|
|
||||||||
Embryo |
Department of Animal Science,3
Department of Computer Science,4
Molecular Biology Program,5
and
Department of Health Management and Informatics,6 University of Missouri-Columbia, Columbia, Missouri 65211
Monsanto Company,7 Chesterfield, Missouri 63017
| ABSTRACT |
|---|
|
|
|---|
embryo, embryogenesis, EST, pig
| INTRODUCTION |
|---|
|
|
|---|
One method for identification of genes that are transcribed at specific stages of tissue development is via sequencing of expressed sequence tags (ESTs). Differential representation of a message in a library can be reflective of actual message levels within a tissue from which the library was derived [9]. Previous reports of EST, bioinformatics, and microarray projects in mouse embryogenesis [10, 11] identified a number of developmentally regulated genes. A complete description of changes in gene expression during embryogenesis would provide insight into the many differentiation and developmental events taking place at this critical time. As a preliminary step toward this goal, we report the results of an EST sequencing project directed toward the identification of novel genes expressed during porcine embryogenesis. Libraries were made from germinal vesicle-stage oocytes and in vitro- and in vivo-produced four-cell- and blastocyst-stage embryos in an attempt to provide a catalog of expressed genes and a preliminary evaluation of gene-expression patterns in the porcine oocyte and early embryo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oocytes were aspirated from ovaries obtained at the slaughterhouse and stripped of their cumulus cells. In vitro-produced four-cell and blastocyst stage embryos were collected on Days 3 and 7, respectively, as described by Abeydeera et al. [12]. In vivo-produced four-cell- and blastocyst-stage embryos were collected on Days 3 and 6, respectively, as described by Anderson et al. [5] except that the embryos were flushed with TL HEPES [13]. Animals were treated in accordance with the Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching as approved by the Institutional Animal Care and Use Committee.
Poly(A) RNA Extraction
Poly(A) RNA from 200 oocytes or 50 embryos was extracted by using a micro poly(A) kit (Ambion) according to the manufacturer's instructions with minor modifications in the protocol. The modified elution buffer consisted of 10 mM Tris (pH 7.5), 1 mM EDTA, and 0.5% SDS heated to 65°C. Due to the low amount of mRNA, the RNA integrity and purity were not verified.
SMART Technology
Due to the small amount of mRNA in oocytes and embryos, a modified SMART PCR cDNA synthesis (Clontech, Palo Alto, CA) was used [14]. The switching mechanism at the 5' end of RNA Transcipt (SMART) system utilizes the terminal transferase (TdT) activity of MMLV reverse transcriptase (RT). A modified oligo dT primes first strand synthesis. When the RT reaches the 5' end of the mRNA, the enzyme's TdT activity adds additional deoxycytidines (dC) to the 3' end of the cDNA. The modified SMART oligo contains a string of deoxyguanidines (dG) at its 3' end. The reverse transcriptase switches templates and continues replicating to the end of the oligonucleotide [15]. This template is then used to amplify the cDNA before ligating into a vector and electroporating into bacteria (Fig. 1).
|
Reverse Transcription and Terminal Transferase of cDNA
Two microliters of mRNA from oocytes or embryos (10 µl total from mRNA purification) was added to 1 µl of each oligo dT primer (specific for each library), 1 µl of the SMART 5' long primer (1 µg/µl: 5' AAGCAGTGGTAACAACGCAGAGTACGAATTCGTCGACGCGGG 3'), 1 µl of RNase inhibitor (SUPERase-In, 20 U/µl; Ambion) and 5 µl of diethyl pyrocarbonate (DEPC)-treated water [14]. This was heated to 70°C for 10 min and cooled to 37°C for 2 min. Preheated RT mix (9 µl: 4 µl 5x first-strand synthesis buffer, 2 µl 0.1 M dithiothreitol, 1 µl 10 mM dNTP, and 2 µl DEPC-treated water) was then added. After 2 min, 1 µl SuperScript II MMLV reverse transcriptase was added and allowed to incubate for 1 h. The reverse transcription was performed by annealing poly(A) RNA with 1 µg of an oligo(dT) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGC(tag)TTTTTTTTTTTTTTTTTTTTTTTT 3', where tag = library-specific six-base sequence identifier) at 37°C. An excessive amount of oligo(dT) primer was used to reduce the number of clones with long poly(A) tails in the cDNA libraries [16].
PCR Amplification of Embryo and Oocyte cDNA
A 50-µl PCR mix was aliquoted on ice with the following reagents: 2 µl 10 mM dNTP (Life Technologies, Inc., Rockville, MD), 2 µl 5' SMART short primer (50 ng/µl; 5' AAGCAGTGGTAACAACGCAGAGTAC 3'), 2 µl 3' PCR library primer (50 ng/µl; 5' GACTAGTTCTAGATCGCGAGCGG 3'), 5 µl 10x cloned Pfu buffer, 2 µl (5 U) Pfu turbo polymerase (Stratagene, La Jolla, CA) and 32 µl DEPC water. PCR amplification was performed with 5 µl of the 20-µl RT reaction as template. A negative control consisted of using 5 µl of water as template. The 5' SMART short primer and 3' PCR library primer were replaced with primers specific for pig ß-actin in a separate reaction for use as a positive control. The PCR conditions consisted of a 95°C initial denaturation for 3 min and 30 cycles of 95°C denaturation for 30 sec, 53°C annealing for 30 sec, and 72°C elongation for 3 min.
The positive and negative controls were run on a 1.25% agarose gel to determine mRNA quality and nonspecific amplification, respectively.
Restriction Digest of PCR-Amplified Library
The PCR-amplified library was phenol:chloroform extracted and precipitated with ethanol and 1 µl pellet paint (Novagen, Madison, WI). The PCR products were restriction digested in 41 µl water, 5 µl React 3 buffer, 2 µl NotI and 2 µl SalI at 37°C for 2 h. The digest was then increased to 100 µl by adding an additional 41 µl water, 5 µl React 10 buffer, 2 µl NotI, and 2 µl SalI and incubated at 37°C for an additional hour. Restriction enzymes were purchased from New England Biolabs (Beverly, MA).
Clean-Up and Sizing of PCR-Amplified Library
The restriction digested PCR-amplified library was cleaned up by using a High Pure PCR product purification kit (Roche, Mannheim, Germany). Following PCR cleanup, reactions were first sized using one Chroma Spin-400 column (Clontech) by following the manufacturer's instructions. After elution from this column, the library was further sized by using a Chroma Spin-1000 column. After size fractionation, the PCR-amplified library was again phenol:chloroform extracted, precipitated, and resuspended in 5 µl of DEPC water.
Ligation of PCR-Amplified Library in pSport and Transformation into DH10B
The PCR-amplified library was ligated into NotI/SalI digested pSPORT1 (Life Technologies, Inc., Rockville, MD) vector. Secondary structure was reduced by incubating 1 µl of the library, 1 µl pSPORT and 13 µl water at 70°C for 3 min. The ligation was quick chilled on ice for 2 min and 4 µl 5x ligase buffer and 1 µl T4 ligase (Life Technologies) were added. The ligation was incubated at 4°C for 16 h. Following ligation, 1 µl of ligation was electroporated into 25 µl of DH10B Electromax competent cells (Life Technologies) in a 1-mm electroporation cuvette at 1.5 KV/5 msec. Transformants were recovered in 1 ml SOC at 37°C for 1 h. Ten and 100 µl of transformants were plated on LB-agar plates supplemented with 50 µg/µl carbenicillin (Sigma, St. Louis, MO). Colonies were counted to determine the number of recombinants for each library.
cDNA Sequencing
Bacteria clones from each library were randomly picked and grown in 96-well plates containing 1.5 ml terrific broth plus 50 µg/ml ampicillin. Plasmid extractions from bacterial culture were performed by using the QIAprep 96 Turbo Miniprep kit (Qiagen). Sequencing reactions were designed to yield 3' sequence by using Sp6 promoter primer and the ABI Prism BigDye Terminator cycle sequencing chemistry (Applied Biosystems, Foster City, CA). The sequencing reactions were analyzed on an ABI 377 automated DNA sequencer (Applied Biosystems). Individual clone names are based on a description of the tissue (oocyte: pgvo; in vitro-produced four-cell stage embryo: p4civp; in vivo-produced four-cell-stage embryo: p4civv; in vitro-produced blastocyst-stage embryo: pblivp; in vivo-produced blastocyst-stage embryo: pblivv) followed by the library number, followed by the plate number, followed by the location within the plate. So pgvo4-011-b01 is a germinal vesicle oocyte, 4th library attempt, 11th plate, and the clone is located in well b01 of this plate.
Quality Assessment of cDNA Libraries
The quality of each cDNA library was first assessed by restriction digestion of 96 randomly picked clones to determine the average insert size and the percentage of clones without inserts. Acceptable libraries were assessed by sequencing 288 randomly picked clones to determine the percentage of clones with long poly(A) tails (long poly[A] tails are designated as poly[A] stretches containing more than 40 adenines) and the percentage of clones with ribosomal RNA inserts or genomic DNA.
Sequence Clustering and Annotation
A 10-stage process is implemented to evaluate the sequence data. 1) The Zip file from the sequencer is validated and extracted. 2) Phred (University of Washington program) determines the quality of each base call and determines which clones are acceptable. 3) ValSeq (a modified version of ESTprep, University of Iowa) validates the Phred results, rejects sequences with long Poly(A) tails, rejects sequences that don't have a minimum number of good bases, and determines the location of NOTI site, the preliminary trimming location, and the library tag. 4) A modified version of Crossmatch program (University of Washington) in conjunction with a University of Missouri-written program creates a database identifying the properly trimmed sequence to be used for cluster analysis (e.g., must be 100 base pairs long). 5) Trimming is performed by another University of Missouri-written program. Results are saved in a fasta format. 6) Tlcluster program (University of Iowa) determines which sequences cluster and displays this information via a Web page. 7) Statistical data for a tissue are updated. 8) Tlcluster is run again to cluster all acceptable sequences within a tissue. This yields a cluster table for that tissue. 9) The project information is then updated. Stages 19 take about 1 min per plate. 10) GenBank (ALL, AMA) and TIGR searching then begin autonomously and take about 1 h per plate.
5' Sequencing
Selected clones were also sequenced from their 5' end by using the M13 reverse universal primer. These were subjected to the same quality analysis as were the sequences from the 3' end. Sequence similarity was then determined and annotation compared with the annotation from the 3' sequencing.
Data and cDNA Clones Access
The DNA sequence and annotation for each cDNA reported are available through the Web site http://genome.rnet.missouri.edu/Swine/, and all clones have been submitted to GenBank and have been assigned accession numbers CN024942CN033007.
Statistics
Chi-square statistics were calculated to give an indication of statistical differences in incidence of hits between the following pairs of tissues: germinal vesicle versus four-cell in vivo-produced embryo, four-cell in vivo-produced embryo versus in vivo-produced blastocyst, four-cell in vivo-produced embryo versus four-cell in vitro-produced embryo, and in vitro-produced blastocyst versus in vivo-produced blastocyst. Comparisons were made at P = 0.01; it should be recognized that these comparisons were made without experiment-wise protection against Type I errors.
Gene Ontology
To summarize the distribution of the sequences in the oocyte/embryo library, the publicly available sequences of TIGR (http://www.tigr.org/) and the descriptive terms of gene ontology were used [17]. Library sequences were compared with those in the swine, human, and bovine divisions at TIGR by using BLAST. When a suitable alignment was found, the corresponding gene ontology identifiers were sought using a mapping that TIGR maintains. The frequency of occurrence of library sequences in each gene ontology term was then determined and recorded in the directed acyclic graphs (generated 9 July 2002) that describe the ontologies.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
Evaluations of the library quality are presented in Table 1. The quality of these libraries was lower, i.e., shorter inserts were obtained, than we achieved without amplification of the cDNAs [16]. It is likely that some bias has been introduced by the amplification and library production methods; however, the bias should have been equal in all these libraries and thus limited, direct comparisons can be made. Nevertheless, 8066 ESTs were generated that provided information about tissue-specific expression. These individual ESTs were clustered into a Unigene set of 2489 members. The number of ESTs that do not have any obvious matches in the genome databases (score of less than 200) was 1114 (44.8%). Such a high percentage lacking a match is likely a result of two factors. 1) This project was based on 3' sequencing and many porcine EST projects have been based on 5' sequencing. Thus, sequence information for a particular EST may be in the database, but there may be insufficient overlap of the two sequences to provide for positive identification. 2) There is a large percentage of genes uniquely expressed during these early stages of embryogenesis. It is known that the 3' untranslated region (UTR) confers both message stability as well as stage-specific translation. Different UTRs may result in translation upon resumption of meiosis or after fertilization [1821]. In fact, the same message, such as Spin [22], may have as many as three different 3' UTRs that regulate differential translation during embryogenesis. Thus, many of the unknown ESTs may contain valuable information regarding message stability and translation specificity.
|
To directly address the possibility that the 3' sequence information is representative of unique genes, 29 clones classified as unique were successfully sequenced from their 5' end; 19 of these still had low TIGR scores. Although this was not an extensive analysis, it does suggest that
1/ 3 of those classified as unique have been sequenced before and that
2/3 of these have yet to be identified. The unique discovery rate then might be reduced from 45.8% to about 30%.
Gene Ontology
Sequences with known TIGR hits were classified according to the gene ontology index [23]. A summary of this information is presented in Figure 2. For molecular function, 527 sequences were mapped to 278 gene ontology identifiers at TIGR; similarly, 515 were mapped to 258 identifiers for biological processes and 283 were mapped to 129 identifiers for cellular components. For the sequences that mapped to molecular functions, over half of the ligand bindings were for nucleic acid binding, while among those that mapped to biological process, over 80% within cell growth were for metabolism.
|
Germinal Vesicle
The representative member of the largest clusters in the pgvo library and annotation is presented in Table 2. Clusters present in the germinal vesicle oocytes include those for many cellular functions, but surprisingly there are also a number of unique sequences, i.e., matches with a score below 200 and thus not in GenBank. The clusters with five or more members include, as might be predicted, messages that are specific to the oocyte: zona pellucida protein 1 (pgvo3-001-c07) and zona pellucida protein 3 (pgvo4-005-b01). In addition, nine of these highly abundant messages had not been previously sequenced. Pgvo4-011-c06 has a TIGR cluster annotation indicating that this is importin
1b in Xenopus. Cyclin I (pblivp1-003-c10), ferritin light chain subunit (pgvo-003-e01), ribonuclease inhibitor (pgvo4-011-c07), 90 kDa heat shock protein (pblivp1-004-e10), and DNA methyltransferase (pgvo3-001-c11) are some of the more well-known genes in the list. The function of many of the other gene products is not known.
|
Four-Cell Stage (In Vivo Produced)
The clusters with five or more members in the p4civv library are listed in Table 3. The most abundant clusters include many involved with protein expression, such as ribosomal subunits S21 (p4civv1-006-f08), S10 (p4civp1-018-d02), L7a (pgvo4-011-b06), L8 (pblivp1-006-f12), L36 (p4civv1-015-c11), 16S (p4civv1-020-e05), and 23S (p4civv1-005-g01), translation initiation factor (p4civv1-011-g12), and a Sin3-associated polypeptide that is thought to regulate nuclear structure (p4ivp1-004-g04). There are 18 in this list of 37 (
49%) that have scores less than 200.
|
Blastocyst Stage (In Vivo Produced)
In the pblivv library, clusters with five or more members are shown in Table 4. The clusters with the most members included ribosomal subunits S21 (p4civv1-006-f08), P0 (p4civp1-006-f06), L11 (pblivv4-016-d02), and L8 (pblivp1-006-f12), as well as proteins involved with fatty acid binding (pblivp1-006-d03), energy metabolism (pblivv4-019-c11, pblivv4-004-d02, pblivp1-006-c11, pblivp1-006-e09, pblivv4-014-a05, pblivv1-002-g12), and nuclear structure (p4civp1-004-g04, pblivv4-003-a08 [unc-50 inner nuclear membrane binding protein]). Here, only two clusters have a score of less than 200.
|
Germinal Vesicle to Four-Cell Stage (In Vivo Produced)
Differences in the detection of common transcripts between the pgvo and the p4civv libraries could result from degradation of maternal oocyte-specific message as well as the onset of newly synthesized message derived from the embryonic genome. In Table 5, the data only includes the 37 significant differences between the germinal vesicle and in vivo four-cell stages, and is sorted from most to least significant. About half of the clusters have a significantly greater abundance in the oocyte and, as expected, include zona pellucida protein 1 (pgvo3-001-c07). Zona pellucida protein 3 (pgvo4-005-b01), while present only in the oocyte, was not in great enough abundance to be significantly different. Those clones that appear in greater abundance in the four-cell stage are likely newly synthesized transcripts and may represent some of the first products of the porcine embryonic genome. Many of these ESTs are similar to the mRNAs that are detected in greater abundance in the mouse embryo beyond the two-cell stage, specifically an increase in many of the ribosomal subunits [11].
|
Four-Cell Stage to Blastocyst Stage (In Vivo Produced)
Differences in the detection of common transcripts between the in vivo-produced four-cell stage embryo and blastocyst-stage embryo likely result from changes in de novo mRNA synthesis. In Table 6, the percentage representation within the pblivv library was compared with the p4civv library. All 40 clusters with significant differences are listed in Table 6. Nine of the 10 unique clusters appear to decrease in relative abundance, and only one of the newly appearing transcripts is unique. Many of the more abundant ESTs are similar to those that increase in abundance in the mouse [11].
|
In Vitro- Versus In Vivo-Derived Four-Cell-Stage Embryos
Perhaps surprisingly, 38 clusters are represented differently between the in vitro- and in vivo-produced four-cell-stage embryo libraries (Table 7). Twenty-four were in greater abundance in the p4civp library as compared with the p4civv library. Those that are more abundant in the in vivo-produced embryos include many clusters that deal with translation, plus six unique clusters. Similarly, of the 24 that appear to be of higher abundance in the in vitro-produced embryos, 10 are unique.
|
In Vitro- Versus In Vivo-Derived Blastocyst-Stage Embryos
Similar to the comparison of the in vitro- and in vivo-produced four-cell-stage embryos, a difference of 37 clusters was detected between the pblivv and pblivp libraries (Table 8). In this list, only two are unique and most can be assigned a function.
|
General Discussion of Some of the Interesting Clusters
Pgvo4-011-c07 is porcine ribonuclease inhibitor (RI). RI is a cytoplasmic protein that tightly binds and inhibits ribonucleases of the pancreatic ribonuclease superfamily [24]. The primary sequence of this inhibitor contains leucine-rich repeats; these motifs are present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. In vivo, RI may have a role in the regulation of RNA turnover in mammalian cells and in angiogenesis. This clone was found only in the germinal vesicle-stage oocyte and in vitro-produced blastocyst stages. Its presence in the oocyte may help to stabilize maternal transcripts.
Pgvo2-001-a11 is porcine destrin. Destrin is a mammalian 19-kDa protein that rapidly depolymerizes F-actin in a stoichiometric and pH-independent manner [25]. Destrin is an isoprotein of cofilin that regulates actin cytoskeleton in various eukaryotes. Destrin clones were detected mainly in in vitro-produced blastocysts.
P4civv1-006-f06 is porcine casein kinase II beta (CKIIß). CKIIß binds to and regulates Mos activity [26] and is phosphorylated at Ser-209 by p34cdc2 [27]. Clones for CKIIß were found in greatest abundance in the in vitro-produced four-cell-stage embryos. It might be that these embryos were not dividing as fast as they should have been and thus the gene upregulated to modulate cell division.
Pblivp1-004-e10 is porcine heat shock protein 90 (Hsp90). Hsp90 interacts with steroid hormone receptors, protein kinases, and cytoskeletal proteins. It is known to bind tubulin dimers and inhibit microtubule formation [28]. Hsp90 binds and protects casein kinase II from self-aggregation and enhances its kinase activity, suggesting that CKII is structurally and functionally active when it forms a complex with Hsp90. Interestingly, Hsp90 protein was detected only at a low level in porcine Day 6 blastocysts, and Hsp90 levels did not increase in embryos subjected to heat stresses [29]. We found that the Hsp90 message was of highest abundance in in vivo-produced blastocyst-stage embryos.
P4civp1-018-d02 is ribosomal protein S10 (RPS10). RPS10 localizes to the surface of mammalian 40S subunits and stabilizes their conformation [30]. Interestingly, an anti-Sm monoclonal antibody (Y12) appears to recognize the D core protein of small nuclear ribonuclear proteins and also recognizes the carboxyl terminus of RPS10 containing the Gly-Arg-Gly sequence motif shared by Sm-D [31]. Immunocytochemical localization of Y12 to the nucleus does not begin until the late four-cell stage in the pig [32]. Detection of this clone was numerically highest in in vivo-produced four-cell-stage embryos.
P4civv1-011-g12 is eukaryotic translation initiation factor 3 subunit p42/p44 (eIF3). The eIF3 has an aggregate molecular mass of approximately 600 kDa and is composed of at least 10 subunits. Initiation of eukaryotic protein synthesis begins with the ribosome separated into its 40S and 60S subunits. The 40S subunit first binds eIF3 and an eIF2-GTP-initiator transfer RNA ternary complex [33] and thus plays a central role in protein synthesis. We found the highest representation in the in vivo-derived four-cell-stage embryo.
Pgvo-003-e01 is porcine ferritin L subunit. The iron-storage protein ferritin is a multimeric hollow sphere consisting of two types of subunits, heavy (H) and light (L), and thus is a metalloprotein. Iron is stored in an iron protein containing ferric hydroxide and ferric phosphate [34]. It is also likely a secreted protein. We found the ferritin L subunit and the H subunit (pblivp1-005-g05) to be the most abundant in the blastocyst stages, while being the least abundant in the four-cell-stage embryos.
Pblivp1-003-c10 is cyclin I. While it is known that cyclins control cell-cycle progression by regulating the activity of cyclin-dependent kinases, very little is known about the presence of these genes during porcine embryogenesis, although relative message levels have been described for cyclin B1 [5]. Cyclin I was recently added to the cyclin family of proteins because of the presence of a cyclin box motif in the deduced amino-acid sequence [35]. In contrast with what is generally observed with other cyclins, the levels of cyclin I appear not to change during the cell cycle and its distribution is uniform within the cell during the cell cycle [35]. Thus, its functional role has not been elucidated. Cyclin I was detected most often in the germinal vesicle oocyte and the in vitro-produced blastocyst-stage embryo.
P4civp1-004-g04 is a Sin-3-associated protein 18 (SAP18). SAP18 represses transcription via interactions with histone deacetylase [36]. Expression appears to be highest during the four-cell stage, a time when transcription is being initiated.
Pblivp1-006-a09 is keratin 18 and was detected only in the in vitro-produced blastocyst-stage embryos. In contrast, pblivv4-019-c11 is an ADP/ATP carrier protein and is detected only in the in vivo-produced blastocyst stage.
Pblivp1-006-d03 is-produced only at the blastocyst stage and is a fatty acid-binding protein.
While the most abundant clusters provide interesting avenues for future investigation, clusters farther down the list are also of interest. For example, p4civp1-003-d02 is likely a cyclin-dependent kinase [(CksHs1:gb|X54941.1); but the score was only 149 (1e-33)]. Overexpression of CksHs1 inhibits CDK2 (cyclin-dependent kinase 2) activity [37]. It is interesting to note that the clone for CksHs1 was found only in the in vitro-produced four-cell-stage embryo. Ectopic expression of CKsHs1 interferes with the control of cyclin B metabolism by the mitotic spindle cell cycle checkpoint and results in a higher tendency to undergo DNA endoreduplication [38]. Both of these points may have important implications for the reduced developmental potential of the in vitro-produced four-cell-stage embryo. While it is not clear what factors are responsible for the reduced developmental competence of in vitro-produced embryos, identification of genes that are expressed in these embryos and placement of these sequences in the database and on microarrays is essential to begin to understand which gene pathways are altered due to in vitro embryo production.
The data presented in this article provide a solid foundation for future studies evaluating mammalian embryogenesis in terms of candidate genes via the virtual Northerns and the large number of unique sequences that have been entered into the genomic databases. Microarray studies using the clones described in this manuscript are currently underway to confirm and extend our findings of developmental expression.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Randall S. Prather, E125D Animal Science Research Center, 920 East Campus Drive, University of Missouri-Columbia, Columbia, MO 65211. FAX: 573 884 7827; PratherR{at}Missouri.Edu ![]()
Received: 29 March 2004.
First decision: 24 April 2004.
Accepted: 25 May 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
V. Duranthon, A. J Watson, and P. Lonergan Preimplantation embryo programming: transcription, epigenetics, and culture environment Reproduction, February 1, 2008; 135(2): 141 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Misirlioglu, G. P. Page, H. Sagirkaya, A. Kaya, J. J. Parrish, N. L. First, and E. Memili Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos PNAS, December 12, 2006; 103(50): 18905 - 18910. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Chen, E. C. Lin, W. T. K. Cheng, H. S. Sun, H. J. Mersmann, and S. T. Ding Abundantly expressed genes in pig adipose tissue: An expressed sequence tag approach J Anim Sci, October 1, 2006; 84(10): 2673 - 2683. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.M. Whitworth, C. Agca, J.-G. Kim, R.V. Patel, G.K. Springer, N.J. Bivens, L.J. Forrester, N. Mathialagan, J.A. Green, and R.S. Prather Transcriptional Profiling of Pig Embryogenesis by Using a 15-K Member Unigene Set Specific for Pig Reproductive Tissues and Embryos Biol Reprod, June 1, 2005; 72(6): 1437 - 1451. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |