the total RNA isolated after 0, 3, and 6 h was subjected to relative mRNA quantification using real-time PCR analysis. As shown in Figure 3, there was no significant difference between the reporter mRNA levels with and without the bFSHß 3'UTR following actinomycin D treatment, suggesting that the stability of the reporter mRNA was unaltered when fused with the bFSHß 3'UTR, and therefore, a decrease in the reporter expression in the presence of the 3'UTR probably occurred at the posttranscriptional level.
|
Bovine FSHß 3'UTR Decreases Polysome Association of the Reporter mRNA
Efficiency of translation of specific mRNAs can be compared by determining the relative amounts of mRNA associated with the polysomal fraction that contains the translationally active mRNAs bound to more than one 80S ribosome [12]. In order to determine whether the 3'UTR affected translation of the reporter, the cells transfected with the reporter constructs with and without the 3'UTR were subjected to polysome isolation by ultracentrifugation in the presence of cycloheximide as described in Materials and Methods, and the steady-state levels of polysome-associated reporter mRNA were determined by real-time PCR. Cyclophilin mRNA levels in these polysome preparations determined in the same way served as internal controls. Representative data from two different experiments with both T3-1 and NIH3T3 cells are shown in Figure 3. In the presence of 3'UTR, there was a decrease in the association of the reporter mRNA with the polysomes compared with the reporter alone, indicating a possible translational control exerted by the bFSHß 3'UTR on the reporter expression.
The Region of 601–800 Bases Retains Most of the 3'UTR Effect
To identify the region within bFSHß 3'UTR that was responsible for the downregulatory effect on growth hormone expression, the 3'UTR was divided into five segments of 200 nucleotides each (U1–U5) and 294 nucleotides (U6) from the 5' end, and fused individually to the reporter. As shown in Figure 4, the segment U4 (600–800 bases) was as effective as the full-length 3'UTR in decreasing hGH expression in the T3-1 cell line. Segments U1, U2, U3, and U5 were partially effective in reducing the expression. No effect was observed with U6. Similar results were obtained with NIH3T3 cells (data not shown).
|
Specific Factors Interact with U4
Functionality of a 3'UTR in many cases is brought about by specific proteins that bind one or more specific regions within the 3'UTR. To explore the possibility of U4 interacting with specific transfactors, [32P]-labeled U4 probe synthesized by in vitro transcription was gel-purified and incubated with cytosolic extracts prepared from bovine pituitaries and cell lines in the presence of nonspecific competitors such as tRNA and heparin. The resulting complexes were resolved on a 6% native polyacrylamide gel. As shown in Figure 5A, there was a clear shift in the electrophoretic mobility of the [32P] probe in the presence of the cytosolic extracts. The complex formation could be inhibited by 400-fold molar excess of unlabeled U4 transcript, demonstrating the specificity of the interaction and further confirming the presence of one or more specific proteins interacting with U4 in the extracts. A UV cross-linking experiment showed the molecular masses of the putative transfactors present in the bovine pituitary extracts to be between 30 and 40 kDa (Fig. 5B).
|
U4 ARE Is Important for Transfactor Interaction and for the Downregulatory Effect of U4
Because U4 harbors one ARE (AUUUA), we next investigated whether the putative transfactors interacted with the ARE of U4. The U4 ARE was mutated from AUUUA to AUGUA by site-directed mutagenesis and the modified U4 (U4M) was fused to hGH cDNA and was used as a template to produce unlabeled U4M transcript, which was then used in the competition experiment. As shown in Figure 6A, U4M transcript was unable to compete with U4 to bind to the putative transfactors, indicating these factors interacted with ARE in the U4. In transient transfection experiments, U4M was unable to affect the reporter expression, further confirming the functionality of ARE present in U4 (Fig. 6B).
|
Role of the hnRNP HuR in Regulation of Expression by bFSHß 3'UTR
Having demonstrated the functionality of U4 ARE, it was of interest to investigate whether any known ARE binding proteins would bind this element specifically and would be able to overcome its downregulating effect. As shown in Figure 7, recombinant HuR, a well-characterized ARE-binding protein, could specifically bind [32P]-labeled U4 as shown by RNA electrophoretic mobility gel shift assay (REMSA) analysis, as well as by Northwestern blotting. Although HuR is known to be ubiquitously expressed, there were significant differences in its levels in different cell lines. Western blot analysis revealed that endogenous HuR levels were undetectable in the T3-1 cell, very low in NIH3T3 cells, and extremely high in HEK 293 cells (Fig. 8A). Lack of a downregulatory effect of FLUTR seen in the HEK 293 cells (Fig. 2) is probably due to this high level of HuR. Overexpression of HuR was able to overcome the downregulatory effect of FLUTR in NIH3T3 cells (Fig. 8B), supporting the functionality of ARE. Intriguingly, similar results were not obtained with T3-1 cells, suggesting that these cells probably have other factors that exert a stronger downregulatory role and overexpression of HuR is unable to overcome their effect (Fig. 8B).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Analysis of FSHß mRNA sequences from five species (Fig. 1) revealed the presence of six canonical AREs, along with several AU-rich sequences such as AUUUAUUUA in the 3'UTR. These AREs can be classified as class I based on their location and distribution in the UTR [10]. The 3'UTR, or its different segments, reduced reporter expression, with the segment U4 harboring one ARE exerting the same effect as the full-length 3'UTR. Intriguingly, other segments having extended AU-rich sequences and other elements such as LOX-DICE were not as effective as U4.
The presence of AREs in the 3'UTR suggested that FSHß expression could be regulated at the mRNA stability level, the translational level, or both [10]. However, lack of differences in the steady-state mRNA levels and in the decay of the reporter mRNA in the presence and absence of the 3'UTR (Fig. 3) indicated that the 3'UTR did not influence the stability of mRNA, which is, perhaps, suggestive of a role at the translational level. Polysome association experiments (Fig. 3) suggested decreased association of the mRNA with ribosomes in the presence of 3'UTR, supporting its role in translational regulation. However, further characterization by polysome profiling is required to ascertain the nature of translational control exerted by the 3'UTR. In vitro translation of hGH mRNA with and without 3'UTR in commercial preparations of rabbit reticulocyte lysate as well as wheat germ extracts did not down-regulate hGH levels (data not shown), suggesting the involvement of cell-specific factors in bringing about the UTR effect. It is well known that such a mechanism of translational repression by other 3'UTRs that are brought about by either interaction with transfactors, or decreased polysome association (or both). Translational regulation of mRNAs through differential association with polyribosomes has been demonstrated for a variety of genes, including cytidine deaminase, insulin-like growth factor I, serine hydroxymethyltransferase, complement factor B, proenkephalin, retinoic acid receptor h-2 mRNA, and many others [8, 10, 12, 16, 17].
The presence of such factors was established by demonstrating specific interaction of U4 with putative transfactors present in the cells and the pituitary. Interaction of [32P] U4 RNA with transfactors was inhibited by unlabeled U4 RNA, but not by mutated U4 ARE (U4M-AUUUA to AUGUA), providing evidence that this is the recognition site for these factors. Further evidence of a role for U4 ARE was provided by the observation that U4M was also unable to downregulate reporter expression. These data suggest an important role for U4 ARE in the bovine FSHß 3'UTR function.
We next investigated whether any of the known ARE-binding proteins are involved in FSHß expression. Factors recognizing these elements, such as HuR and AUF1, are ubiquitously expressed and have been shown to regulate mRNA stability or translatability (or both) of many mRNAs such as GM-CSF, c-MYC, c-JUN, TNF, and others [10, 11]. HuR is generally localized in the nucleus, and under stressful conditions such as overexpression and exposure to UV light, is translocated to the cytoplasm, where it is known to perform its transfunction of providing stability, or enhancing mRNA translatability, or both. Northwestern blot analysis and REMSA showed that HuR binds specifically to the U4 ARE (Fig. 7). Western blot analysis of HuR across cell lines revealed that it was barely detectable in T3-1 cells, low in NIH3T3 cells, and abundant in HEK 293 cells. Immunochemical localization of HuR also confirmed this observation (data not shown). In cotransfection experiments, overexpression of HuR abolished the down-regulatory effect of 3'UTR in NIH3T3 cells (Fig. 8). Higher levels of HuR may be able to overcome the function of the downregulatory factors and hence increase expression of the protein. This is clearly the case in HEK cells, in which with extraordinarily high levels of HuR, the presence of the 3'UTR had no effect on hGH expression. In NIH3T3 cells, with moderate expression of HuR, ARE exhibited its down-regulatory role, which was overcome by HuR overexpression, probably by competing out or displacing the factors that bring about such an effect. However, in T3-1 cells, perhaps a relatively higher abundance of the downregulatory factors may inhibit HuR's ability to affect ARE function despite overexpression of the latter.
Apart from the U4 ARE, other fragments (U3, U5, and U6) also harbor AREs. Many 3'UTRs have multiple AREs. Very recently, it was proposed that AREs can be divided into functionally distinct domains. Using a bipartite domain model, it was suggested that an ARE core domain is mainly responsible for the ARE function, the effect of which is greatly enhanced by an auxiliary domain that might also comprise AREs. Such a modular mechanism was also shown to explain the differential HuR specificities for AU-rich sequences harboring AREs [18, 19]. Therefore, it is possible that U3, U5, or U6 (or a combination of these) also might play important roles in the downregulatory effect exerted by the bovine 3'UTR.
Another level of regulation could be the interaction of transfactors with the secondary structures comprising mainly stem and loops present in the mRNA. In silico secondary structure analyses of bFSHß mRNA showed high propensity to form complex stem-loop structures (
G = –467.06 kcal/mol), compared with mRNAs of other glycoprotein hormone subunits (bovine subunit G = –174.25 kcal/ mol, bLHß G = –183.56 kcal/mol, bTSHß G = –107.51 kcal/mol). The complex stem-loop structures and the high G value of the bFSHß mRNA were mainly contributed by its 3'UTR, which was also present in hGH mRNA fused to the FSHß 3'UTR (G = –532 kcal/mol) (data not shown). Such predicted structures have been shown to affect protein expression, as shown in FSHß expression itself [13], as well as others [12, 20, 21, 22]. The fragments U1, U2, and U3 display complex stem-loop structures in silico, and they also downregulate reporter expression. Hence, in addition to regulation exerted by the ARE, it is probable that the putative structures within the 3'UTR also might contribute to bovine FSHß expression.
The role of the 3'UTR in physiological regulation of FSHß gene expression is not understood. FSHß gene expression is a complex event, and many factors such as GnRH, steroid hormones, activin, and inhibin play roles in this process. In the absence of cell lines that express FSHß, its promoter has not been well characterized [1]. It is also not possible to mimic the precise environment that exists in the pituitary gonadotrophs that may influence FSHß gene expression at the posttranscriptional level. However, it is known that GnRH and activin upregulate transcription of FSHß, while the steroid hormones downregulate it [1]. Levels of ARE binding proteins have been shown, interestingly, to be regulated by steroid hormones in tissue- and cell-specific manners. HuR expression was downregulated by androgens in HEPG2 cells, as well as in the submaxillary gland, while an opposite effect has been reported on AUF1, the mRNA destabilizing ARE-binding protein [23, 24]. Pituitary HuR levels were upregulated in castrated male rats, demonstrating regulation of HuR expression by steroid hormones (data not shown). Thus, apart from the transcriptional regulation of the FSHß gene, the steroid hormones may be regulating the translatability of the message by altering levels of the factors that interact with AREs in the pituitary, thus providing an additional step for FSHß gene expression.
In conclusion, FSHß gene expression is probably governed by the regulation of myriad factors that may play a role at transcriptional and posttranscriptional levels.
|
ACKNOWLEDGMENTS |
|---|
T3-1 cell line; Prof. Joan A. Steitz (HHMI) for the HuR protein, pcDNA HuR construct, and 3A2 monoclonal antibody. The National Hormone and Pituitary Program for supplying hGH RIA reagents is acknowledged. |
FOOTNOTES |
|---|
2 Correspondence. FAX: 91 80 3600999; rdighe{at}mrdg.iisc.ernet.in
Received: 25 March 2004.
First decision: 18 April 2004.
Accepted: 27 May 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  N. H. Ing Steroid Hormones Regulate Gene Expression Posttranscriptionally by Altering the Stabilities of Messenger RNAs Biol Reprod, June 1, 2005; 72(6): 1290 - 1296. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
