| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Testis |
Grup de Recerca en Endocrinologia Molecular3
Departament d'Anatomia Patològica,4 Hospital Universitari Vall d'Hebron, 08035 Barcelona, Spain
Department of Cell Biology,5 Georgetown University Medical Center, Washington, DC 20007
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
androgen-binding protein, apoptosis, estradiol receptor, estrogen receptor ß, male reproductive tract, meiosis, spermatogenesis, testis
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
knock-out mouse and that the fertility problems reported are due to the inability to regulate the reabsorption of luminal fluid in the head of the epididymis [12] and/or disruption of somatic cell function [13], estrogen action in spermatogenesis must control distinct functions in the germ cell compartment, and presumably via the second estrogen receptor, ERß. Indeed, one potential activity is the progression of the first meiotic division, one of the most strictly regulated points of spermatogenesis. A mouse model overexpressing a rat androgen-binding protein (rABP) transgene was developed to better understand the role of this ubiquitously expressed protein in spermatogenesis [14, 15]. Examination of the testes from these transgenic mice at the light and ultrastructural levels revealed that germ cell differentiation was arrested at the first meiotic division in some tubules and that primary spermatocytes degenerate by an apoptotic process [16]. Although plasma and intratesticular testosterone levels in these transgenic mice were not significantly different when compared with nontransgenic littermates [17], Leydig cells in the transgenic mice showed remarkable ultrastructural signs of hyperfunction [18]. A plausible explanation for this structural evidence of Leydig cell hyperactivity is that high levels of rat ABP in the seminiferous tubular compartment of these transgenic mice causes a marked reduction of free testosterone levels within the Sertoli cells and associated germ cells [16], reducing the substrate for the production of intratesticular estrogens by aromatase. A similar Leydig cell phenotype, with the association of increased levels of circulating luteinizing hormone, has been described in mice lacking a functional aromatase gene (ArKO) [19].
In the present study, we address the possibility that overexpression of ABP in the testis is associated with changes in the expression of ERß in pachytene spermatocytes that arrest at meiosis and degenerate by apoptosis as a consequence of a reduction in the amount of estradiol available to germ cells.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The rABP transgenic mouse line used for the present study has been described previously [14–16, 18]. Identification of animals carrying the rat ABP transgene was performed by PCR analysis or Southern blot hybridization [16]. A total of 43 animals were used, including 12 nontransgenic littermates, 18 heterozygous, and 13 homozygous transgenic mice. All animals were killed by CO2 inhalation before tissue collection. One testis from each animal was fixed in 4% paraformaldehyde for 24 h, subsequently embedded in paraffin, and used for TUNEL assay and immunohistochemistry (see below). The other testis was minced, immediately frozen, and used for RNA and protein extraction (see below). Some testes were also used for germ cell isolation (see below). Nontransgenic and transgenic mice were killed and analyzed simultaneously whenever possible. All experimental procedures were conducted in accordance with institutional standards that fulfill the requirements established by the Spanish Government and the European Community (BOE 67, 3/18/88, Real Decreto 223/1988, and BOE 256, 10/25/90).
Germ Cell Isolation
Germ cells were isolated from the testes of five heterozygous and three homozygous rABP transgenic mice, as well as three nontransgenic littermates, all at 3 mo of age, as previously described [16]. The isolated germ cells were counted and resuspended in mRNA extraction buffer, provided in the Quickprep mRNA purification kit from Pharmacia Biotech (Piscataway, NJ). This protocol ensures the purity of the germ cell fraction as it has been shown using vimentin as a marker for Sertoli cell contamination [20].
Messenger RNA Isolation and Analysis by RT-PCR and Northern Blotting
Poly(A+) RNA was isolated from unseparated testicular cells and from isolated germ cells using a Quickprep mRNA purification kit (Pharmacia Biotech) according to the supplier instructions. For PCR amplification, eluted mRNA (0.25 ng) was reverse transcribed using 200 U of Superscript II RNase H- Reverse Transcriptase (Life Technologies, Inc.) and oligo-dT primer, at 42°C for 50 min. One microliter of the resulting complementary DNA (cDNA) was amplified in a 50-µl reaction, in the presence of 2 U Taq polymerase (Ecogen, Barcelona, Spain), 0.05 mM MgCl2, 0.2 mM of dNTPs, and 0.1 µM of specific primers for ERß (GAGGGGAAGTGCGTGGAAGG, CCCGAGATTGAGGACTTGTACCC, spanning from exon 6 to 8) and for cyclophilin A (ATGGTCAACCCCACCGTG, CAGATGGGGTAGGGACG) as a control, in different microtubes. Amplification was carried out in nonsaturating conditions consisting of 40 cycles of amplification for ERß and 30 cycles for the control gene. Annealing was performed at 58°C for 30 sec. PCR products, sized 430 base pairs (bp) and 570 bp, respectively, were separated on a 2% agarose gel, and quantified by the Molecular Analyst/Macintosh data analysis software using a Bio-Rad Image Analysis System (Bio-Rad Laboratories, Inc., Hercules, CA). The products of amplification were purified using the QIAquick PCR Purification Kit (Quiagen, Hilden, Germany) according to supplier instructions and sequenced using an Abi Prism 310 genetic analyzer (Applied Biosystems, Foster City, CA).
For Northern blot analysis of ERß, 2 µg poly(A+) RNA were fractionated by electrophoresis in a denaturing agarose gel (1.5%) with formaldehyde and blotted onto a Nybond nylon membrane by capillary transfer. A 430-bp cDNA probe was prepared by purification of the RT-PCR product obtained with ERß-specific primers, using the QIAquick PCR purification product system (Quiagen). The probe was labeled with [-32P] dCTP using a random Primer Kit (Promega, Madison, WI) and was used to probe the membrane in a formamide-containing solution, at 42°C, overnight. After several washes with decreasing concentrations of sodium chloride/sodium citrate (SSC) and sodium dodecyl sulfate (SDS) buffer, the membrane was subjected to autoradiography and the hybridization signals were analyzed using the Bio-Rad Image Analysis System (Bio-Rad Laboratories).
Protein Extraction and ERß Quantitation by Western Blot Analysis
Total protein was extracted from testes of two heterozygous and two homozygous transgenic mice and two nontransgenic littermates, all 3 mo of age. Tissue was digested using RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) that contained the protease inhibitors phenylmethylsulfonyl fluoride (0.2 mM), aprotinin (5 mg/ml), and leupeptin (5 mg/ml), at 4°C overnight. The homogenates were centrifuged for 10 min at 13 000 x g, and protein concentrations were measured in the resultant supernatants by the Bio-Rad Dc Protein assay (Bio-Rad Laboratories). An equal amount of protein from each sample (50 µg) was subjected to electrophoresis in a 10% SDS-polyacrylamide gel under reducing conditions, and transferred electrophoretically onto polyvinylidene diflouride (PVDF) membranes (Schleicher and Schuell, Dassel, Germany). Membranes were incubated in a blocking solution (PBS containing 5% powdered skim milk and 0.01% Tween-20) at room temperature for 2 h and then in the same solution containing a goat polyclonal antibody against mouse ERß (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), at 4°C overnight. After three washes in PBS containing 0.01% Tween-20, membranes were incubated with horseradish peroxidase-labeled secondary goat antiserum, diluted 1:2000 in the blocking solution, at room temperature for 1 h. The immunoreactive bands were visualized by enhanced chemiluminescence with the ECL system (Amersham Pharmacia Biotech, Arlington Heights, IL), according to manufacturer instructions and quantified densitometrically using the Bio-Rad Image Analysis System. The specificity of the immunoreaction was demonstrated by incubating the antibody with an excess of the ERß peptide (sc-6821P; Santa Cruz Biotechnology) following the supplier instructions. To confirm that similar amounts of protein were loaded onto each lane, membranes were stained with Coomassie brilliant blue R-250.
TUNEL Analysis and Immunohistochemistry for ERß in Testicular Sections
The TUNEL assay and immunohistochemistry for ERß were performed in consecutive testicular sections of six heterozygous and six homozygous rABP transgenic mice and four nontransgenic littermates. The TUNEL assay was performed as described [16]. For the immunohistochemical analysis, two different primary polyclonal antibodies raised against the amino-terminal region of mouse ERß were used: one obtained in goat (sc-6821; Santa Cruz Biotechnology) and the other in rabbit (PA1-311; Affinity Bioreagents Inc., Golden, CO). In brief, dewaxed sections were incubated in a 95°C preheated target retrieval solution for 2 min 30 sec (DAKO Corporation, Carpinteria, CA), cooled to room temperature for 10 min, and treated with a 0.03% hydrogen peroxide solution for 7 min. Sections were then either blocked with 3% normal rabbit serum and incubated with the goat polyclonal antibody, diluted to 3 µg/ml, at 4°C overnight, or blocked with 3% normal goat serum and incubated with the rabbit polyclonal antibody, at the same dilution and conditions. After washing in PBS, the sections incubated with the goat primary antibody were exposed to biotinylated rabbit anti-goat IgG (Vector Laboratories, Burlingham, CA) as secondary antibody for 30 min and treated with the avidin-biotin complex (Vectastain ABC Kit; Vector Laboratories) at 37°C for 45 min. Alternatively, the sections incubated with the rabbit primary antibody were treated with the rabbit EnVision-Plus Peroxidase reagent system (DAKO Corporation) containing goat anti-rabbit immunoglobulins conjugated to a peroxidase-labeled dextran polymer in Tris-HCl buffer, at room temperature, for 30 min. In both cases, bound peroxidase was visualized using 0.01% hydrogen peroxide and 0.05% diaminobenzidine in PBS. Quantification of TUNEL and ERß-labeled cells was performed in testicular sections of rABP transgenic mice (two homozygous and three heterozygous) and in two nontransgenic littermates. Two parameters were recorded: number of labeled cells per labeled tubules and number of labeled tubules per total tubules analyzed.
Confocal Analysis of Fluorescent TUNEL Assay and ERß Immunohistochemistry
Paraffin sections were dewaxed and rehydrated, as described above, and treated with 20 µg/ml proteinase K at room temperature for 15 min. After PBS washing, sections were incubated in the preheated target retrieval solution, as described, and cooled at room temperature for 10 min. Sections were then blocked with 3% normal rabbit serum for 2 h and incubated with 7.5 µg/ml of the ERß (sc-6821) antibody, at 4°C overnight. After PBS washing, sections were exposed to ImmunoPure Rhodamine-conjugated rabbit anti-goat (Pierce Chemical Company, Rockford, IL), diluted 1:75 in PBS, washed again, and incubated in terminal deoxynucleotidyltransferase (TdT) buffer for 30 min. The samples were then treated with 0.05 U/µl TdT (Roche Applied Science, Penzberg, Germany) and 0.5 nM fluorescein 12 dUTP (Roche Applied Science) in TdT buffer, at 37°C for 90 min, and with 300 mM NaCl and 300 mM sodium citrate, at room temperature for 15 min. Finally, sections were washed in PBS and mounted in Immuno-Fluore mounting medium (ICN Pharmaceuticals, Inc., Costa Mesa, CA). The fluorescent labeling was analyzed with a laser scanning confocal microscope (Leica DMIRB/E). Rhodamine was excited by the 568-nm line and fluorescein by the 488-nm line. Single consecutive confocal planes through the Z-axis were analyzed.
Statistical Analysis
For experiments shown in Figures 1 and 2, at least three replicates were used for each group within an experiment. Analysis of variance was used to assess statistical significance between group means, and groups were considered to be statistically different at P 
0.05.
|
|
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The levels of ERß mRNAs were measured by RT-PCR in unseparated testicular cells and/or in isolated germ cells of heterozygous and homozygous rABP transgenic mice and wild-type mice (Fig. 1A). The sequence analysis of the products confirmed the identity of the amplified cDNA. The ERß mRNA levels were significantly higher (P < 0.05) in unseparated testicular cells of homozygous rABP transgenic mice compared with wild-type animals, and this increase was more evident when the mRNA obtained from germ cells were analyzed. To confirm this observation, poly(A+) RNA from rABP transgenic and wild-type mice was analyzed by Northern blotting. The membrane was probed with a 430-bp cDNA that recognized nucleotides 972–1402 of mouse ERß (GenBank sequence U81451) and with a 570-bp cDNA that recognized nucleotides 42–612 of mouse cyclophilin A (CypA) (GenBank sequence X52803) as a control gene. The ERß probe detected one band of approximately 1.4 kb in all the samples analyzed. A comparison of the ratios between the ERß and CypA bands showed an increase in ERß transcripts in homozygous mice compared with controls (P < 0.08) (Fig. 1B), confirming the RT-PCR results obtained using unseparated testicular cells.
The analysis of ERß protein in testicular extracts by Western blot using the ERß (sc-6821) antibody showed the presence of two bands, sized approximately at 80 kDa and 55 kDa (Fig. 2A), coincident with results demonstrated with another antibody that recognizes the carboxy-terminus of ERß (PA1-310) [21]. In the testes of heterozygous and homozygous rABP transgenic mice, there was an increase in the 55-kDa band intensity compared with wild-type mice (Fig. 2A). The specificity of the reaction was confirmed by the disappearance of both bands when the antibody was preabsorbed with an excess of blocking peptide (Fig. 2B).
Immunolocalization of ERß
In wild-type mice, using the ERß antibody PA1-311, a robust staining in Sertoli cells and Leydig cell nuclei and, albeit less intense, in elongated spermatids and spermatozoa was detected (Fig. 3, a and b). In contrast, using the ERß antibody sc-6821, no signal was noticed (Fig. 3d). In transgenic mice, the ERß immunolabeling using both antibodies was strongly detected in Leydig cells and elongated spermatids, as demonstrated previously with the ERß antibody PA1-311 [22], whereas Sertoli cells showed a weaker signal. However, the main difference between rABP transgenic and wild-type testes was the appearance of a strong staining in pachytene spermatocytes and metaphase cells clustered in some tubules (Fig. 3, c, e, and f). Interestingly, the enhanced pachytene spermatocyte immunostaining was clearly present in the cytoplasm and not in the nucleus. Quantification of TUNEL and ERß-labeled spermatocytes showed a parallel increase in the number of positive cells per tubule in transgenic animals. The number of labeled tubules per total tubules did not increase significantly (Table 1).
|
|
Expression of ERß in Apoptotic Germ Cells
Given that the distribution of the ERß labeling was very similar to the distribution of the TUNEL-positive cells, colocalization of ERß immunostaining with TUNEL-positive cells in consecutive testicular sections was determined. As described previously [16], only a limited number of cells, corresponding to pachytene spermatocytes, round spermatids, and spermatogonia, were TUNEL positive in wild-type mice, whereas in rABP transgenic mice, clusters of pachytene spermatocytes and metaphase cells were labeled by this technique. The identification of the seminiferous tubular stages confirmed that TUNEL and ERß-immunolabeled primary spermatocytes clustered in stages I–III and XII but were specifically absent in stage VII (Fig. 4).
|
To verify that pachytene spermatocytes undergoing apoptosis were overexpressing the ERß protein, immunohistochemistry and TUNEL were performed in the same section and analyzed using confocal microscopy. In the testes of homozygous rABP transgenic mice, clusters of pachytene spermatocytes at specific tubular stages were FITC labeled by the TUNEL assay, as was demonstrated previously using colorimetric procedures [16]. The signal of the TUNEL assay showed a definite colocalization with the rhodamine ERß immunolabeling (Fig. 5, d–f). In the testes of wild-type mice, the TUNEL assay labeled isolated dying cells (Fig. 5, a–c) that were the same cells stained with the ERß antibody. In contrast, spermatozoa at the luminal compartment exhibited rhodamine fluorescence but not FITC, indicating that these mature germ cells express ERß but not the dye corresponding to cells dying by apoptosis. Control slides without either d-UTP or primary antibody showed only a weak nonspecific fluorescence in Leydig cells (data not shown).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A growing body of evidence supports a direct role for estrogens in spermatogenesis. Ebling and collaborators demonstrated that the administration of low doses of estradiol to the hypogonadal (hpg) mouse, congenitally lacking gonadotrophs and presenting a meiotic arrest at the pachytene stage, induced the progression and completion of spermatogenesis in the absence of measurable androgens [25]. Pentikainen and collaborators showed that the addition of low concentrations of estradiol inhibit the germ cell apoptosis induced by incubating segments of human seminiferous tubules without survival factors [10]. Thus, as mentioned above, if significant disruption in androgen homeostasis occurs in the rABP transgenic mouse, then its subsequent aromatization to estrogens should also be impaired and may account in part for the observed phenotype.
The mechanism of action of estrogens in spermatogenesis is still a matter of debate. Although there is not a complete agreement about the presence of estrogen receptors in each cell type in the testis [11], a considerable number of studies concur that ERß is the predominant form in germ cells of rodents and humans [8–9, 26–30]. The expression of ERß was localized in pachytene spermatocytes at stage VII up to round spermatids at stage VIII in rat testis [10]. A similar expression pattern has been described for P450 aromatase in mice and rats [4, 6], suggesting that the locally produced estrogens in these cells could act through ERß [31]. Further, there are reports of ERß expression in other germ cell types, such as spermatogonia [9, 28, 29] and elongated spermatids [22]. Because several isoforms of ERß have been described, it is possible that the use of different antibodies, raised against different parts of the protein, might explain some of these differences.
In the present study, we showed a strong and well-defined distribution of the ERß protein in degenerating spermatocytes. A lack of specificity of the ERß antibody can be discarded because it perfectly stains the nuclei of Sertoli cells in controls and because the specific Western blot signal disappears when the antibody is preadsorbed with the corresponding peptide. The specific bands that we observed by Western blot sized approximately at 80 kDa and 55 kDa. Although both bands appeared more intense in transgenic animals as compared with controls and both disappeared when the antibody was preadsorbed, the 55-kDa band shows a more significant increase in ABP homozygous mice compared with control animals and fits better to the expected size. Additionally, in the model of pachytene spermatocyte apoptosis induced by administration of methoxyacetic acid in adult rats, we have found a specific increase of the 55-kDa band using two different antibodies raised against ERß [32]. At present, we do not know if the 80-kDa band indicates expression of an alternatively spliced form of ERß or is just a nonspecific signal. Although a 80-kDa band has been found in the mouse ovary using another antibody specific for ERß, a similar sized band has been detected in the testis with an ER antibody [21]. However, the possibility that the immunohistochemical signal detected in degenerating germ cells is due to ER or another related protein labeling is low because the antiserum was generated against unique ERß peptide sequences.
We also showed that the ERß protein is clearly present in the cytoplasm of spermatids and Leydig cells. Other authors demonstrated the expression of ERß in spermatids by immunohistochemistry [8, 9, 22]. Rosenfeld and collaborators [22] found expression of ERß in elongated spermatids of wild-type mice with the same antibody that we have used in the present study that recognizes amino acids 55– 70 (amino-terminal region) but not with an antibody that recognizes the last 19 residues of the carboxy-terminus. Similar results were found in brain, showing the presence of ERß in Purkinje cell bodies and in dendrites using the N-terminal antibody and in Purkinje cell body only using the carboxy-terminal antibody [33]. These data suggest the existence of a form with the amino-terminus of ERß1 and a different carboxy-terminus in elongated spermatids and in dendrites of Purkinje cells. Van Pelt and collaborators, using an antibody raised against the ligand-binding domain of ERß, did not find expression in spermatids or Leydig cells. However, the size of the ERß protein in the rat testis recognized by these authors is the same (55 kDa) that we found increased in the rABP transgenic mice. Because all these antibodies are raised against specific parts of the protein, it is possible that the conformation of the receptor in each cellular type or compartment, that depends on its binding to a specific ligand and/or DNA, or its interaction with chaperons or other proteins, modify the ability of each antibody to recognize a specific epitope. Another possible explanation is the species variation of ERß expression between mouse and rat, as has been discussed by Rosenfeld and collaborators [22].
The results presented here suggest than an excess of ERß could drive the cell to an apoptotic pathway or, alternatively, could stop the progression of the first meiotic division and, as a consequence, the cell dies by apoptosis. In control mice, we found expression of ERß in isolated spermatocytes, also positive by the TUNEL technique. These data suggest that ERß has an active role in this step during normal spermatogenesis. Of interest is the finding that TUNEL and ERß-immunolabeled primary spermatocytes are absent in seminiferous tubular stage VII in rABP transgenic mice because it has been demonstrated that this is the stage where the germ cells are at the least risk of degeneration in normal rats [34]. The studies of Van Pelt and collaborators demonstrated the expression of ERß in pachytene spermatocytes at stage VII in normal rats, using an antibody raised against the ligand-binding domain [9]. The apparent contradiction with our results might be explained by the loss of the normal expression of ERß in rABP transgenic mice or by the existence of two isoforms, one involved in apoptosis and the other having other functions in the nuclei of healthy pachytene spermatocytes.
If the overexpression of ERß results in cell cycle arrest and/or apoptosis, it could be expected that the absence of this receptor could favor the opposite action; that is, to force the cells to enter into meiosis or to avoid apoptosis, but neither of these phenotypes are observed in the BERKO mice [35]. Because the division of primary spermatocytes is, arguably, the most controlled steps of spermatogenesis by a high number of genes with apparently redundant function [36, 37], other genes could compensate for the absence of ERß. The development of a transgenic mice model overexpressing ERß could help in learning its function in germ cells.
The possible involvement of ERß in cell cycle arrest should not be surprising, based on the demonstration that estrogens regulate cell cycle [38, 39]. Recent results showing the opposing action of ERß and ER on cyclin D1 gene expression, ERß being the inhibitor and ER the activator, support the antiproliferative role of the former [40]. Additional data supporting this role is the demonstration that ERß expression decreases in conditions where cell proliferation is favored, such as breast, colon, ovarian, and prostate cancers [41–49] and the induction of a G2 cell cycle arrest when ERß is introduced into MCF-7 cells [50]
A possible role for ERß in apoptosis also has been suggested by several groups. In the rat brain cells, Nilsen and collaborators demonstrated that estradiol could act as a positive or negative regulator of apoptosis, depending on the estrogen receptor subtype present in the cell: ER being a neuroprotective agent and ERß an inducer of apoptosis when either are expressed [51]. In human brains, it was shown that an increased ERß immunoreactivity is present in the cytoplasm of degenerative hippocampal neurons in patients with Alzheimer disease [52]. In human colonocytes, Qiu and collaborators found that estradiol induced apoptosis only in cell lines that express ERß but not ER [53]. Regarding spermatogenesis, we demonstrated recently that ERß mRNA and protein specifically correlated with pachytene spermatocyte apoptosis induced by short-term administration of methoxyacetic acid [32], a well-known model for the study of pachytene spermatocyte apoptosis. The expression of ERß in degenerating pachytene spermatocytes in both models as well as in the normally degenerating spermatocytes in their respective controls gives additional support to the hypothesis that ERß may participate in the progression of the first meiotic division.
One of the mechanisms by which ERß might regulate cell cycle is through its direct and specific interaction with the cell cycle spindle assembly checkpoint protein, Mad2 [54]. Recently, it was demonstrated that overexpression of Mad2 in meiosis I of mouse oocytes leads to a cell cycle arrest in metaphase I [55], although it remains to be determined if this action of Mad2 is mediated by its interaction with ERß. Preliminary data obtained in our laboratory reveal an increased expression of Mad2 mRNA in the germ cell fraction of rABP transgenic mice compared with control animals and an enhanced immunohistochemical signal in primary spermatocytes (data not shown). Further experiments will be necessary to demonstrate this hypothesis.
In conclusion, we demonstrated an increased expression of ERß mRNA and protein in primary spermatocytes that degenerate by apoptosis. Considering that ERß is expressed in this cellular type during normal spermatogenesis but its function is still unknown, our results suggest that this receptor could play a role either in regulating the progression of the first meiotic division or favoring the entrance of primary spermatocytes to an apoptotic pathway.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence: Francina Munell, Grup de Recerca en Endocrinologia Molecular, Hospital Materno-Infantil, planta 14, Hospital Universitari Vall d'Hebrón, Pg. Vall d'Hebron, 119-129, 08035 Barcelona, Spain. FAX: 34 934894064; fmunell{at}vhebron.net
Received: 20 November 2003.
First decision: 5 December 2003.
Accepted: 17 June 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
for development or function. Endocrinology 2000 141:1273-1276 knock-out and wild-type mice. Endocrinology 1998 139:2982-2987 and ß proteins in the testes and male reproductive system of human and non-human primates. Mol Hum Reprod 2001 7:227-236 and ß in human testis. Mol Hum Reprod 2001 7:497-503 and ß on cyclin D1 gene expression. J Biol Chem 2002 277:24353-24360 and -ß messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res 1998 58:5367-5373This article has been cited by other articles:
|
|
 |
|
  V. Stabile, M. Russo, and P. Chieffi 17{beta}-Estradiol induces Akt-1 through estrogen receptor-{beta} in the frog (Rana esculenta) male germ cells. Reproduction, September 1, 2006; 132(3): 477 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Luksha, L. Poston, J.-A. Gustafsson, L. Aghajanova, and K. Kublickiene Gender-Specific Alteration of Adrenergic Responses in Small Femoral Arteries From Estrogen Receptor-{beta} Knockout Mice Hypertension, November 1, 2005; 46(5): 1163 - 1168. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
)
