Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print June 2, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.030239
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
71/4/1230    most recent
biolreprod.104.030239v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.
Agricola
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.
BIOLOGY OF REPRODUCTION 71, 1230–1243 (2004)
DOI: 10.1095/biolreprod.104.030239
© 2004 by the Society for the Study of Reproduction, Inc.

Embryo

Developmental Expression of 2489 Gene Clusters During Pig Embryogenesis: An Expressed Sequence Tag Project1

Kristin Whitworth3, Gordon K. Springer4, L. Joe Forrester5, William G. Spollen6, Jim Ries4, William R. Lamberson3, Nathan Bivens4, Clifton N. Murphy3, Nagappan Mathialigan7, Jonathan A. Green3, and Randall S. Prather2,3

Department of Animal Science,3 Department of Computer Science,4 Molecular Biology Program,5 and Department of Health Management and Informatics,6 University of Missouri-Columbia, Columbia, Missouri 65211 Monsanto Company,7 Chesterfield, Missouri 63017


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Identification of mRNAs that are present at early stages of embryogenesis is critical for a better understanding of development. To this end, cDNA libraries were constructed from germinal vesicle-stage oocytes, in vivo-produced four-cell- and blastocyst-stage embryos, and from in vitro-produced four-cell- and blastocyst-stage embryos. Randomly picked clones (10 848) were sequenced from the 3' end and those of sufficient quality (8066, 74%) were clustered into groups of sequence similarity (>95% identity), resulting in 2489 clusters. The sequence of the longest representative expressed sequence tag (EST) of each cluster was compared with GenBank and TIGR. Scores below 200 were considered unique, and 1114 (44.8%) did not have a match in either database. Sequencing from the 5' end yielded 12 of 37 useful annotations, suggesting that one third of the 1114 might be identifiable, still leaving over 700 unique ESTs. Virtual Northerns compared between the stages identified numerous genes where expression appears to change from the germinal vesicle oocyte to the four-cell stage, from the four-cell to blastocyst stage, and between in vitro- and in vivo-derived four-cell- and blastocyst-stage embryos. This is the first large-scale sequencing project on early pig embryogenesis and has resulted in the discovery of a large number of genes as well as possible stage-specific expression. Because many of these ESTs appear to not be in the public databases, their addition will be useful for transcriptional profiling experiments conducted on early pig embryos.

embryo, embryogenesis, EST, pig


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
During embryogenesis in mammals, there is a period after fertilization where certain preexisting messages are degraded and few new transcripts are produced. This is followed by de novo synthesis of embryonic mRNA at a species-specific cell stage. In mice, this major onset of transcription begins during the two-cell stage, while it begins during the four-cell stage in humans and rats and during the 8- to 16-cell stage in cattle and sheep [1]. In the pig, a major shift in the types of proteins synthesized occurs during the four-cell stage [2]. While some changes in protein production occur at fertilization [3], the timing of the first major change is about 18 h after cleavage to the four-cell stage [4]. While there are a few reports characterizing changes in the mRNA of specific genes in the early pig embryo [5–7], very little is known about the changing expression patterns of the vast majority of the other transcripts present at this time. In addition, it is clear that in vitro-produced embryos are less developmentally competent than are in vivo-derived embryos. Simple culture for 4 days slows the embryos by one cleavage division [8]. It is not clear if these differences are reflected in changes of gene expression in the pig.

One method for identification of genes that are transcribed at specific stages of tissue development is via sequencing of expressed sequence tags (ESTs). Differential representation of a message in a library can be reflective of actual message levels within a tissue from which the library was derived [9]. Previous reports of EST, bioinformatics, and microarray projects in mouse embryogenesis [10, 11] identified a number of developmentally regulated genes. A complete description of changes in gene expression during embryogenesis would provide insight into the many differentiation and developmental events taking place at this critical time. As a preliminary step toward this goal, we report the results of an EST sequencing project directed toward the identification of novel genes expressed during porcine embryogenesis. Libraries were made from germinal vesicle-stage oocytes and in vitro- and in vivo-produced four-cell- and blastocyst-stage embryos in an attempt to provide a catalog of expressed genes and a preliminary evaluation of gene-expression patterns in the porcine oocyte and early embryo.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS AND DISCUSSION
 REFERENCES
 
Tissues

Oocytes were aspirated from ovaries obtained at the slaughterhouse and stripped of their cumulus cells. In vitro-produced four-cell and blastocyst stage embryos were collected on Days 3 and 7, respectively, as described by Abeydeera et al. [12]. In vivo-produced four-cell- and blastocyst-stage embryos were collected on Days 3 and 6, respectively, as described by Anderson et al. [5] except that the embryos were flushed with TL HEPES [13]. Animals were treated in accordance with the Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching as approved by the Institutional Animal Care and Use Committee.

Poly(A) RNA Extraction

Poly(A) RNA from 200 oocytes or 50 embryos was extracted by using a micro poly(A) kit (Ambion) according to the manufacturer's instructions with minor modifications in the protocol. The modified elution buffer consisted of 10 mM Tris (pH 7.5), 1 mM EDTA, and 0.5% SDS heated to 65°C. Due to the low amount of mRNA, the RNA integrity and purity were not verified.

SMART Technology

Due to the small amount of mRNA in oocytes and embryos, a modified SMART PCR cDNA synthesis (Clontech, Palo Alto, CA) was used [14]. The switching mechanism at the 5' end of RNA Transcipt (SMART) system utilizes the terminal transferase (TdT) activity of MMLV reverse transcriptase (RT). A modified oligo dT primes first strand synthesis. When the RT reaches the 5' end of the mRNA, the enzyme's TdT activity adds additional deoxycytidines (dC) to the 3' end of the cDNA. The modified SMART oligo contains a string of deoxyguanidines (dG) at its 3' end. The reverse transcriptase switches templates and continues replicating to the end of the oligonucleotide [15]. This template is then used to amplify the cDNA before ligating into a vector and electroporating into bacteria (Fig. 1).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 1. Diagram of library production

Reverse Transcription and Terminal Transferase of cDNA

Two microliters of mRNA from oocytes or embryos (10 µl total from mRNA purification) was added to 1 µl of each oligo dT primer (specific for each library), 1 µl of the SMART 5' long primer (1 µg/µl: 5' AAGCAGTGGTAACAACGCAGAGTACGAATTCGTCGACGCGGG 3'), 1 µl of RNase inhibitor (SUPERase-In, 20 U/µl; Ambion) and 5 µl of diethyl pyrocarbonate (DEPC)-treated water [14]. This was heated to 70°C for 10 min and cooled to 37°C for 2 min. Preheated RT mix (9 µl: 4 µl 5x first-strand synthesis buffer, 2 µl 0.1 M dithiothreitol, 1 µl 10 mM dNTP, and 2 µl DEPC-treated water) was then added. After 2 min, 1 µl SuperScript II MMLV reverse transcriptase was added and allowed to incubate for 1 h. The reverse transcription was performed by annealing poly(A) RNA with 1 µg of an oligo(dT) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGC(tag)TTTTTTTTTTTTTTTTTTTTTTTT 3', where tag = library-specific six-base sequence identifier) at 37°C. An excessive amount of oligo(dT) primer was used to reduce the number of clones with long poly(A) tails in the cDNA libraries [16].

PCR Amplification of Embryo and Oocyte cDNA

A 50-µl PCR mix was aliquoted on ice with the following reagents: 2 µl 10 mM dNTP (Life Technologies, Inc., Rockville, MD), 2 µl 5' SMART short primer (50 ng/µl; 5' AAGCAGTGGTAACAACGCAGAGTAC 3'), 2 µl 3' PCR library primer (50 ng/µl; 5' GACTAGTTCTAGATCGCGAGCGG 3'), 5 µl 10x cloned Pfu buffer, 2 µl (5 U) Pfu turbo polymerase (Stratagene, La Jolla, CA) and 32 µl DEPC water. PCR amplification was performed with 5 µl of the 20-µl RT reaction as template. A negative control consisted of using 5 µl of water as template. The 5' SMART short primer and 3' PCR library primer were replaced with primers specific for pig ß-actin in a separate reaction for use as a positive control. The PCR conditions consisted of a 95°C initial denaturation for 3 min and 30 cycles of 95°C denaturation for 30 sec, 53°C annealing for 30 sec, and 72°C elongation for 3 min.

The positive and negative controls were run on a 1.25% agarose gel to determine mRNA quality and nonspecific amplification, respectively.

Restriction Digest of PCR-Amplified Library

The PCR-amplified library was phenol:chloroform extracted and precipitated with ethanol and 1 µl pellet paint (Novagen, Madison, WI). The PCR products were restriction digested in 41 µl water, 5 µl React 3 buffer, 2 µl NotI and 2 µl SalI at 37°C for 2 h. The digest was then increased to 100 µl by adding an additional 41 µl water, 5 µl React 10 buffer, 2 µl NotI, and 2 µl SalI and incubated at 37°C for an additional hour. Restriction enzymes were purchased from New England Biolabs (Beverly, MA).

Clean-Up and Sizing of PCR-Amplified Library

The restriction digested PCR-amplified library was cleaned up by using a High Pure PCR product purification kit (Roche, Mannheim, Germany). Following PCR cleanup, reactions were first sized using one Chroma Spin-400 column (Clontech) by following the manufacturer's instructions. After elution from this column, the library was further sized by using a Chroma Spin-1000 column. After size fractionation, the PCR-amplified library was again phenol:chloroform extracted, precipitated, and resuspended in 5 µl of DEPC water.

Ligation of PCR-Amplified Library in pSport and Transformation into DH10B

The PCR-amplified library was ligated into NotI/SalI digested pSPORT1 (Life Technologies, Inc., Rockville, MD) vector. Secondary structure was reduced by incubating 1 µl of the library, 1 µl pSPORT and 13 µl water at 70°C for 3 min. The ligation was quick chilled on ice for 2 min and 4 µl 5x ligase buffer and 1 µl T4 ligase (Life Technologies) were added. The ligation was incubated at 4°C for 16 h. Following ligation, 1 µl of ligation was electroporated into 25 µl of DH10B Electromax competent cells (Life Technologies) in a 1-mm electroporation cuvette at 1.5 KV/5 msec. Transformants were recovered in 1 ml SOC at 37°C for 1 h. Ten and 100 µl of transformants were plated on LB-agar plates supplemented with 50 µg/µl carbenicillin (Sigma, St. Louis, MO). Colonies were counted to determine the number of recombinants for each library.

cDNA Sequencing

Bacteria clones from each library were randomly picked and grown in 96-well plates containing 1.5 ml terrific broth plus 50 µg/ml ampicillin. Plasmid extractions from bacterial culture were performed by using the QIAprep 96 Turbo Miniprep kit (Qiagen). Sequencing reactions were designed to yield 3' sequence by using Sp6 promoter primer and the ABI Prism BigDye Terminator cycle sequencing chemistry (Applied Biosystems, Foster City, CA). The sequencing reactions were analyzed on an ABI 377 automated DNA sequencer (Applied Biosystems). Individual clone names are based on a description of the tissue (oocyte: pgvo; in vitro-produced four-cell stage embryo: p4civp; in vivo-produced four-cell-stage embryo: p4civv; in vitro-produced blastocyst-stage embryo: pblivp; in vivo-produced blastocyst-stage embryo: pblivv) followed by the library number, followed by the plate number, followed by the location within the plate. So pgvo4-011-b01 is a germinal vesicle oocyte, 4th library attempt, 11th plate, and the clone is located in well b01 of this plate.

Quality Assessment of cDNA Libraries

The quality of each cDNA library was first assessed by restriction digestion of 96 randomly picked clones to determine the average insert size and the percentage of clones without inserts. Acceptable libraries were assessed by sequencing 288 randomly picked clones to determine the percentage of clones with long poly(A) tails (long poly[A] tails are designated as poly[A] stretches containing more than 40 adenines) and the percentage of clones with ribosomal RNA inserts or genomic DNA.

Sequence Clustering and Annotation

A 10-stage process is implemented to evaluate the sequence data. 1) The Zip file from the sequencer is validated and extracted. 2) Phred (University of Washington program) determines the quality of each base call and determines which clones are acceptable. 3) ValSeq (a modified version of ESTprep, University of Iowa) validates the Phred results, rejects sequences with long Poly(A) tails, rejects sequences that don't have a minimum number of good bases, and determines the location of NOTI site, the preliminary trimming location, and the library tag. 4) A modified version of Crossmatch program (University of Washington) in conjunction with a University of Missouri-written program creates a database identifying the properly trimmed sequence to be used for cluster analysis (e.g., must be 100 base pairs long). 5) Trimming is performed by another University of Missouri-written program. Results are saved in a fasta format. 6) Tlcluster program (University of Iowa) determines which sequences cluster and displays this information via a Web page. 7) Statistical data for a tissue are updated. 8) Tlcluster is run again to cluster all acceptable sequences within a tissue. This yields a cluster table for that tissue. 9) The project information is then updated. Stages 1–9 take about 1 min per plate. 10) GenBank (ALL, AMA) and TIGR searching then begin autonomously and take about 1 h per plate.

5' Sequencing

Selected clones were also sequenced from their 5' end by using the M13 reverse universal primer. These were subjected to the same quality analysis as were the sequences from the 3' end. Sequence similarity was then determined and annotation compared with the annotation from the 3' sequencing.

Data and cDNA Clones Access

The DNA sequence and annotation for each cDNA reported are available through the Web site http://genome.rnet.missouri.edu/Swine/, and all clones have been submitted to GenBank and have been assigned accession numbers CN024942–CN033007.

Statistics

Chi-square statistics were calculated to give an indication of statistical differences in incidence of hits between the following pairs of tissues: germinal vesicle versus four-cell in vivo-produced embryo, four-cell in vivo-produced embryo versus in vivo-produced blastocyst, four-cell in vivo-produced embryo versus four-cell in vitro-produced embryo, and in vitro-produced blastocyst versus in vivo-produced blastocyst. Comparisons were made at P = 0.01; it should be recognized that these comparisons were made without experiment-wise protection against Type I errors.

Gene Ontology

To summarize the distribution of the sequences in the oocyte/embryo library, the publicly available sequences of TIGR (http://www.tigr.org/) and the descriptive terms of gene ontology were used [17]. Library sequences were compared with those in the swine, human, and bovine divisions at TIGR by using BLAST. When a suitable alignment was found, the corresponding gene ontology identifiers were sought using a mapping that TIGR maintains. The frequency of occurrence of library sequences in each gene ontology term was then determined and recorded in the directed acyclic graphs (generated 9 July 2002) that describe the ontologies.


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
REFERENCES
 
Library Quality

Evaluations of the library quality are presented in Table 1. The quality of these libraries was lower, i.e., shorter inserts were obtained, than we achieved without amplification of the cDNAs [16]. It is likely that some bias has been introduced by the amplification and library production methods; however, the bias should have been equal in all these libraries and thus limited, direct comparisons can be made. Nevertheless, 8066 ESTs were generated that provided information about tissue-specific expression. These individual ESTs were clustered into a Unigene set of 2489 members. The number of ESTs that do not have any obvious matches in the genome databases (score of less than 200) was 1114 (44.8%). Such a high percentage lacking a match is likely a result of two factors. 1) This project was based on 3' sequencing and many porcine EST projects have been based on 5' sequencing. Thus, sequence information for a particular EST may be in the database, but there may be insufficient overlap of the two sequences to provide for positive identification. 2) There is a large percentage of genes uniquely expressed during these early stages of embryogenesis. It is known that the 3' untranslated region (UTR) confers both message stability as well as stage-specific translation. Different UTRs may result in translation upon resumption of meiosis or after fertilization [18–21]. In fact, the same message, such as Spin [22], may have as many as three different 3' UTRs that regulate differential translation during embryogenesis. Thus, many of the unknown ESTs may contain valuable information regarding message stability and translation specificity.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Quality of oocyte/embryo libraries

To directly address the possibility that the 3' sequence information is representative of unique genes, 29 clones classified as unique were successfully sequenced from their 5' end; 19 of these still had low TIGR scores. Although this was not an extensive analysis, it does suggest that ~1/ 3 of those classified as unique have been sequenced before and that ~2/3 of these have yet to be identified. The unique discovery rate then might be reduced from 45.8% to about 30%.

Gene Ontology

Sequences with known TIGR hits were classified according to the gene ontology index [23]. A summary of this information is presented in Figure 2. For molecular function, 527 sequences were mapped to 278 gene ontology identifiers at TIGR; similarly, 515 were mapped to 258 identifiers for biological processes and 283 were mapped to 129 identifiers for cellular components. For the sequences that mapped to molecular functions, over half of the ligand bindings were for nucleic acid binding, while among those that mapped to biological process, over 80% within cell growth were for metabolism.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2. The percentage of cDNA within different categories of the gene ontology index. The cDNAs were classified according to GO categories for biological process (A, 515 sequences were mapped to 258 GO identifiers), molecular function (B, 527 sequences were mapped to 278 GO identifiers), and cellular component (C, 482 sequences were mapped to 129 GO identifiers)

Germinal Vesicle

The representative member of the largest clusters in the pgvo library and annotation is presented in Table 2. Clusters present in the germinal vesicle oocytes include those for many cellular functions, but surprisingly there are also a number of unique sequences, i.e., matches with a score below 200 and thus not in GenBank. The clusters with five or more members include, as might be predicted, messages that are specific to the oocyte: zona pellucida protein 1 (pgvo3-001-c07) and zona pellucida protein 3 (pgvo4-005-b01). In addition, nine of these highly abundant messages had not been previously sequenced. Pgvo4-011-c06 has a TIGR cluster annotation indicating that this is importin {alpha}1b in Xenopus. Cyclin I (pblivp1-003-c10), ferritin light chain subunit (pgvo-003-e01), ribonuclease inhibitor (pgvo4-011-c07), 90 kDa heat shock protein (pblivp1-004-e10), and DNA methyltransferase (pgvo3-001-c11) are some of the more well-known genes in the list. The function of many of the other gene products is not known.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Representatives of clusters with five or more members in oocytes

Four-Cell Stage (In Vivo Produced)

The clusters with five or more members in the p4civv library are listed in Table 3. The most abundant clusters include many involved with protein expression, such as ribosomal subunits S21 (p4civv1-006-f08), S10 (p4civp1-018-d02), L7a (pgvo4-011-b06), L8 (pblivp1-006-f12), L36 (p4civv1-015-c11), 16S (p4civv1-020-e05), and 23S (p4civv1-005-g01), translation initiation factor (p4civv1-011-g12), and a Sin3-associated polypeptide that is thought to regulate nuclear structure (p4ivp1-004-g04). There are 18 in this list of 37 (~49%) that have scores less than 200.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Representatives of clusters with five or more members in in vivo-produced four-cell-stage embryos

Blastocyst Stage (In Vivo Produced)

In the pblivv library, clusters with five or more members are shown in Table 4. The clusters with the most members included ribosomal subunits S21 (p4civv1-006-f08), P0 (p4civp1-006-f06), L11 (pblivv4-016-d02), and L8 (pblivp1-006-f12), as well as proteins involved with fatty acid binding (pblivp1-006-d03), energy metabolism (pblivv4-019-c11, pblivv4-004-d02, pblivp1-006-c11, pblivp1-006-e09, pblivv4-014-a05, pblivv1-002-g12), and nuclear structure (p4civp1-004-g04, pblivv4-003-a08 [unc-50 inner nuclear membrane binding protein]). Here, only two clusters have a score of less than 200.


View this table:
[in this window]
[in a new window]
  		TABLE 4. Representatives of clusters with five or more members in in vivo-produced blastocyst-stage embryos

Germinal Vesicle to Four-Cell Stage (In Vivo Produced)

Differences in the detection of common transcripts between the pgvo and the p4civv libraries could result from degradation of maternal oocyte-specific message as well as the onset of newly synthesized message derived from the embryonic genome. In Table 5, the data only includes the 37 significant differences between the germinal vesicle and in vivo four-cell stages, and is sorted from most to least significant. About half of the clusters have a significantly greater abundance in the oocyte and, as expected, include zona pellucida protein 1 (pgvo3-001-c07). Zona pellucida protein 3 (pgvo4-005-b01), while present only in the oocyte, was not in great enough abundance to be significantly different. Those clones that appear in greater abundance in the four-cell stage are likely newly synthesized transcripts and may represent some of the first products of the porcine embryonic genome. Many of these ESTs are similar to the mRNAs that are detected in greater abundance in the mouse embryo beyond the two-cell stage, specifically an increase in many of the ribosomal subunits [11].


View this table:
[in this window]
[in a new window]
  		TABLE 5. Clusters with a different percentage of members between the oocyte and in vivo-produced four-cell-stage embryo.*

Four-Cell Stage to Blastocyst Stage (In Vivo Produced)

Differences in the detection of common transcripts between the in vivo-produced four-cell stage embryo and blastocyst-stage embryo likely result from changes in de novo mRNA synthesis. In Table 6, the percentage representation within the pblivv library was compared with the p4civv library. All 40 clusters with significant differences are listed in Table 6. Nine of the 10 unique clusters appear to decrease in relative abundance, and only one of the newly appearing transcripts is unique. Many of the more abundant ESTs are similar to those that increase in abundance in the mouse [11].


View this table:
[in this window]
[in a new window]
  		TABLE 6. Clusters with a different percentage of members between the in vivo-produced four-cell- and blastocyst-stage embryo.*

In Vitro- Versus In Vivo-Derived Four-Cell-Stage Embryos

Perhaps surprisingly, 38 clusters are represented differently between the in vitro- and in vivo-produced four-cell-stage embryo libraries (Table 7). Twenty-four were in greater abundance in the p4civp library as compared with the p4civv library. Those that are more abundant in the in vivo-produced embryos include many clusters that deal with translation, plus six unique clusters. Similarly, of the 24 that appear to be of higher abundance in the in vitro-produced embryos, 10 are unique.


View this table:
[in this window]
[in a new window]
  		TABLE 7. Clusters with a different percentage of members between the in vitro-produced and in vivo-produced four-cell-stage embryos.*

In Vitro- Versus In Vivo-Derived Blastocyst-Stage Embryos

Similar to the comparison of the in vitro- and in vivo-produced four-cell-stage embryos, a difference of 37 clusters was detected between the pblivv and pblivp libraries (Table 8). In this list, only two are unique and most can be assigned a function.


View this table:
[in this window]
[in a new window]
  		TABLE 8. Clusters with a different percentage of members between the in vitro-produced and in vivo-produced blastocyst-stage embryos.*

General Discussion of Some of the Interesting Clusters

Pgvo4-011-c07 is porcine ribonuclease inhibitor (RI). RI is a cytoplasmic protein that tightly binds and inhibits ribonucleases of the pancreatic ribonuclease superfamily [24]. The primary sequence of this inhibitor contains leucine-rich repeats; these motifs are present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. In vivo, RI may have a role in the regulation of RNA turnover in mammalian cells and in angiogenesis. This clone was found only in the germinal vesicle-stage oocyte and in vitro-produced blastocyst stages. Its presence in the oocyte may help to stabilize maternal transcripts.

Pgvo2-001-a11 is porcine destrin. Destrin is a mammalian 19-kDa protein that rapidly depolymerizes F-actin in a stoichiometric and pH-independent manner [25]. Destrin is an isoprotein of cofilin that regulates actin cytoskeleton in various eukaryotes. Destrin clones were detected mainly in in vitro-produced blastocysts.

P4civv1-006-f06 is porcine casein kinase II beta (CKIIß). CKIIß binds to and regulates Mos activity [26] and is phosphorylated at Ser-209 by p34cdc2 [27]. Clones for CKIIß were found in greatest abundance in the in vitro-produced four-cell-stage embryos. It might be that these embryos were not dividing as fast as they should have been and thus the gene upregulated to modulate cell division.

Pblivp1-004-e10 is porcine heat shock protein 90 (Hsp90). Hsp90 interacts with steroid hormone receptors, protein kinases, and cytoskeletal proteins. It is known to bind tubulin dimers and inhibit microtubule formation [28]. Hsp90 binds and protects casein kinase II from self-aggregation and enhances its kinase activity, suggesting that CKII is structurally and functionally active when it forms a complex with Hsp90. Interestingly, Hsp90 protein was detected only at a low level in porcine Day 6 blastocysts, and Hsp90 levels did not increase in embryos subjected to heat stresses [29]. We found that the Hsp90 message was of highest abundance in in vivo-produced blastocyst-stage embryos.

P4civp1-018-d02 is ribosomal protein S10 (RPS10). RPS10 localizes to the surface of mammalian 40S subunits and stabilizes their conformation [30]. Interestingly, an anti-Sm monoclonal antibody (Y12) appears to recognize the D core protein of small nuclear ribonuclear proteins and also recognizes the carboxyl terminus of RPS10 containing the Gly-Arg-Gly sequence motif shared by Sm-D [31]. Immunocytochemical localization of Y12 to the nucleus does not begin until the late four-cell stage in the pig [32]. Detection of this clone was numerically highest in in vivo-produced four-cell-stage embryos.

P4civv1-011-g12 is eukaryotic translation initiation factor 3 subunit p42/p44 (eIF3). The eIF3 has an aggregate molecular mass of approximately 600 kDa and is composed of at least 10 subunits. Initiation of eukaryotic protein synthesis begins with the ribosome separated into its 40S and 60S subunits. The 40S subunit first binds eIF3 and an eIF2-GTP-initiator transfer RNA ternary complex [33] and thus plays a central role in protein synthesis. We found the highest representation in the in vivo-derived four-cell-stage embryo.

Pgvo-003-e01 is porcine ferritin L subunit. The iron-storage protein ferritin is a multimeric hollow sphere consisting of two types of subunits, heavy (H) and light (L), and thus is a metalloprotein. Iron is stored in an iron protein containing ferric hydroxide and ferric phosphate [34]. It is also likely a secreted protein. We found the ferritin L subunit and the H subunit (pblivp1-005-g05) to be the most abundant in the blastocyst stages, while being the least abundant in the four-cell-stage embryos.

Pblivp1-003-c10 is cyclin I. While it is known that cyclins control cell-cycle progression by regulating the activity of cyclin-dependent kinases, very little is known about the presence of these genes during porcine embryogenesis, although relative message levels have been described for cyclin B1 [5]. Cyclin I was recently added to the cyclin family of proteins because of the presence of a cyclin box motif in the deduced amino-acid sequence [35]. In contrast with what is generally observed with other cyclins, the levels of cyclin I appear not to change during the cell cycle and its distribution is uniform within the cell during the cell cycle [35]. Thus, its functional role has not been elucidated. Cyclin I was detected most often in the germinal vesicle oocyte and the in vitro-produced blastocyst-stage embryo.

P4civp1-004-g04 is a Sin-3-associated protein 18 (SAP18). SAP18 represses transcription via interactions with histone deacetylase [36]. Expression appears to be highest during the four-cell stage, a time when transcription is being initiated.

Pblivp1-006-a09 is keratin 18 and was detected only in the in vitro-produced blastocyst-stage embryos. In contrast, pblivv4-019-c11 is an ADP/ATP carrier protein and is detected only in the in vivo-produced blastocyst stage.

Pblivp1-006-d03 is-produced only at the blastocyst stage and is a fatty acid-binding protein.

While the most abundant clusters provide interesting avenues for future investigation, clusters farther down the list are also of interest. For example, p4civp1-003-d02 is likely a cyclin-dependent kinase [(CksHs1:gb|X54941.1); but the score was only 149 (1e-33)]. Overexpression of CksHs1 inhibits CDK2 (cyclin-dependent kinase 2) activity [37]. It is interesting to note that the clone for CksHs1 was found only in the in vitro-produced four-cell-stage embryo. Ectopic expression of CKsHs1 interferes with the control of cyclin B metabolism by the mitotic spindle cell cycle checkpoint and results in a higher tendency to undergo DNA endoreduplication [38]. Both of these points may have important implications for the reduced developmental potential of the in vitro-produced four-cell-stage embryo. While it is not clear what factors are responsible for the reduced developmental competence of in vitro-produced embryos, identification of genes that are expressed in these embryos and placement of these sequences in the database and on microarrays is essential to begin to understand which gene pathways are altered due to in vitro embryo production.

The data presented in this article provide a solid foundation for future studies evaluating mammalian embryogenesis in terms of candidate genes via the virtual Northerns and the large number of unique sequences that have been entered into the genomic databases. Microarray studies using the clones described in this manuscript are currently underway to confirm and extend our findings of developmental expression.


   ACKNOWLEDGMENTS
 
The authors would like to acknowledge Tom Casavant for providing library tags; Tom Cantley for help with surgery; Rami Woods, Melissa Samuel, and Tom Cantley for retrieving ovaries; and Brad Didion for his initial help in coordinating these studies with Monsanto.


   FOOTNOTES
 
1 Supported by The Monsanto Company and NLM Training Grant 5 T15 LM07089-09. Back

2 Correspondence: Randall S. Prather, E125D Animal Science Research Center, 920 East Campus Drive, University of Missouri-Columbia, Columbia, MO 65211. FAX: 573 884 7827; PratherR{at}Missouri.Edu Back

Received: 29 March 2004.

First decision: 24 April 2004.

Accepted: 25 May 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Prather RS. Nuclear control of early embryonic development in domestic pigs. J Reprod Fertil 1993: 17–29
  2. Jarrell VL, Day BN, Prather RS. The transition from maternal to zygotic control of development occurs during the 4-cell stage in the domestic pig, Sus scrofa: quantitative and qualitative aspects of protein synthesis. Biol Reprod 1991 44:62-68[Abstract]
  3. Ding J, Moor RM, Foxcroft GR. Effects of protein synthesis on maturation, sperm penetration, and pronuclear development in porcine oocytes. Mol Reprod Dev 1992 33:59-66[CrossRef][Medline]
  4. Schoenbeck RA, Peters MS, Rickords LF, Stumpf TT, Prather RS. Characterization of deoxyribonucleic acid synthesis and the transition from maternal to embryonic control in the 4-cell porcine embryo. Biol Reprod 1992 47:1118-1125[Abstract]
  5. Anderson JE, Matteri RL, Abeydeera LR, Day BN, Prather RS. Cyclin B1 transcript quantitation over the maternal to zygotic transition in both in vivo-and in vitro-derived 4-cell porcine embryos. Biol Reprod 1999 61:1460-1467[Abstract/Free Full Text]
  6. Anderson JE, Matteri RL, Abeydeera LR, Day BN, Prather RS. Degradation of maternal Cdc25c during the maternal to zygotic transition is dependent upon embryonic transcription. Mol Reprod Dev 2001 60:181-188[CrossRef][Medline]
  7. Do HJ, Kim JH, Abeydeera LR, Han YM, Matteri RL, Green JA, Roberts RM, Day BN, Prather RS. Expression of pregnancy-associated glycoprotein 1 and 2 genes in in vivo, in vitro and parthenogenetically derived preimplantation pig embryos. Zygote 2001 9:245-250[CrossRef][Medline]
  8. Machaty Z, Day BN, Prather RS. Development of early porcine embryos in vitro and in vivo. Biol Reprod 1998 59:451-455[Abstract/Free Full Text]
  9. Kawamoto S, Yoshii J, Mizuno K, Ito K, Miyamoto Y, Ohnishi T, Matoba R, Hori N, Matsumoto Y, Okumura T, Nakao Y, Yoshii H, Arimoto J, Ohashi H, Nakanishi H, Ohno I, Hashimoto J, Shimizu K, Maeda K, Kuriyama H, Nishida K, Shimizu-Matsumoto A, Adachi W, Ito R, Kawasaki S, Chae KS, Murakawa K, Yokoyama M, Fukushima A, Hishiki T, Nakaya A, Sese J, Monma N, Nikaido H, Morishita S, Matsubara K, Okubo K. BodyMap: a collection of 3' ESTs for analysis of human gene expression information. Gen Res 2000 10:1817-1827[Abstract/Free Full Text]
  10. Ko MS, Kitchen JR, Wang X, Threat TA, Hasegawa A, Sun T, Grahovac MJ, Kargul GJ, Lim MK, Cui Y, Sano Y, Tanaka T, Liang Y, Mason S, Paonessa PD, Sauls AD, DePalma GE, Sharara R, Rowe LB, Eppig J, Morrell C, Doi H. Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development. Dev Suppl 2000 127:1737-1749
  11. Hamatani T, Carter MG, Sharov AA, Ko MSH. Dynamics of global gene expression changes during mouse preimplantation development. Dev Cell 2004 6:117-131[CrossRef][Medline]
  12. Abeydeera LR, Wang WH, Prather RS, Day BN. Maturation in vitro of pig oocytes in protein-free culture media: fertilization and subsequent embryo development in vitro. Biol Reprod 1998 58:1316-1320[Abstract/Free Full Text]
  13. Hagen DR, Prather RS, Sims MM, First NL. Development of one-cell porcine embryos to the blastocyst stage in simple media. J Anim Sci 1991 69:1147-1150[Abstract]
  14. Adjaye J, Bolton V, Monk M. Developmental expression of specific genes detected in high-quality cDNA libraries from single human preimplantation embryos. Gene 1999 237:373-383[CrossRef][Medline]
  15. Chenchik A, Zhu YY, Diatchenko L, Li R, Hill J, Siebert PD. Generation and use of high-quality cDNA from small amounts of total RNA by SMART PCR. BioTechnique Books, MA 1998:305–319
  16. Jiang H, Bivens NJ, Ries JE, Whitworth KM, Green JA, Forrester LJ, Springer GK, Didion BA, Mathialagan N, Prather RS, Lucy MC. Constructing cDNA libraries with fewer clones that contain long poly(dA) tails. Biotechniques 2001; 31:38+
  17. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000 25:25-29[CrossRef][Medline]
  18. Salles FJ, Darrow AL, O'Connell ML, Strickland S. Isolation of novel murine maternal mRNAs regulated by cytoplasmic polyadenylation. Gene Dev 1992 6:1202-1212[Abstract/Free Full Text]
  19. Charlesworth A, Welk J, MacNicol AM. The temporal control of Wee1 mRNA translation during Xenopus oocyte maturation is regulated by cytoplasmic polyadenylation elements within the 3'-untranslated region. Dev Biol 2000 227:706-719[CrossRef][Medline]
  20. Paillard L, Maniey D, Lachaume P, Legagneux V, Osborne HB. Identification of a C-rich element as a novel cytoplasmic polyadenylation element in Xenopus embryos. Mech Dev 2000 93:117-125[CrossRef][Medline]
  21. Jin SW, Arno N, Cohen A, Shah A, Xu Q, Chen N, Ellis RE. In Caenorhabditis elegans, the RNA-binding domains of the cytoplasmic polyadenylation element binding protein FOG-1 are needed to regulate germ cell fates. Genetics 2001 159:1617-1630[Abstract/Free Full Text]
  22. Oh B, Hwang S, McLaughlin J, Solter D, Knowles BB. Timely translation during the mouse oocyte-to-embryo transition. Dev Suppl 2000 127:3795-3803
  23. Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B, Pertea G, Sultana R, White J. The TIGR gene indices: analysis of gene transcript sequences in highly sampled eukaryotic species. Nucl Acids Res 2001 29:159-164[Abstract/Free Full Text]
  24. Shapiro R. Cytoplasmic ribonuclease inhibitor. In: Nicholson AW (ed.), Ribonucleases, pt A, vol. 34, Methods in Enzymology. San Diego, CA: Academic Press Inc.; 2001:611–628
  25. Aizawa H, Sutoh K, Tsubuki S, Kawashima S, Ishii A, Yahara I. Identification, characterization, and intracellular distribution of cofilin in Dictyostelium discoideum. J Biol Chem 1995 270:10923-10932[Abstract/Free Full Text]
  26. Chen M, Li D, Krebs EG, Cooper JA. The casein kinase II beta subunit binds to Mos and inhibits Mos activity. Mol Cell Biol 1997 17:1904-1912[Abstract]
  27. Litchfield DW, Bosc DG, Slominski E. The protein kinase from mitotic human cells that phosphorylates Ser-209 on the casein kinase II beta-subunit is p34cdc2. Biochim Biophys Acta 1995 1269:69-78[Medline]
  28. Garnier C, Barbier P, Gilli R, Lopez C, Peyrot V, Briand C. Heat-shock protein 90 (hsp90) binds in vitro to tubulin dimer and inhibits microtubule formation. Biochem Biophys Res Commun 1998 250:414-419[CrossRef][Medline]
  29. Kojima T, Udagawa K, Onishi A, Iwahashi H, Komatsu Y. Effect of heat stress on development in vitro and in vivo and on synthesis of heat shock proteins in porcine embryos. Mol Reprod Dev 1996 43:452-457[CrossRef][Medline]
  30. Marion MJ, Marion C. Ribosomal proteins S2, S6, S10, S14, S15 and S25 are localized on the surface of mammalian 40S subunits and stabilize their conformation. A study with immobilized trypsin. FEBS Lett 1988 232:281-285[CrossRef][Medline]
  31. Hasegawa H, Uchiumi T, Sato T, Arakawa M, Kominami R. Anti-Sm autoantibodies cross-react with ribosomal protein S10: a common structural unit shared by the small nuclear RNP proteins and the ribosomal protein. Arthritis Rheum 1998 41:1040-1046[CrossRef][Medline]
  32. Prather RS, Rickords LF. Developmental regulation of an snRNP core protein epitope during pig embryogenesis and after nuclear transfer for cloning. Mol Reprod Dev 1992 33:119-123[CrossRef][Medline]
  33. Pestova TV, Lomakin IB, Lee JH, Choi SK, Dever TE, Hellen CU. The joining of ribosomal subunits in eukaryotes requires eIF5B. Nature 2000 403:332-335[CrossRef][Medline]
  34. Aguilar-Martinez P, Biron C, Masmejean C, Jeanjean P, Schved JF. A novel mutation in the iron responsive element of ferritin L-subunit gene as a cause for hereditary hyperferritinemia-cataract syndrome. Blood 1996 88:1895 (letter, comment) [Free Full Text]
  35. Jensen MR, Audolfsson T, Factor VM, Thorgeirsson SS. In vivo expression and genomic organization of the mouse cyclin I gene (Ccni). Gene 2000 256:59-67[CrossRef][Medline]
  36. Alland L, Muhle R, Hou H Jr, Potes J, Chin L, Schreiber-Agus N, DePinho RA. Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. [see comments]. Nature 1997 387:49-55[CrossRef][Medline]
  37. Mongay L, Plaza S, Vigorito E, Serra-Pages C, Vives J. Association of the cell cycle regulatory proteins p45(SKP2) and CksHs1. Functional effect on CDK2 complex formation and kinase activity. J Biol Chem 2001 276:25030-25036[Abstract/Free Full Text]
  38. Hixon ML, Flores AI, Wagner MW, Gualberto A. Ectopic expression of cdc2/cdc28 kinase subunit Homo sapiens 1 uncouples cyclin B metabolism from the mitotic spindle cell cycle checkpoint. Mol Cell Biol 1998 18:6224-6237[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 ReproductionHome page
V. Duranthon, A. J Watson, and P. Lonergan
Preimplantation embryo programming: transcription, epigenetics, and culture environment
Reproduction, February 1, 2008; 135(2): 141 - 150.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Misirlioglu, G. P. Page, H. Sagirkaya, A. Kaya, J. J. Parrish, N. L. First, and E. Memili
Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos
PNAS, December 12, 2006; 103(50): 18905 - 18910.
[Abstract] [Full Text] [PDF]

Home page
 J ANIM SCIHome page
C. H. Chen, E. C. Lin, W. T. K. Cheng, H. S. Sun, H. J. Mersmann, and S. T. Ding
Abundantly expressed genes in pig adipose tissue: An expressed sequence tag approach
J Anim Sci, October 1, 2006; 84(10): 2673 - 2683.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
K.M. Whitworth, C. Agca, J.-G. Kim, R.V. Patel, G.K. Springer, N.J. Bivens, L.J. Forrester, N. Mathialagan, J.A. Green, and R.S. Prather
Transcriptional Profiling of Pig Embryogenesis by Using a 15-K Member Unigene Set Specific for Pig Reproductive Tissues and Embryos
Biol Reprod, June 1, 2005; 72(6): 1437 - 1451.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
71/4/1230    most recent
biolreprod.104.030239v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.
Agricola
Right arrow Articles by Whitworth, K.
Right arrow Articles by Prather, R. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS