|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Testis |
Division of Reproductive Biology, Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Maryland 21205
| ABSTRACT |
|---|
|
|
|---|
androgen receptor, apoptosis, Sertoli cells, spermatogenesis, testis, testosterone
| INTRODUCTION |
|---|
|
|
|---|
The intratesticular concentration of T in the rat is approximately 4050 times higher than the physiologic T concentration in serum of 12 ng/ml [9]. Interestingly, quantitatively normal spermatogenesis can be maintained in the rat only when intratesticular T (ITT) levels are above 20 ng/ml, a level that is 10-fold greater than in the peripheral circulation [1012]. When T levels within the testis fall below the threshold of 20 ng/ml, step 19 spermatids fail to be released, pachytene spermatocytes undergo apoptosis, and round spermatids are sloughed from the seminiferous epithelium [712]. These events are initiated specifically at stages VIIVIII and presumably occur because of reduced androgen-dependent gene transcription mediated via the AR in Sertoli cells associated with these stages of germ cell development [2, 3, 5, 7, 8]. Germ cells that are lost as a consequence of reduced ITT can be restored to the testis by the administration of high doses of exogenous T that are sufficient to reestablish ITT levels that exceed the critical threshold of 20 ng/ml [911].
The relationships among germ cell dynamics, AR-mediated molecular events, and ITT concentrations have not been established. Immunohistochemical studies have shown a dramatic loss of AR from Sertoli cell nuclei at stages VIIVIII of the seminiferous epithelium, when the concentration of T is profoundly decreased by the administration of a GnRH antagonist, Azaline B [5], or the Leydig cell toxicant ethane dimethanesulfonate (EDS) [13]. This suggests that AR redistribution might be an important consequence of the effect of reduced ITT on germ cell apoptosis. However, the regulation of AR in Sertoli cells by T, involving transcriptional, translational, and posttranslational control mechanisms, also may play important roles. For example, T was reported to decrease the AR mRNA level in Sertoli cells on Day 20 of life [14] but to have stimulatory effects on the level of Sertoli cell AR protein [15, 16]. In studies of the effects of EDS treatment, an alkylating agent that kills Leydig cells, total testis AR mRNA and protein levels were not affected by reduced ITT, but ligand binding assays revealed lower AR protein levels in the nuclear fraction isolated from whole testes of EDS-treated rats [17, 18]. A testable, unifying hypothesis that might explain the relationship of ITT concentration to AR-mediated molecular events that lead to germ cell survival or death is that ITT concentration has effects on intracellular AR localization, AR mRNA, and/or AR protein levels within Sertoli cells at specific stages of the cycle. Perturbations of AR localization and/or protein expression may determine whether germ cells live or die.
The study reported herein was designed to address the previously mentioned hypothesis. We focused on the in vivo effects of changes in T concentration within the Sertoli cell microenvironment, that is, within the seminiferous tubule fluid of the testis, on AR localization, and on AR mRNA and protein levels within Sertoli cells, in relationship to germ cell death. For this reason, rats were implanted with T- and estradiol (E)-filled capsules to reduce ITT secondary to a reduction in serum LH but without a confounding effect on serum FSH levels [9, 10]. Our results show a time-dependent loss of AR nuclear localization in Sertoli cells at stages VIVIII of the seminiferous epithelium and of germ cell apoptosis that accompany the reduction of ITT levels following the administration of contraceptive doses of T and E, with AR protein levels also decreasing. In contrast, AR mRNA levels remained unchanged. Within 24 h following the administration of exogenous T to the rats that had received T/E implants, AR protein was restored, and AR was again localized to Sertoli cell nuclei. These results suggest that, by an as-yet-unknown mechanism, T regulation of AR localization within Sertoli cells and of AR level in turn regulates germ cell life or death.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Male Sprague-Dawley rats, 812 wk of age, were purchased from Charles River Laboratories (Kingston, MA). All rats were housed in a vivarium under a 14:10 light:dark cycle and provided water and rat chow ad libitum. To experimentally suppress LH-stimulated T production from Leydig cells and reduce ITT levels, rats were administered subdermal 2.5 cm T- and 0.1 cm 17
-E-filled polydimethylsiloxane (Silastic, Dow Corning, Midland, TX) capsules for 7, 10, 14, 21, and 28 days or empty capsules as controls, according to methods previously described [19, 20]. To study the acute effects of T restoration following 28 days of T/E treatment, rats were implanted with 3 x 8 cm (24 cm total) T-filled capsules for 6 and 24 h or empty capsules as controls. All protocols used herein were approved by the Johns Hopkins University Animal Care and Use Committee.
Tissue Fixation and Processing
Adult male Sprague-Dawley rats were anesthetized, and the thoracic cavity was opened to expose the heart. The left ventricle of the heart was punctured with a 25G butterfly needle attached to a Cole-Parmer Masterflex L/S Pump (Model 7519-20) via Masterflex 96410-14 tubing. The superior vena cava was severed, and the vasculature was flushed with PBS until the testes were visually devoid of blood. Subsequently, approximately 300 ml of Bouin fixative was infused at a rate of 7 ml/min to fix the testes in situ. The testes were removed, sliced in quarters, and postfixed in Bouin solution for 48 h at 4°C. The testes were washed in 50% ethanol, followed by 70% ethanol, and embedded in paraffin.
Androgen Receptor Immunohistochemistry
Testis tissue sections (6 µm) were deparaffinized and rehydrated through a series of graded alcohols. For antigen retrieval, tissue sections were brought to a boil in 0.01 M citrate buffer (pH 6.0) and then cooled for 20 min, a process that was repeated four times in fresh buffer. Sections were then incubated in 2% H2O2 in PBS for 30 min at room temperature to quench endogenous peroxidase activity and subsequently incubated in PBS containing 1% bovine serum albumin for 1 h at room temperature to block nonspecific binding. Sections were incubated in a humidified chamber with 5 µg/ml anti-human androgen receptor (PG-21; Upstate, Charlottesville, VA) at 4°C overnight. Antibody binding was visualized using the Elite Vectastain ABC kit (Vector Laboratories, Burlingame, CA). Sections were counterstained with 1% methyl green and mounted with Permount. Negative controls had primary antibody or secondary antibody omitted. The localization of AR immunostaining was observed by light microscopy using a Nikon Eclipse E800 microscope (Nikon, Melville, NY) and a Plan Apo 20x or 40x objective. Images were captured utilizing a Princeton 5-MHz cooled CCD camera (Princeton Instruments, Trenton, NJ) and IPLab Spectrum Analysis Software (Scanalytics, Fairfax, VA) and converted to Adobe Photoshop Version 5.5 (Adobe Systems, San Jose, CA). For AR immunostaining studies, testes from three rats per treatment group were used, and at least four testis tissue cross sections were examined from each testis.
In Situ Localization of Apoptotic Cells
Testicular cells undergoing apoptosis were visualized by the TUNEL assay, which labels fragmented DNA with digoxigenin-deoxy-UTP using terminal deoxynucleotidyl transferase as detected by the anti-digoxigenin-conjugated reporter system (Chemicon/Serologicals, Norcross, GA). Briefly, serial sections (6 µm) from the same samples used for AR immunohistochemistry were deparaffinized, rehydrated through a series of graded alcohols and PBS, digested with 20 µg/ml proteinase K for 15 min at room temperature, and washed with water. Endogenous peroxidase activity was quenched in 3% H2O2 in PBS for 5 min, and tissue sections were incubated sequentially in a humidified chamber with equilibration buffer for 10 min at room temperature, terminal deoxynucleotidyl transferase (TdT) and digoxigenin-labeled deoxy-UTP for 1 h at 37°C, and anti-digoxigenin peroxidase conjugate for 30 min at room temperature. Sections were then stained with 3,3'-diaminobenzidine peroxidase (DAB) substrate solution for 2 min and counterstained with 1% methyl green. The presence of TUNEL-positive germ cells was observed by light microscopy with a Plan Apo 20x objective as described previously for androgen receptor immunohistochemistry. The numbers of apoptotic germ cells detected by TUNEL staining were counted in tubules corresponding to specific stages of the cycle of the seminiferous epithelium. Random areas were viewed on testis tissue sections from three animals within each treatment group until a total of 50 tubules corresponding to each grouping of stages (II IV, VIIVIII, or IXXII) were examined.
Radioimmunoassays
Trunk blood was collected and serum was obtained to measure T in the peripheral circulation. Seminiferous tubule fluid (STF) was collected from testes by centrifugation according to the method previously described by Turner et al. [21]. All samples were stored at 80°C. T concentrations in serum and STF were assayed in duplicate by RIA using a testosterone antibody purchased from ICN (Costa Mesa, CA) and 3H-T (New England Nuclear, Boston, MA) as previously described [12, 21]. The sensitivity of the assay was 10 pg/tube.
Seminiferous Tubule Microdissection
Seminiferous tubule segments were isolated from rat testes by transillumination-assisted microdissection as previously described [22]. For RNA isolation, approximately 60 cm of seminiferous tubules at stages II IV, VIVIII, and IXXII were dissected from two testes (one rat, 30 cm per testis) from control rats and from rats implanted with T/E capsules for 7, 10, or 14 days. For protein analyses, approximately 1520 cm of seminiferous tubules from the same stages were dissected from testes of control rats and rats implanted with T/E capsules for 7 or 14 days. Dihydrotestosterone (1 nM) was added to the dissection medium and to the tissue lysis buffer to stabilize the AR protein prior to Western blot analyses [23]. Testes from three different rats (n = 3) were included as independent samples within each experimental group for isolation of RNA or protein.
Sertoli Cell Isolation
Sertoli cells were isolated from whole testes as described by Anway [24], except the 10-min trypsin digestion step was omitted. Briefly, two decapsulated testes were incubated in 0.5 mg/ml collagenase in Hanks buffered salt solution (HBSS), pH 7.4, at 34°C with shaking for 15 min and then washed three times to eliminate the interstitial cells. To separate Sertoli and germ cells, the tubules were incubated in a mixture of enzymes, 0.1% collagenase (C2674; Sigma, St. Louis, MO), 0.2% hyaluronidase (H6254; Sigma), 0.04% DNase I (D5024; Sigma), and 0.03% trypsin inhibitor (T6522; Sigma) in HBSS, pH 7.4, at 34°C with shaking for 40 min. The enriched Sertoli cell fraction was sedimented by centrifugation and washed in HBSS three times. The Sertoli cells were resuspended in HBSS and diluted with 2.5 volumes of 1:10 dilution of HBSS to further eliminate germ cells from Sertoli cells by hypotonic shock. The Sertoli cells were collected by centrifugation, resuspended in HBSS, and filtered through 53-µm nylon mesh. The purified Sertoli cells were washed and finally resuspended in F12/DMEM (1:1) medium. Sertoli cells were counted using a hemocytometer. In each preparation, 57 x 106 Sertoli cells were isolated from each testis. A typical preparation consisted of 75% 80% Sertoli cells as determined by nuclear morphology evaluated microscopically following fixation of the cells in 5% glutaraldehyde/1% osmium tetroxide in 0.1 M cacodylate buffer, embedment in Epon, and staining with 1% toluidine blue/1% sodium borate. Contaminating cells in the preparation consisted of germ (
10%) and peritubular myoid (
10%) cells. Preparations consistently contained <2% nonviable cells as judged by trypan blue exclusion.
Germ Cell Isolation
Pachytene spermatocytes and round spermatids were isolated from the testes of 120-day-old rats by unit gravity sedimentation (Staput) according to methods previously described [25]. The purity of the pachytene spermatocyte and round spermatid fractions was estimated to be 90% for each based on morphologic characteristics of the cells as viewed by light microscopy.
Northern Blot Analysis
RNA was purified from the microdissected seminiferous tubules and freshly isolated Sertoli cells using Trizol according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). Total RNA (8 µg) from the microdissected seminiferous tubules was fractionated on a 1% agarose/formaldehyde gel, transferred overnight to a nylon membrane (Hybond TM-N, Amersham Biosciences, Piscataway, NJ), and cross-linked by UV irradiation (UV Stratagene 1800, Stratagene, La Jolla, CA). Complementary DNA fragments radiolabeled with (alpha-32P) dATP using the Rad Prime DNA Labeling Kit (Invitrogen) were used as probes for specific mRNAs. The cDNA probes were specific for clusterin [26], cathepsin L [27], and ribosomal protein S2 (ChoB) mRNAs. ChoB was used as a control for RNA loading [28, 29]. Northern blots were hybridized overnight at 65°C with labeled cDNA probes in ExpressHyb solution (Clontech, Palo Alto, CA). Following hybridization, membranes were washed in 2x SSC/1.0% SDS for 30 min at 65°C, 1x SSC/0.5% SDS for 30 min at 65°C, and 0.1x SSC/0.1% SDS for 30 min at 65°C. The signals were detected using a phosphor screen and Typhoon 9200 Imaging System (Amersham Biosciences).
Relative Levels of mRNA Determined by Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA (1.5 µg) from microdissected seminiferous tubules and freshly isolated Sertoli cells was reverse transcribed in a 20-µl reaction at 46°C for 60 min using 0.2 units of Superscript II (Invitrogen) and 50 ng of oligo-dT primer in first-strand synthesis buffer according to the manufacturer's specifications. PCR was performed in a reaction volume of 25 µl containing 0.5 µl of the RT reaction, 400 nM sense primer, and 400 nM antisense primer using the QuantiTech SYBR green PCR kit (Qiagen, Valencia, CA). Each reaction was spiked with 0.05 units of Taq polymerase (Invitrogen) to amplify cDNA products greater than 250 bp. Gene-specific primers were as follows: for AR, 5' GGGGCAATTCGACCATATCT (sense) and 5' CCCTTTGGCGTAACCT (antisense) to amplify a 277-bp fragment corresponding to the region 16611938 of the AR cDNA GenBank accession number M20133 [30]; for ABP, 5' CAGCAAACCCTCTTCCTCC (sense) and 5' TTCCATCCACCCATAGCAGCAG (antisense) to amplify a 516-bp fragment corresponding to the region 2038 2554 of the ABP cDNA GenBank accession number M19993 [31]; and for ribosomal L19, 5' CTGAAGGTCAAAGGGAATGTG (sense) and 5' GGACAGAGTCTTGATGATCTC (antisense) to amplify a 195-bp fragment corresponding to the region 401595 of the L19 cDNA GenBank accession number NM031103. The PCR conditions were 26 cycles at 94°C for 20 sec, 56°C for 20 sec, and 72°C for 45 sec, with a final extension at 72°C for 1 min. PCR products (10 µl) were separated on a 1.5% agarose gel, and the fluorescent signal was detected using a Typhoon 9200 Imaging System and quantified using ImageQuant software (Amersham Biosciences). PCR products were cloned into p-GemT Easy Vector (Promega, Madison, WI) and sequenced to validate the cDNA insert against the GenBank database. Signal intensities were normalized to L19 expression with the ratio of 1.0 assigned to the control group, and all treatment groups are presented relative to the control.
Western Blot Analysis
Seminiferous tubule segments, testis, pachytene spermatocytes, round spermatids, spleen, kidney, or liver were homogenized in RIPA buffer (1% Triton X-100, 15 mM Hepes pH 7.5, 0.15 mM NaCl, 1% sodium deoxycholate, 0.1% SDS, 1 mM sodium orthovanadate, 10 mM EDTA, 1 nM DHT, and 0.5% protease inhibitor cocktail). Protein concentration was determined by the BCA method (Pierce, Rockford, IL). The protein samples were added to an equal volume of 2x loading buffer (100 mM Tris pH 6.8, 4% SDS, 0.2% bromophenol blue, and 20% glycerol), sonicated for 30 sec, and stored at 20°C until analyzed. Prior to analyses, samples were reduced with 0.1% beta-mercaptoethanol, boiled for 2 min, and loaded for electrophoresis on 10% SDS-polyacrylamide gels as described [32]. Protein was transferred to Protran Nitrocellulose (Schleicher & Schuell, Keene, NH) with a Trans-Blot SD Semi Dry Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA) according to the manufacturer's specifications.
AR protein was detected by Western blot analyses using anti-AR antibody (N-20, Santa Cruz Biotechnology, Santa Cruz, CA) as previously described [23]. Briefly, membranes were blocked for 30 min with 10% nonfat dry milk in PBS plus 0.2% Tween 20 (PBS + T) and then incubated overnight at room temperature in 1% nonfat milk in PBS + T and anti-AR antibody (1:500). The next day, the membranes were washed in PBS + T and incubated in a secondary anti-rabbit HRP-linked IgG (1: 3000) in PBS + T for 1 h at room temperature. The chemiluminescent signal was detected on film using the SuperSignal WestPico Chemiluminescent kit (Pierce) according to the manufacturer's specifications. Membranes were then stripped using Restore Western Blot Stripping Solution (Pierce) according to the manufacturer's instructions. Membranes were reblocked for 1 h in 5% nonfat dry milk in TBSS (25 mM Tris, 137 mM NaCl, 3 mM KCl) and 0.1% Tween 20 (blocking solution) at room temperature, followed by anti-beta actin antibody (1:1000, A5441; Sigma) and/or anti-tyrosine tubulin (1:1000, T9028; Sigma) for 3 h in blocking solution followed by anti-mouse HRP-linked IgG (1:3000) for 1 h at room temperature. The chemiluminescent signal for each protein was detected as described previously. All films were scanned and intensities quantified by MacBAS software version 2.2 (Fuji Photo Film, Edison, NJ). Signal intensities were normalized to Sertoli cell tyrosine tubulin expression with a ratio of 1.0 assigned to the control groups and the treatment groups represented relative to the control. Equivalent amounts of total protein in samples were verified by detection of actin expression.
Statistical Analysis
Data are expressed as the mean + SEM for three to five animals per group. Statistical differences involving multiple group comparisons were determined by one-way ANOVA followed by a multiple-range test according to the Scheffe F-test (P < 0.05).
| RESULTS |
|---|
|
|
|---|
As shown in Figure 1A, testis weights decreased significantly by 7 days of T/E administration, with further reductions seen through 28 days. These results coincide with the progressive loss of germ cells as previously reported [8, 9, 12]. As expected, testis weights did not change at 6 or 24 h of T replacement.
|
Serum T concentrations did not change over the course of T/E administration for 28 days (Fig. 1B). However, as seen in Figure 1C, the concentration of T in STF was significantly reduced from 160 ng/ml in control rats to approximately 20 ng/ml within 7 days after T/E administration. At subsequent times following implantation of T/E capsules, the T concentration was further reduced, reaching approximately 9 ng/ml by 28 days. When the T/E capsules were removed and replaced with 24 cm T-filled capsules, serum T concentrations increased significantly at 6 and 24 h (Fig. 1B), and the T concentration in the STF increased to over 30 ng/ml (Fig. 1C).
Germ Cell Apoptosis Fragmented DNA (TUNEL)
The decrease in testis weights in response to T/E administration coincided with increased apoptosis of germ cells, as detected by the TUNEL assay (Fig. 2). Only a few apoptotic germ cells typically were observed in testes from control (Fig. 2A) and 7-day T/E-treated (Fig. 2B) rats. An obvious increase in the number of apoptotic germ cells was seen in tubules at stages VIVIII (Fig. 2C) but not other stages by 10 days of T/E treatment (Table 1). More apoptotic germ cells began to appear in stages IIIV and IX XII, as well as stages VIVIII, by 14 days of T/E treatment (Fig. 2D and Table 1). A large number of apoptotic germ cells were observed in all tubules by 21 days of T/E treatment (Fig. 2E and Table 1).
|
|
AR Immunohistochemistry
In the testes of control animals (Fig. 3, A and B), nuclear AR immunostaining was prominent in Sertoli cells at stages VIIVIII of the cycle of the seminiferous epithelium and not at other stages and also in the nuclei of peritubular myoid and Leydig cells throughout the testis. In testes from rats treated with T/E for 7 (Fig. 3, C and D) and 10 (Fig. 3, E and F) days, AR staining intensity became notably reduced in stage VIIVIII Sertoli cell nuclei. By Day 14 of T/E treatment (Fig. 3, G and H), Sertoli cell nuclear AR immunostaining was absent and remained so through 21 (Fig. 3, I and J) and 28 days (Fig. 3, K and L). By contrast, AR immunostaining was still visible in the nuclei of peritubular myoid and Leydig cells throughout the course of T/ E treatment (Fig. 3, AL). The apparent immunostaining present within the tubules of T/E-treated animals resembled that ascribed to steps 1119 elongated spermatids, including the residual bodies, by Vornberger et al. [2]. The failure of Sertoli cells to release step 19 spermatids following T/ E treatment may account for the persistence of immunostaining within the tubules [8]. When Sertoli cells were viewed in longitudinal cross section at higher magnification (100x), immunostaining was not present within the cytoplasm of Sertoli cells (data not shown). When animals treated with T/E for 28 days received 24 cm T implants to partially restore ITT levels, AR immunostaining in Sertoli cell nuclei at stages VIIVIII was restored within 6 h (Fig. 3, M and N) and increased further in intensity by 24 h (Fig. 3, O and P). When primary or secondary antibodies were omitted, there was no staining (data not shown). Identical cell- and stage-specific nuclear AR immunostaining was observed with the PG-21 and N-20 AR antisera (data not shown).
|
RT-PCR Analyses of AR and ABP mRNA
We asked whether the diminished AR protein in Sertoli cell nuclei at 7 and 10 days of T/E treatment and its absence by 14 days were related to changes in the steady-state mRNA levels of AR. Additionally, because ABP plays a role in determining the bioavailability of T within the seminiferous tubules and the expression of ABP by Sertoli cells was shown in some studies to be under T regulation, we also measured ABP mRNA levels in concert with the levels of AR mRNA. Relative mRNA levels were analyzed ex vivo by RT-PCR in Sertoli cells freshly isolated from testes of control and 7-, 14-, and 28-day T/E-treated rats and 28-day T/E-treated rats in which T was replaced for 24 h. Figure 4A illustrates the amplified products for AR and ABP mRNAs and Figure 4B the relative intensities of the amplified products. AR mRNA levels remained constant through 14 days of T/E treatment but increased significantly by 28 days of T/E treatment compared to control levels (Fig. 4B). ABP mRNA levels were unchanged throughout the course of the treatments. Sertoli cells isolated from rats in which ITT levels were restored for 24 h had no significant change in AR or ABP mRNA levels as compared to Sertoli cells from 28-day T/E-treated rats (Fig. 4B). Similarly, neither AR nor ABP mRNA levels changed within 24 h when the T/E capsules were removed after 28 days and replaced with an empty capsule.
|
Following androgen withdrawal, the stages of the seminiferous epithelium can still be distinguished. Utilizing transillumination-assisted microscopy, we were able to collect stage-specific segments of seminiferous tubules from testes of rats treated with T/E for up to 14 days. The staging of the microdissected seminiferous tubules collected from control and 7- and 14-day T/E-treated rats was determined by morphological criteria and verified by Northern blot analyses of cathepsin L and clusterin mRNAs (Fig. 5A) based on the knowledge that cathepsin L mRNA is expressed at high levels during stages VIVIII and at low levels during stages IXXII and IIIV [33], whereas clusterin mRNA levels are high and relatively constant throughout the stages [34]. ChoB was used as a loading control for the RNA in the Northern blot analyses.
|
Using RNA isolated from the same stage-specific microdissected tubules shown in Figure 5A, we measured the expression of AR and ABP mRNA levels for stages IIIV (Fig. 5B), VIVIII (Fig. 5C), and IXXII (Fig. 5D) of the seminiferous epithelium of control and 7-, 10-, and 14-day T/E-treated rats by RT-PCR. AR mRNA levels were increased significantly compared to controls in tubule segments from stages IIIV (Fig. 5B) at 10 and 14 days of T/ E treatment but remained constant at stages VIVIII (Fig. 5C) and IXXII (Fig. 5D). ABP mRNA levels increased significantly in tubule segments from stages IIIV and VI VIII following 14 days of T/E treatment but were unchanged in stages IXXII (Fig. 5).
Western Blot Analyses of AR protein
AR immunostaining in Sertoli cell nuclei at stages VII VIII decreased in response to reduced STF T levels, but steady-state levels of AR mRNA did not decrease. Western blot analyses were used to determine the steady-state levels of AR protein in seminiferous tubules at specific stages of the cycle, similar to the mRNA levels determined by RT-PCR analyses. The specificity of the anti-AR antibody for Western blot analyses was determined using protein extracts from whole testis, pachytene spermatocytes, round spermatids, spleen, kidney, and liver (Fig. 6). The
110-kDa AR protein was detected in testis and weakly in the kidney but not in pachytene spermatocytes, round spermatids, liver, or spleen.
|
Western blot analyses of seminiferous tubules from stages IIIV, VIVIII, and IXXII, shown in Figure 7A, demonstrated that the AR protein level was significantly decreased in all stages at 7 and 14 days of T/E treatment. In Figure 7B, each treatment group is presented as the relative change in AR protein level from the control level, normalized to a value of 1.0, within a given stage. Expression of tyrosine tubulin, specific for Sertoli cells within the seminferous epithelium, was used to normalize the amount of AR protein. The consistency of actin levels shows that equivalent amounts of total protein were loaded for each sample. In stages IIIV, AR protein levels decreased by 50% and 72% following T/E treatment for 7 and 14 days, respectively. A similar trend was seen in stages VIVIII and IXXII, in which AR protein levels decreased 20% and 38%, respectively, following T/E treatment for 7 days and by 68% and 70%, respectively, following T/E treatment for 14 days. Beyond 14 days of T/E treatment, seminiferous tubule segments of defined stages could no longer be identified by transillumination microscopy. Instead, Western blot analyses for AR were performed on protein extracts from whole testes. As shown in Figure 8, AR protein levels in testes from rats treated for 28 days with T/E were decreased by 58% from control, an effect that was reversed within 24 h by T replacement. As with the Western blot analyses of Figure 7, tyrosine tubulin was used to normalize the results, and actin was used as a loading control.
|
|
| DISCUSSION |
|---|
|
|
|---|
We show herein that the increased number of apoptotic germ cells observed by TUNEL staining after 1014 days of T/E treatment was specific to spermatocytes in seminiferous tubules at stages VIIVIII. AR immunolocalization in Sertoli cell nuclei in stage VIIVIII tubules was no longer observed once the ITT concentration fell below its critical threshold for maintenance of spermatogenesis. The correlation between loss of Sertoli cell nuclear AR localization and apoptosis of germ cells suggests a functional disruption of AR-mediated androgen action in Sertoli cells specific to stages VIIVIII of the seminiferous epithelium. We did, however, observe an unexplained compensatory increase in AR mRNA level in stage IIIV seminiferous tubules after 10 and 14 days of T/E treatment that coincided with the critical decrease in ITT concentration.
Our studies further examined the stage-specific loss of Sertoli cell nuclear AR localization and the apparent disruption of AR-mediated androgen action in Sertoli cells at the levels of AR mRNA and protein expression at various stages of the seminiferous epithelium. We used RT-PCR of RNA from isolated Sertoli cells and seminiferous tubule segments to show that despite the dramatic decrease in Sertoli cell nuclear AR immunolocalization following the diminution of ITT levels, steady-state measurements of AR mRNA in microdissected stage-specific seminiferous tubule segments and in isolated Sertoli cells were not significantly affected. If the concentration of ITT regulated AR mRNA levels, we would have expected a dramatic change in steady-state AR mRNA levels following the significant decrease in ITT concentration provoked by implantation of T/E capsules. Rather, we observed a significant increase in the relative level of AR mRNA in seminiferous tubules from stages IIIV on Days 10 and 14 following T/E treatment but no change in AR mRNA levels in tubules from stages VIVIII or IXXII through 14 days of T/E treatment. Similarly, we did not observe changes in AR mRNA levels of Sertoli cells isolated from whole testes during the period up to 14 days of T/E treatment, but AR mRNA levels increased by 28 days of T/E treatment in isolated Sertoli cells.
Interestingly, Shan et al. [35] previously concluded that AR protein levels in Sertoli cells were regulated primarily at the level of AR gene transcription. Their quantitative in situ hybridization assays showed that AR mRNA levels in Sertoli cells increase during stages IVV and peak during stages VIIVIII of the seminiferous epithelium, thus correlating with the maximal immunocytochemical localization of AR protein in Sertoli cell nuclei at stages VIIVIII. However, similar to our findings, Blok et al. [17] reported that AR mRNA levels as measured by Northern blots with total testis RNA were not affected following treatment of rats with the Leydig cell toxicant EDS, which also reduces ITT levels. Taken together, we conclude that the steady-state levels of AR mRNA in Sertoli cells are not regulated by the concentration of ITT.
We subsequently used Western blots to show that the levels of AR protein were significantly decreased in microdissected stage-specific seminiferous tubule segments and in whole testis homogenates following T/E treatment. Interestingly, AR protein was detected in seminiferous tubule segments from control rats at stages IIIV, VIVIII, and IXXII despite the observation that AR was localized to Sertoli cell nuclei at stages VIVIII but not in stages IIIV or IXXII. We cannot, however, exclude the possibility that the AR protein and mRNA measured in seminiferous tubule segments from stages IIIV and IXXII is derived from peritubular myoid cells rather than Sertoli cells. Perhaps AR protein redistributes to the Sertoli cell cytoplasm, although significant reductions in total AR protein levels were observed at 7 and 14 days of T/E treatment in tubule segments from each of the different stages of the seminiferous epithelium. This decrease in AR protein levels following reduction of the ITT concentration was also confirmed in whole testis homogenates from rats treated with T/E for 28 days from which staged tubule segments could not be microdissected by transillumination-assisted microscopy.
A critical factor in our ability to detect AR protein on Western blot analyses was the inclusion of 1 nM DHT in the buffers used to microdissect the seminiferous tubules and prepare the protein extracts [23]. In the absence of DHT during the tissue preparative phase, we were unable to detect AR protein by Western blot utilizing several different AR-specific antisera. This technical observation may explain results obtained by Blok et al. [17, 18], who reported the complete loss of immunoassayable AR in testicular cells following administration of EDS. They were unable to detect AR protein in total testis homogenates from EDS-treated rats by immunoprecipitation or Western blot, an effect that was prevented if EDS-treated rats were immediately given implants containing T. They supposed that this was due to a structural modification of AR that prevented its detection by specific AR antisera following prolonged absence of androgen rather than a decrease in the amount of AR protein. On the basis of our work, however, we conclude that absolute levels of AR protein in testicular cells, specifically Sertoli cells, are decreased following T/ E treatment.
Of particular interest is the rapid return of AR protein levels within 24 h following replacement of T to restore the ITT concentration that follows the significant decrease in testicular AR protein levels of 28-day T/E-treated rats. Sertoli cell AR mRNA levels were increased after T/E treatment for 28 days and remained elevated 24 h following T replacement. Within 6 h of T replacement, AR nuclear localization in Sertoli cells reappeared in a subset of seminiferous tubules at specific stages. By 24 h following restoration of ITT levels in the range of 3035 ng/ml, AR protein levels in the testis measured on Western blots matched the levels observed in control rats. The acute response to testosterone further suggests that additional paracrine factors within the testis are not required for the relocalization of AR within nuclei of Sertoli cells. These results agree with previous reports in which the nuclear localization of AR in Sertoli cells was maintained or restored by more long-term replacement of androgen subsequent to the reduction of ITT concentration by treatment with EDS [13] or a gonadotropin antagonist [5].
In summary, we propose that the intratesticular level of T has a primary role to regulate the translation and/or posttranslational stability of the AR protein and to promote its nuclear translocation for transactivation of androgen-regulated genes. This conclusion is based on our present in vivo experiments that demonstrated a reduction in AR protein levels in Sertoli cells following T deprivation but no effect or an increase in AR mRNA levels. Our conclusion regarding posttranslational stability of AR is supported by previous in vitro studies showing that AR stability is increased in the presence of its ligands, T or DHT, part because of interactions between the amino- and carboxy-terminal domains of the receptor [37]. Caspase 3 can cleave the AR amino-terminal transactivation domain and remove the epitope recognized by the PG-21 and N-20 AR antibodies used in our study [38]. Alternatively, proteolysis of the carboxy-terminal ligand-binding domain would disrupt testosterone binding, androgen-dependent nuclear localization, and transcriptional activation of AR in Sertoli cells [38].
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Terry R. Brown, Division of Reproductive Biology, Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, Room W3606, 615 North Wolfe St., Baltimore, MD 21205. FAX: 410 614 2356; tbrown{at}jhsph.edu ![]()
3 Current address: Washington State University, Center of Reproductive Biology, Pullman, WA 99164 ![]()
Received: 13 March 2004.
First decision: 7 April 2004.
Accepted: 10 June 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R.-S. Wang, S. Yeh, C.-R. Tzeng, and C. Chang Androgen Receptor Roles in Spermatogenesis and Fertility: Lessons from Testicular Cell-Specific Androgen Receptor Knockout Mice Endocr. Rev., April 1, 2009; 30(2): 119 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, J. Hill, M. Holland, Y. Kurihara, and K. L. Loveland Bovine Sertoli Cells Colonize and Form Tubules in Murine Hosts Following Transplantation and Grafting Procedures J Androl, July 1, 2008; 29(4): 418 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-S. Wang, S. Yeh, L.-M. Chen, H.-Y. Lin, C. Zhang, J. Ni, C.-C. Wu, P. A. di Sant'Agnese, K. L. deMesy-Bentley, C.-R. Tzeng, et al. Androgen Receptor in Sertoli Cell Is Essential for Germ Cell Nursery and Junctional Complex Formation in Mouse Testes Endocrinology, December 1, 2006; 147(12): 5624 - 5633. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Asirvatham, M. Schmidt, B. Gao, and J. Chaudhary Androgens Regulate the Immune/Inflammatory Response and Cell Survival Pathways in Rat Ventral Prostate Epithelial Cells Endocrinology, January 1, 2006; 147(1): 257 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ye, S. J. Han, S. Y. Tsai, F. J. DeMayo, J. Xu, M.-J. Tsai, and B. W. O'Malley Roles of steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF) 2 in androgen receptor activity in mice PNAS, July 5, 2005; 102(27): 9487 - 9492. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. L. Tan, K. De Gendt, N. Atanassova, M. Walker, R. M. Sharpe, P. T. K. Saunders, E. Denolet, and G. Verhoeven The Role of Androgens in Sertoli Cell Proliferation and Functional Maturation: Studies in Mice with Total or Sertoli Cell-Selective Ablation of the Androgen Receptor Endocrinology, June 1, 2005; 146(6): 2674 - 2683. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou, J. E. Shima, R. Nie, P. J. Friel, and M. D. Griswold Androgen-Regulated Transcripts in the Neonatal Mouse Testis as Determined Through Microarray Analysis Biol Reprod, April 1, 2005; 72(4): 1010 - 1019. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |