|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reproductive Technology |
Department of Animal Science and Center for Regenerative Biology,4
Department of Molecular and Cellular Biology,5 University of Connecticut, Storrs, Connecticut 06269
Kagoshima Prefectural Cattle Breeding Development Institute,6 2200 Tsukino Osumi So-Gun Kagoshima, 8998212 Japan
Cyagra, Inc.,7 North Grafton, Massachusetts 01536
| ABSTRACT |
|---|
|
|
|---|
assisted reproductive technology, cattle, H19, imprinting, nuclear transfer
| INTRODUCTION |
|---|
|
|
|---|
Expression patterns of imprinted genes are studied based on the fact that imprinted genes are monoallelically expressed. To study if gene expression is mono- or biallelic, an expressed polymorphism (polymorphism in the mRNA or proteins) must be present to distinguish which parental allele is transcribed. It also requires that the animals being studied be heterozygous for the gene/polymorphism of interest. The most common polymorphisms in the mammalian genome are single nucleotide polymorphisms (SNP), which are DNA point mutations (base-pair change or insertions/deletions) and are distributed throughout the genome. Although the H19 gene is well characterized in the mouse and human, there has been neither sequence nor imprinting determination for the bovine.
Bovine embryos produced using a variety of assisted reproductive techniques have resulted in the development of unusually large offspring (large calf syndrome, LOS) [9]. This syndrome also includes a number of other defects of newborns, such as breathing difficulties, reluctance to suckle, sudden death, and increased embryonic losses, particularly in the first trimester of pregnancy [912]. These symptoms are frequently observed in pregnancies derived from embryos of in vitro fertilization (IVF) and culture, but are more pronounced and more frequently encountered in pregnancies derived from cloned embryos. The consistency of these observations, by numerous research teams in various experimental settings, indicates that these defects may be caused by systematic mistakes in the expression of a certain set of essential growth-regulating genes. Furthermore, many of these defects are similar to experimentally induced imprinting disruptions (biallelic expression of imprinted genes) in mice and naturally occurring imprinting diseases in humans [9, 13, 14]. Because most imprinted genes regulate fetal growth and many are essential for normal development [8, 15, 16], it is likely that some of the defects in LOS may be caused by imprinting disruptions.
Although cattle are the most frequently used species for the development of assisted reproductive technologies and LOS is commonly observed in cloned as well as in IVF pregnancies, imprinting studies in cattle remain an underdeveloped area of research, largely because of the lack of information on polymorphisms of putative imprinted genes in the bovine. The aims of this study were to obtain the sequence of the bovine H19 gene, to identify SNPs in the bovine H19 gene, to establish the imprinting status of H19 in cattle from natural reproduction, and to determine whether cloned cattle have imprinting disruptions in the H19 gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Blood samples were obtained from 162 dairy and beef cattle from the research herds at the University of Connecticut. These samples were used for identification of SNPs, heterozygosity screening, and allele frequency determination. Organ/tissue samples, including bladder, brain, heart, kidney, liver, lung, muscle, pancreas, placenta, spleen, and thymus, were obtained from two naturally reproduced newborn calves (Jersey and Holstein) from the university's research herds and from one beef fetus in a slaughterhouse. Organ/tissue samples from four full-term cloned calves that died shortly after birth or developed abnormalities that necessitated immediate killing at birth, were also collected. To determine whether imprinting of H19 is normal in naturally reproduced offspring of a cloned animal, organ samples were also collected from a 2-wk-old calf produced from a cloned dairy cow [17]. All organ samples were frozen immediately after collection and stored at 80°C until analysis. Genomic DNA was extracted from blood and organ samples using DNeasy kit from Qiagen (Valencia, CA) and total RNA was extracted from frozen organ samples using the RNeasy kit (Qiagen). The RNA was treated with RNase-free DNase to remove any possible contaminating genomic DNA. All procedures involving the use of animals were approved by the Institutional Animal Care and Use Committee at the University of Connecticut.
Reverse Transcription-PCR and DNA Sequencing
The reverse transcription-PCR (RT-PCR) was conducted using the One-Step RT-PCR kit (Qiagen) with 4 ng/µl of total RNA and 0.6 pmol/ µl primers, 2 µl reverse transcriptase in a total volume of 25 µl at 55°C for 30 min. Gene specific primers for the H19 were designed using available consensus sequences from the human (AC004556), mouse (AP03182 and AY044827), swine (AY044827), and ovine (AY091484). The PCR products were then subcloned into TOPO TA cloning vectors (Invitrogen, Carlsbad, CA) and sequenced using the Bigdye kit on ABI PRISM model 3700 (Applied Biosystems, Foster City, CA). The 3'-rapid amplification of cDNA ends (3'-RACE; Clontech, Palo Alto, CA) method was used to obtain the first and fourth exons of the bovine H19 sequences. Briefly, bovine cDNA was prepared from RNA samples using oligo-dT primers conjugated to an anchor DNA. The 3'-RACE was then accomplished by using the anchor primer and a gene-specific primer designed as described above. The specific bands obtained from the 3'-RACE were then sequenced. The sequences of the introns were generated by sequencing the PCR products using primers designed from newly generated bovine exon sequences.
Identification of SNP in the Bovine H19 Gene and Determination of Allele Frequency of the SNP
New PCR primers were designed from the bovine H19 gene sequences and used to amplify regions of H19 for the generation of amplicons ranging from 200 to 400 base pairs (bp) [1820]. The sizes of the amplicons were chosen to obtain the best resolution in single-strand conformation polymorphism (SSCP). For each PCR assay, 100 ng of genomic DNA from blood was used as a template, and PCR was performed in a final volume of 25 µl as follows: an initial denaturation step of 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 62°C for 30 sec, and extension at 72°C for 10 sec, and finishing with one cycle at 72°C for 5 min. The PCR products were then resolved on 1% agarose gels to confirm the specific amplification of the product by size, and then they were subjected to SSCP analysis. The SSCP was conducted on 12% polyacrylamide gels, run in a cold room (4°C) at 200 V overnight. The gels were then subjected to silver staining [19], dried in a gel drier, and the images archived. The appearance of different banding patterns on the SSCP for exon 5 using the primer pair JY511 (5' GACCTAAAGGAACGGACGAC 3,' forward) and JY318 (5' TCC TGAGCAAAGGATAGCAGA 3,' reverse), indicated the existence of a polymorphism. The PCR product from this set of primers was then directly sequenced to identify the base changes of the polymorphism. The allele frequency was determined by genotyping all blood samples and calculated by using the following formula: frequency of an allele = (2 x number of animals homozygous for this allele + number of animals heterozygous for this allele)/2 x total number of animals examined.
Analysis of the Allele-Specific Gene Expression of H19 in Cattle
Heterozygous animals for which organ samples were available were used in the allele-specific gene expression analysis. A total of three control calves and four cloned calves were heterozygous for this SNP and were used in the analysis. The cDNAs were made from total RNA preparations of all available organ samples of control and cloned calves. PCR using JY511/JY318 was conducted on all cDNA samples and the PCR products were then subjected to SSCP. In the case of monoallelic expression (imprinting), one parental band will be detected on SSCP, while biallelic expression will generate two bands for the H19 gene on SSCP.
| RESULTS |
|---|
|
|
|---|
We obtained the entire sequence of the bovine H19 gene except an approximately 200-bp GC-rich region in exon 1. Previously, there was no bovine H19 sequence available in the Genbank. In the present study, we found that the bovine H19 gene is highly GC rich, shares similar gene structure with the sheep (gi: 23428778) and pig (gi: 21956485), and is 91.8% and 71.2% identical to the sheep and pig H19 genes, respectively. The degree to which the bovine H19 sequence identifies with those of sheep and pigs is 93% and 73% for exons, 83% and 60.6% for introns, respectively (Table 1).
|
Identification of SNP in Bovine H19 Exon 5 and Allele Frequency of the SNP
Using primer pair JY511 and JY318 specifically for bovine H19 exon 5, we observed different banding patterns for the PCR products and identified an SNP (Fig. 1a) at the 66th nucleotide (from 5' to 3') of exon 5. Sequencing of a heterozygous animal showed that a G/A transition was present at this locus (Fig. 1b).
|
To determine the abundance of each allele (G or A) of the SNP, we analyzed 162 samples from cattle (beef, Jersey, and Holstein). The results are shown in Table 2. The A allele was the predominant allele and was about four times more abundant than the G allele in all breeds examined.
|
Analysis of the Allele-Specific Expression of H19 in Cattle from Natural Reproduction and from Nuclear Transfer
Allele-specific expression analysis by RT-PCR-SSCP of each organ from animals of natural reproduction is shown in Figure 2. When compared with the PCR products from genomic DNA with two bands, the organ samples all had only one predominant band. This band was of maternal origin in the cDNA samples, demonstrating that the bovine H19 gene is monoallelically expressed from the maternal allele, and therefore this gene is imprinted in the bovine. A low level of expression of the paternal allele (leaky expression) was also seen in some samples. The degree of leaky expression varied in different organs, with the brain, lung, heart, and spleen having virtually no leaky expression of the paternal allele.
|
In deceased calves from nuclear transfer, however, both predominant expression of the maternal allele as well as biallelic expression of H19 were found (Fig. 3). This latter expression pattern was usually associated with biallelic expression of this gene in the corresponding donor cells as well (lane 5 of Fig. 3). In fact, three out of four cloned animals examined had biallelic expression of the H19 gene. This demonstrated that there was a loss of correct imprinting in some of the deceased clones. Another possibility is that the biallelic expression pattern present in the donor cells of three clones was preserved throughout development.
|
Analysis of H19 Expression in Naturally Reproduced Offspring of a Cloned Cow
A male calf of a cloned cow, produced by artificial insemination of the cloned cow, was heterozygous for the SNP of H19. The organs of the clone's offspring, collected at 2 wk of age, showed maternal expression of H19. The pattern of expression was indistinguishable from the imprinting expression patterns in control animals (Fig. 4).
|
| DISCUSSION |
|---|
|
|
|---|
The identification of an SNP in the bovine H19 gene allowed us to study its imprinting status by following the expression of the parental alleles in heterozygous animals. We found that, as in the mouse [5] and human [24], H19 is imprinted in cattle and the maternal allele is predominantly or exclusively expressed in all tissues examined. The conservation of the imprinting status of the H19 gene in animals phylogenetically distant demonstrated the importance of imprinting of this gene in mammalian development.
In deceased animals generated by somatic cell nuclear transfer, biallelic expression of the H19 gene was found, suggesting the disruption of imprinting, which may have contributed to their abnormal development. Biallelic expression of the H19 gene has been reported in cloned mouse embryos, along with imprinting disruptions of other genes as well [25]. Mann et al. [25] reported that only about 4% of embryos had normal expression patterns of the imprinted genes examined, which may help explain the low efficiency of mouse cloning. In full-term cloned mice, however, expression patterns, as well as levels of H19 mRNA in the placenta, were found similar to those of control mice [26, 27]. These observations suggest that mouse clones that developed to full term and survived after birth have relatively normal expression of imprinted genes. Recently, Dindot et al. [28] reported normal allelic expression of Igf2 and Gtl2 (gene trap locus 2) in Day 40 bovine cloned fetuses and placentas. These cloned fetuses were derived from donor cells of a bovine interspecies hybrid (Bos gaurus x B. taurus). Because these cloned fetuses were removed in early gestation for imprinting determinations, it is unclear whether they would have survived to full term and beyond. Because cloned mice from genetically heterozygous F1 mice survive better than those cloned from inbred mice [29], it is possible that this may also be true in the bovine and that the normal imprinting patterns found by Dindot et al. [28] might have reflected those from surviving clones of highly heterozygous background. The animals used in the present study, however, were all pure bred except for one, and all died shortly after birth, although they did develop to full term. This may indicate that cloned cattle can tolerate a high degree of imprinting disruption at fetal stages, which may account for the higher efficiency of cattle cloning than other species. These imprinting disruptions, however, rendered the bovine cloned fetuses weaker than those from natural reproduction, and the abrupt postnatal change in environment was sufficient to induce life-threatening stress to the newborn calves, causing them to die shortly after birth. The cause of imprinting disruption in these cloned animals may be related to the donor cell's imprinting pattern, although it is impossible to study the expression patterns of H19 retrospectively in the very cells that gave rise to these clones.
In a naturally reproduced offspring of a cloned cow, expression of the imprinted H19 gene was found completely normal, although we don't have allele-specific expression data for the cloned cow because she is homozygous for this SNP and her imprinting patterns could not be determined. The fact that this clone did not die after birth does not necessarily indicate that she did not have imprinting disruptions. Nonetheless, even if the clone had imprinting disruptions, the fact that the offspring produced naturally had normal imprinting patterns suggests that epigenetic anomalies in cloned animals were not inherited and could be corrected by natural reproduction.
In summary, in the present study, we established for the first time that the H19 gene is imprinted in domestic cattle and imprinting disruption of H19 can be present in developmentally abnormal animals produced by nuclear transfer. The identification of an expressed SNP in the H19 gene would allow its use as a marker to study the causes of developmental abnormalities associated with other assisted reproductive technologies.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: X. Cindy Tian, 1392 Storrs Road, Storrs, CT 06269-4243. FAX: 860 486 8809; xtian{at}canr.uconn.edu ![]()
3 Current address: College of Animal Science, South China Agricultural University, Guangzhou 510642, People's Republic of China ![]()
Received: 10 May 2004.
First decision: 7 June 2004.
Accepted: 21 June 2004.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Lucifero, J. Suzuki, V. Bordignon, J. Martel, C. Vigneault, J. Therrien, F. Filion, L. C. Smith, and J. M. Trasler Bovine SNRPN Methylation Imprint in Oocytes and Day 17 In Vitro-Produced and Somatic Cell Nuclear Transfer Embryos Biol Reprod, October 1, 2006; 75(4): 531 - 538. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Cobbe Why the apparent haste to clone humans? J. Med. Ethics, May 1, 2006; 32(5): 298 - 302. [Full Text] [PDF] |
||||
![]() |
C. Curchoe, S. Zhang, Y. Bin, X. Zhang, L. Yang, D. Feng, M. O'Neill, and X. C. Tian Promoter-Specific Expression of the Imprinted IGF2 Gene in Cattle (Bos taurus) Biol Reprod, December 1, 2005; 73(6): 1275 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fujimoto, S.M. Mitalipov, L.L. Clepper, and D.P. Wolf Development of a monkey model for the study of primate genomic imprinting Mol. Hum. Reprod., June 1, 2005; 11(6): 413 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Morgan, F. Santos, K. Green, W. Dean, and W. Reik Epigenetic reprogramming in mammals Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R47 - R58. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |