Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print July 7, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.031807
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/5/1540    most recent
biolreprod.104.031807v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.
Agricola
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.
BIOLOGY OF REPRODUCTION 71, 1540–1544 (2004)
DOI: 10.1095/biolreprod.104.031807
© 2004 by the Society for the Study of Reproduction, Inc.


Reproductive Technology

Genomic Imprinting of H19 in Naturally Reproduced and Cloned Cattle1

Shouquan Zhang3,4, Chikara Kubota6, Lan Yang4, Yuqin Zhang4, Raymond Page7, Michael O'Neill5, Xiangzhong Yang4, and X. Cindy Tian2,4

Department of Animal Science and Center for Regenerative Biology,4 Department of Molecular and Cellular Biology,5 University of Connecticut, Storrs, Connecticut 06269 Kagoshima Prefectural Cattle Breeding Development Institute,6 2200 Tsukino Osumi So-Gun Kagoshima, 8998212 Japan Cyagra, Inc.,7 North Grafton, Massachusetts 01536


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals produced from assisted reproductive technologies suffer from developmental abnormalities and early fetal death at a higher frequency than that observed in those produced by natural breeding. These symptoms are reminiscent of imprinting disruptions in the human and mouse, suggesting the possibility of perturbations in the expression of imprinted genes such as biallelic expression or silencing. H19 is one of the imprinted genes first identified in mice and humans, but its sequence and imprinting status have not been determined in cattle. In the present study, we obtained the majority of the bovine H19 gene sequence (approximately 2311 base pairs), identified a single nucleotide polymorphism (SNP) in exon 5 and determined the frequencies of different alleles containing the SNP. Our analysis demonstrated that, in cattle produced by natural breeding, H19 was indeed imprinted as shown by either predominant or exclusive expression of the maternal allele. We also analyzed the imprinting pattern of H19 in organs of four animals produced by somatic cell nuclear transfer that died shortly after birth or had developed abnormalities that necessitated immediate killing at birth. Three out of four cloned animals showed biallelic expression of H19, supporting our hypothesis that imprinting disruption is present in cloned animals that suffered from developmental abnormalities at birth. Examination of the expression of H19 in the offspring of a cloned animal produced by artificial insemination showed that the imprinting pattern in this animal was indistinguishable from those of control animals, suggesting that either imprinting disruptions in cloned animals are corrected through natural reproduction or that they are not present in healthy cloned animals capable of undergoing natural reproduction.

assisted reproductive technology, cattle, H19, imprinting, nuclear transfer


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genomic imprinting is an epigenetic phenomenon in which only one allele of a specific gene is expressed, depending on its parental origin [1, 2]. To date, more than 50 imprinted genes have been identified in the mouse and/or human [3], and many of them are involved in regulation of fetal growth. The H19 gene encodes for an untranslated RNA molecule [4] and is one of the best-studied imprinted genes in both the mouse and human. It is expressed from the maternal allele in both species, with the paternal allele silent or nearly silent [5, 6]. H19 is expressed abundantly in the human placenta and in several embryonic tissues [7]. Although the function of the H19 transcript is unclear, it is closely linked to the Igf2 gene in both the mouse and human and regulates imprinting of the Igf2 gene [8] by sharing an imprinting control element.

Expression patterns of imprinted genes are studied based on the fact that imprinted genes are monoallelically expressed. To study if gene expression is mono- or biallelic, an expressed polymorphism (polymorphism in the mRNA or proteins) must be present to distinguish which parental allele is transcribed. It also requires that the animals being studied be heterozygous for the gene/polymorphism of interest. The most common polymorphisms in the mammalian genome are single nucleotide polymorphisms (SNP), which are DNA point mutations (base-pair change or insertions/deletions) and are distributed throughout the genome. Although the H19 gene is well characterized in the mouse and human, there has been neither sequence nor imprinting determination for the bovine.

Bovine embryos produced using a variety of assisted reproductive techniques have resulted in the development of unusually large offspring (large calf syndrome, LOS) [9]. This syndrome also includes a number of other defects of newborns, such as breathing difficulties, reluctance to suckle, sudden death, and increased embryonic losses, particularly in the first trimester of pregnancy [912]. These symptoms are frequently observed in pregnancies derived from embryos of in vitro fertilization (IVF) and culture, but are more pronounced and more frequently encountered in pregnancies derived from cloned embryos. The consistency of these observations, by numerous research teams in various experimental settings, indicates that these defects may be caused by systematic mistakes in the expression of a certain set of essential growth-regulating genes. Furthermore, many of these defects are similar to experimentally induced imprinting disruptions (biallelic expression of imprinted genes) in mice and naturally occurring imprinting diseases in humans [9, 13, 14]. Because most imprinted genes regulate fetal growth and many are essential for normal development [8, 15, 16], it is likely that some of the defects in LOS may be caused by imprinting disruptions.

Although cattle are the most frequently used species for the development of assisted reproductive technologies and LOS is commonly observed in cloned as well as in IVF pregnancies, imprinting studies in cattle remain an underdeveloped area of research, largely because of the lack of information on polymorphisms of putative imprinted genes in the bovine. The aims of this study were to obtain the sequence of the bovine H19 gene, to identify SNPs in the bovine H19 gene, to establish the imprinting status of H19 in cattle from natural reproduction, and to determine whether cloned cattle have imprinting disruptions in the H19 gene.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Samples, Extraction of Genomic DNA and Total RNA

Blood samples were obtained from 162 dairy and beef cattle from the research herds at the University of Connecticut. These samples were used for identification of SNPs, heterozygosity screening, and allele frequency determination. Organ/tissue samples, including bladder, brain, heart, kidney, liver, lung, muscle, pancreas, placenta, spleen, and thymus, were obtained from two naturally reproduced newborn calves (Jersey and Holstein) from the university's research herds and from one beef fetus in a slaughterhouse. Organ/tissue samples from four full-term cloned calves that died shortly after birth or developed abnormalities that necessitated immediate killing at birth, were also collected. To determine whether imprinting of H19 is normal in naturally reproduced offspring of a cloned animal, organ samples were also collected from a 2-wk-old calf produced from a cloned dairy cow [17]. All organ samples were frozen immediately after collection and stored at –80°C until analysis. Genomic DNA was extracted from blood and organ samples using DNeasy kit from Qiagen (Valencia, CA) and total RNA was extracted from frozen organ samples using the RNeasy kit (Qiagen). The RNA was treated with RNase-free DNase to remove any possible contaminating genomic DNA. All procedures involving the use of animals were approved by the Institutional Animal Care and Use Committee at the University of Connecticut.

Reverse Transcription-PCR and DNA Sequencing

The reverse transcription-PCR (RT-PCR) was conducted using the One-Step RT-PCR kit (Qiagen) with 4 ng/µl of total RNA and 0.6 pmol/ µl primers, 2 µl reverse transcriptase in a total volume of 25 µl at 55°C for 30 min. Gene specific primers for the H19 were designed using available consensus sequences from the human (AC004556), mouse (AP03182 and AY044827), swine (AY044827), and ovine (AY091484). The PCR products were then subcloned into TOPO TA cloning vectors (Invitrogen, Carlsbad, CA) and sequenced using the Bigdye kit on ABI PRISM model 3700 (Applied Biosystems, Foster City, CA). The 3'-rapid amplification of cDNA ends (3'-RACE; Clontech, Palo Alto, CA) method was used to obtain the first and fourth exons of the bovine H19 sequences. Briefly, bovine cDNA was prepared from RNA samples using oligo-dT primers conjugated to an anchor DNA. The 3'-RACE was then accomplished by using the anchor primer and a gene-specific primer designed as described above. The specific bands obtained from the 3'-RACE were then sequenced. The sequences of the introns were generated by sequencing the PCR products using primers designed from newly generated bovine exon sequences.

Identification of SNP in the Bovine H19 Gene and Determination of Allele Frequency of the SNP

New PCR primers were designed from the bovine H19 gene sequences and used to amplify regions of H19 for the generation of amplicons ranging from 200 to 400 base pairs (bp) [1820]. The sizes of the amplicons were chosen to obtain the best resolution in single-strand conformation polymorphism (SSCP). For each PCR assay, 100 ng of genomic DNA from blood was used as a template, and PCR was performed in a final volume of 25 µl as follows: an initial denaturation step of 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 62°C for 30 sec, and extension at 72°C for 10 sec, and finishing with one cycle at 72°C for 5 min. The PCR products were then resolved on 1% agarose gels to confirm the specific amplification of the product by size, and then they were subjected to SSCP analysis. The SSCP was conducted on 12% polyacrylamide gels, run in a cold room (4°C) at 200 V overnight. The gels were then subjected to silver staining [19], dried in a gel drier, and the images archived. The appearance of different banding patterns on the SSCP for exon 5 using the primer pair JY511 (5' GACCTAAAGGAACGGACGAC 3,' forward) and JY318 (5' TCC TGAGCAAAGGATAGCAGA 3,' reverse), indicated the existence of a polymorphism. The PCR product from this set of primers was then directly sequenced to identify the base changes of the polymorphism. The allele frequency was determined by genotyping all blood samples and calculated by using the following formula: frequency of an allele = (2 x number of animals homozygous for this allele + number of animals heterozygous for this allele)/2 x total number of animals examined.

Analysis of the Allele-Specific Gene Expression of H19 in Cattle

Heterozygous animals for which organ samples were available were used in the allele-specific gene expression analysis. A total of three control calves and four cloned calves were heterozygous for this SNP and were used in the analysis. The cDNAs were made from total RNA preparations of all available organ samples of control and cloned calves. PCR using JY511/JY318 was conducted on all cDNA samples and the PCR products were then subjected to SSCP. In the case of monoallelic expression (imprinting), one parental band will be detected on SSCP, while biallelic expression will generate two bands for the H19 gene on SSCP.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Sequence of the Bovine H19 Gene

We obtained the entire sequence of the bovine H19 gene except an approximately 200-bp GC-rich region in exon 1. Previously, there was no bovine H19 sequence available in the Genbank. In the present study, we found that the bovine H19 gene is highly GC rich, shares similar gene structure with the sheep (gi: 23428778) and pig (gi: 21956485), and is 91.8% and 71.2% identical to the sheep and pig H19 genes, respectively. The degree to which the bovine H19 sequence identifies with those of sheep and pigs is 93% and 73% for exons, 83% and 60.6% for introns, respectively (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Comparative exon/intron organization of the pig, sheep, and cattle H19 genes

Identification of SNP in Bovine H19 Exon 5 and Allele Frequency of the SNP

Using primer pair JY511 and JY318 specifically for bovine H19 exon 5, we observed different banding patterns for the PCR products and identified an SNP (Fig. 1a) at the 66th nucleotide (from 5' to 3') of exon 5. Sequencing of a heterozygous animal showed that a G/A transition was present at this locus (Fig. 1b).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 1. Identification of an SNP in the bovine H19 gene by PCR-SSCP and sequencing. a) An SSCP image of three different banding patterns of PCR products of exon 5 for three animals with different genotypes at the SNP. Lanes 1 and 2: cows homozygous for the A and G alleles, respectively; lane 3: a cow heterozygous for the SNP. b). Chromatographs of gene sequences of three cows surrounding the SNP (arrow) of the H19 gene, showing the nature of the base change of this SNP. Top panel: an animal homozygous for allele A; middle panel: an animal heterozygous for the SNP has double peaks of both A and G nucleotides at the SNP; lower panel: an animal homozygous for Allele G

To determine the abundance of each allele (G or A) of the SNP, we analyzed 162 samples from cattle (beef, Jersey, and Holstein). The results are shown in Table 2. The A allele was the predominant allele and was about four times more abundant than the G allele in all breeds examined.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Allele and genotype frequencies of the bovine H19 gene in research cattle herds at the University of Connecticut

Analysis of the Allele-Specific Expression of H19 in Cattle from Natural Reproduction and from Nuclear Transfer

Allele-specific expression analysis by RT-PCR-SSCP of each organ from animals of natural reproduction is shown in Figure 2. When compared with the PCR products from genomic DNA with two bands, the organ samples all had only one predominant band. This band was of maternal origin in the cDNA samples, demonstrating that the bovine H19 gene is monoallelically expressed from the maternal allele, and therefore this gene is imprinted in the bovine. A low level of expression of the paternal allele (leaky expression) was also seen in some samples. The degree of leaky expression varied in different organs, with the brain, lung, heart, and spleen having virtually no leaky expression of the paternal allele.



View larger version (67K):
[in this window]
[in a new window]
 
FIG. 2. SSCP images of the allele-specific expression pattern of the H19 gene in cattle produced by natural reproduction. a) Allelic expression of a beef calf: Lanes 1 and 2: Genotypes of the calf and his dam. The calf had two bands, indicating the animal was heterozygous for the SNP, while the dam only had one band (allele A), indicating she was homozygous and the calf inherited the A allele from the maternal origin. Lanes 3–9: Expression pattern of H19 in the calf's liver, kidney, heart, brain, lung, placenta, thymus, bladder, spleen. All organs were either predominantly or exclusively expressing the A allele, which was of maternal origin, indicating the H19 is imprinted and maternally expressed. b) Allelic expression of a Jersey calf: Lanes 1 and 2: genotypes of the dam and the calf; lanes 3–13: expression patterns of liver, kidney, heart, brain, lung, placenta, thymus, bladder, spleen, muscle, and pancreas of the calf. c) Allelic expression of a Holstein fetus. Lanes 1 and 2: genotypes of the fetus and the dam; lanes 3–10: allelic expression of brain, heart, kidney, liver, lung, muscle, cotyledon, and intercotyledon tissues of the fetus

In deceased calves from nuclear transfer, however, both predominant expression of the maternal allele as well as biallelic expression of H19 were found (Fig. 3). This latter expression pattern was usually associated with biallelic expression of this gene in the corresponding donor cells as well (lane 5 of Fig. 3). In fact, three out of four cloned animals examined had biallelic expression of the H19 gene. This demonstrated that there was a loss of correct imprinting in some of the deceased clones. Another possibility is that the biallelic expression pattern present in the donor cells of three clones was preserved throughout development.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. A representative SSCP image of the allele-specific expression pattern of the bovine H19 gene in a deceased cloned calf showing biallelic expression of H19. Lanes 1 and 2: Genotypes of control animals homozygous for the H19 SNP; lane 3: genotype of the cloned animal, showing that she was heterozygous for the SNP; lane 4: genotype of the donor cells; lane 5: allelic expression of the donor cells, showing biallelic expression; lanes 6–11: brain, heart, liver, lung, spleen, and kidney of the cloned animal

Analysis of H19 Expression in Naturally Reproduced Offspring of a Cloned Cow

A male calf of a cloned cow, produced by artificial insemination of the cloned cow, was heterozygous for the SNP of H19. The organs of the clone's offspring, collected at 2 wk of age, showed maternal expression of H19. The pattern of expression was indistinguishable from the imprinting expression patterns in control animals (Fig. 4).



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 4. An SSCP image of the allele-specific expression of H19 in tissues of offspring of a cloned cow by artificial insemination. Lanes 1 and 2: genotypes of the clone's dam (the cloned cow) and her calf by natural reproduction; lanes 3–11: allelic expression of the liver, kidney, heart, brain, lung, placenta, thymus, bladder, spleen of the clone's calf


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The sequence of the cattle H19 gene was obtained, except for a part of the 5' end of exon 1 (about 200 bp), in this study. Similar to that of the sheep and pig, the GC content in exons of cattle H19 is high [21, 22]. Both the sequence, as well as the gene structure of the bovine H19, shared a high degree of homology with those of the sheep and pig, indicating that the sequence and gene structure conservation is important in the formation of very stable secondary structures in the mRNA for carrying out its yet-to-be-determined biological function(s) [23].

The identification of an SNP in the bovine H19 gene allowed us to study its imprinting status by following the expression of the parental alleles in heterozygous animals. We found that, as in the mouse [5] and human [24], H19 is imprinted in cattle and the maternal allele is predominantly or exclusively expressed in all tissues examined. The conservation of the imprinting status of the H19 gene in animals phylogenetically distant demonstrated the importance of imprinting of this gene in mammalian development.

In deceased animals generated by somatic cell nuclear transfer, biallelic expression of the H19 gene was found, suggesting the disruption of imprinting, which may have contributed to their abnormal development. Biallelic expression of the H19 gene has been reported in cloned mouse embryos, along with imprinting disruptions of other genes as well [25]. Mann et al. [25] reported that only about 4% of embryos had normal expression patterns of the imprinted genes examined, which may help explain the low efficiency of mouse cloning. In full-term cloned mice, however, expression patterns, as well as levels of H19 mRNA in the placenta, were found similar to those of control mice [26, 27]. These observations suggest that mouse clones that developed to full term and survived after birth have relatively normal expression of imprinted genes. Recently, Dindot et al. [28] reported normal allelic expression of Igf2 and Gtl2 (gene trap locus 2) in Day 40 bovine cloned fetuses and placentas. These cloned fetuses were derived from donor cells of a bovine interspecies hybrid (Bos gaurus x B. taurus). Because these cloned fetuses were removed in early gestation for imprinting determinations, it is unclear whether they would have survived to full term and beyond. Because cloned mice from genetically heterozygous F1 mice survive better than those cloned from inbred mice [29], it is possible that this may also be true in the bovine and that the normal imprinting patterns found by Dindot et al. [28] might have reflected those from surviving clones of highly heterozygous background. The animals used in the present study, however, were all pure bred except for one, and all died shortly after birth, although they did develop to full term. This may indicate that cloned cattle can tolerate a high degree of imprinting disruption at fetal stages, which may account for the higher efficiency of cattle cloning than other species. These imprinting disruptions, however, rendered the bovine cloned fetuses weaker than those from natural reproduction, and the abrupt postnatal change in environment was sufficient to induce life-threatening stress to the newborn calves, causing them to die shortly after birth. The cause of imprinting disruption in these cloned animals may be related to the donor cell's imprinting pattern, although it is impossible to study the expression patterns of H19 retrospectively in the very cells that gave rise to these clones.

In a naturally reproduced offspring of a cloned cow, expression of the imprinted H19 gene was found completely normal, although we don't have allele-specific expression data for the cloned cow because she is homozygous for this SNP and her imprinting patterns could not be determined. The fact that this clone did not die after birth does not necessarily indicate that she did not have imprinting disruptions. Nonetheless, even if the clone had imprinting disruptions, the fact that the offspring produced naturally had normal imprinting patterns suggests that epigenetic anomalies in cloned animals were not inherited and could be corrected by natural reproduction.

In summary, in the present study, we established for the first time that the H19 gene is imprinted in domestic cattle and imprinting disruption of H19 can be present in developmentally abnormal animals produced by nuclear transfer. The identification of an expressed SNP in the H19 gene would allow its use as a marker to study the causes of developmental abnormalities associated with other assisted reproductive technologies.


    ACKNOWLEDGMENTS
 
We thank Marina Julian for careful reading and editing of the manuscript, Charles Bormann and Dr. Brian Enright for taking the blood samples from diary animals, and Dr. Gary Kazmer for providing blood samples from beef cattle.


    FOOTNOTES
 
1 Supported by funding from NIH (HD40889) and USDA (02402) to X.C.T. S.Z. was partially supported by a scholarship from The China Education Fund. Back

2 Correspondence: X. Cindy Tian, 1392 Storrs Road, Storrs, CT 06269-4243. FAX: 860 486 8809; xtian{at}canr.uconn.edu Back

3 Current address: College of Animal Science, South China Agricultural University, Guangzhou 510642, People's Republic of China Back

Received: 10 May 2004.

First decision: 7 June 2004.

Accepted: 21 June 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ferguson-Smith AC, Surani MA. Imprinting and the epigenetic asymmetry between parental genomes. Science 2001 293:1086-1089[Abstract/Free Full Text]
  2. Latham KE. Epigenetic modification and imprinting of the mammalian genome during development. Curr Top Dev Biol 1999 43:1-49[Medline]
  3. Dean W, Santos F, Reik W. Epigenetic reprogramming in early mammalian development and following somatic nuclear transfer. Sem Cell Dev Biol 2003 14:93-100[CrossRef][Medline]
  4. Brannan CI, Dees EC, Ingram RS, Tilghman SM. The product of the H19 gene may function as an RNA. Mol Cell Biol 1990 10:28-36[Abstract/Free Full Text]
  5. Bartolomei MS, Tilghman SM. Genomic imprinting in mammals. Annu Rev Genet 1997 31:493-525[CrossRef][Medline]
  6. Rachmilewitz J, Goshen R, Ariel I, Schneider T, de Groot N, Hochberg A. Parental imprinting of the human H19 gene. FEBS Lett 1992 309:25-28[CrossRef][Medline]
  7. Goshen R, Rachmilewitz J, Schneider T, de Groot N, Ariel I, Palti Z, Hochberg AA. The expression of the H19 and IGF2 genes during human embryogenesis and placental development. Mol Reprod Dev 1993 34:374-379[CrossRef][Medline]
  8. Bartolomei MS, Zemel S, Tilghman SM. Parental imprinting of mouse H19 gene. Nature 1991 351:153-155[CrossRef][Medline]
  9. Young LE, Fairburn HR. Improving the safety of embryo technologies: possible role of genomic imprinting. Theriogenology 2000 53:627-648[CrossRef][Medline]
  10. Garry FB, Adams R, McCann JP, Odde KG. Postnatal characteristics of calves produced by nuclear transfer cloning. Theriogenology 1996 45:141-152[CrossRef]
  11. Ranilla MJ, Gebbie FE, King ME, Carolan C, Sinclair KD, Watt RG, Dolman DF, Beckers JF, Robinson JJ. The incidence of embryo and fetal loss following the transfer of in vitro-cultured sheep embryos. Theriogenology 1998 49:248
  12. Walker SK, Hartwich KM, Seamark RF. The production of unusually large offspring following embryo manipulation: concepts and changes. Theriogenology 1996 45:111-120[CrossRef]
  13. Reik W. Genomic imprinting and genetic disorders in man. Trends Genet 1989 5:331-336[CrossRef][Medline]
  14. Reik W, Maher ER. Imprinting in clusters: lessons from Beckwith-Wiedemann syndrome. Trends Genet 1997 13:330-334[CrossRef][Medline]
  15. Hall JG. Genomic imprinting: review and relevance to human diseases. Am J Hum Genet 1990 46:857-873[Medline]
  16. Jaenisch R. DNA methylation and imprinting: why bother?. Trends Genet 1997 13:323-329[CrossRef][Medline]
  17. Xue F, Tian XC, Du F, Kubota C, Taneja M, Dinnyes A, Dai Y, Levine H, Pereira LV, Yang X. Aberrant patterns of X chromosome inactivation in bovine clones. Nat Genet 2002 31:216-220[CrossRef][Medline]
  18. Orita M, Iwahana H, Hayashi K, Sekiya T. Detection of polymorphism of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A 1989 86:2766-2770[Abstract/Free Full Text]
  19. Bosari S, Marchetti A, Buttitta F, Graziani D, Borsani G, Loda M, Bevilacqua G, Coggi G. Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP analysis. Diag Mol Pathol 1995 4:249-255[Medline]
  20. Gray A, Tam AW, Dull TJ, Joel H, Pintar J, Cavenee WK, Koufos A, Ullrich A. Tissue-specific and developmentally regulated transcription of the insulin-like growth factor 2 gene. DNA 1987 6:283-295[Medline]
  21. Lee RS, Depree KM, Davey HW. The sheep (Ovis aries) H19 gene: genomic structure and expression patterns, from the preimplantation embryo to adulthood. Gene 2002 301:67-77[CrossRef][Medline]
  22. Amarger V, Nguyen M, Laere AV, Braunschweig M, Nezer C, Georges M, Andersson L. Comparative sequence analysis of the INS-IGF2-H19 gene cluster in pigs. Mamm Genome 2002 13:388-398[CrossRef][Medline]
  23. Juan V, Crain C, Wilson C. Evidence for evolutionarily conserved secondary structure in the H19 tumour suppressor RNA. Nucleic Acids Res 2000 28:1221-1227[Abstract/Free Full Text]
  24. Zhang Y, Tycko B. Monoallelic expression of the human H19 gene. Nat Genet 2002 1:40-44[CrossRef]
  25. Mann MR, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003 69:902-914[Abstract/Free Full Text]
  26. Inoue K, Kohda T, Lee J, Ogonuki N, Mochida K, Noguchi Y, Tanemura K, Kaneko-Ishino T, Ishino F, Ogura A. Faithful expression of imprinted genes in cloned mice. Science 2002 295:297[Free Full Text]
  27. Ogura A, Inoue K, Ogonuki N, Lee J, Kohda T, Ishino F. Phenotypic effects of somatic cell cloning in the mouse. Clon Stem Cells 2002 4:397-405
  28. Dindot SV, Farin PW, Farin CE, Romano J, Walker S, Long C, Piedrahita JA. 2004 Epigenetic and genomic imprinting analysis in nuclear transfer derived Bos gaurus/Bos taurus hybrid fetuses. Biol Reprod 2004 71:470-478 DOI 10.1095/biolreprod.103. 025775 [Abstract/Free Full Text]
  29. Eggan K, Akutsu H, Loring J, Jackson-Grusby L, Klemm M, Rideout WM 3rd, Yanagimachi R, Jaenisch R. Hybrid vigor, fetal overgrowth, and viability of mice derived by nuclear cloning and tetraploid embryo complementation. Proc Natl Acad Sci U S A 2001 98:6209-6214[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler
Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos
Biol Reprod, October 1, 2006; 75(4): 531 - 538.
[Abstract] [Full Text] [PDF]


Home page
J. Med. EthicsHome page
N Cobbe
Why the apparent haste to clone humans?
J. Med. Ethics, May 1, 2006; 32(5): 298 - 302.
[Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Curchoe, S. Zhang, Y. Bin, X. Zhang, L. Yang, D. Feng, M. O'Neill, and X. C. Tian
Promoter-Specific Expression of the Imprinted IGF2 Gene in Cattle (Bos taurus)
Biol Reprod, December 1, 2005; 73(6): 1275 - 1281.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Fujimoto, S.M. Mitalipov, L.L. Clepper, and D.P. Wolf
Development of a monkey model for the study of primate genomic imprinting
Mol. Hum. Reprod., June 1, 2005; 11(6): 413 - 422.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. D. Morgan, F. Santos, K. Green, W. Dean, and W. Reik
Epigenetic reprogramming in mammals
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R47 - R58.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
71/5/1540    most recent
biolreprod.104.031807v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.
Agricola
Right arrow Articles by Zhang, S.
Right arrow Articles by Tian, X. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS