| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Stem Cell Biology,3 Medical Research Center, MizMedi Hospital, 157-280 Seoul, Korea
Department of Life Science,4 College of Natural Sciences, Hanyang University, 133-791 Seoul, Korea
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cell line establishment, embryo, human embryonic stem cell lines, human endometrium, human feeder, xeno-free culture
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human uterine endometrial cells (hUECs) regulate embryonic development and successful implantation in the reproductive track. Their growth and differentiation vary according to the menstrual cycle due to hormonal regulation. Throughout the menstrual cycle, hUECs express various factors, including growth factors (IGF, EGF, and TGFß) [17–21], cytokines (CSF, LIF, and interleukin-1 and -6) [22– 27], and cell adhesion molecules (ECMs and integrin) [28– 31] to control embryonic development and allow successful implantation. Some of these factors (such as LIF and TGFß1) secreted in hUECs are known to be key regulators related to hES cell self-renewal. Additionally, various ECMs and cell adhesion molecules are expressed in hUECs, and these factors also have an important role in maintaining the undifferentiated state of hES cells [12].
In the present study, we examined the availability of hUECs as a feeder cell, attempted to establish and maintain new hES cell lines by using hUEC feeder cells, and confirmed the characteristics of newly established hES cell lines.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Human endometrium was obtained by biopsy following institutional review board (IRB) approval and the receipt of informed consent from the subjects. The obtained endometrium was minced finely and digested enzymatically with 0.25% collagenase (Sigma, St. Louis, MO) and 10 U/ml DNase I (Sigma) in DMEM/F-12 (GibcoBRL/Invitrogen, Grand Island, NY). Dissociated hUECs were cultured in DMEM/F-12 supplemented with 10% FBS (Hyclone, Logan, UT), 4 mM glutamine (GibcoBRL/Invitrogen), 20 mM HEPES, 100 U/ml penicillin, and 100 µg/ml streptomycin (Sigma).
Preparation of Feeder Layers
Cultured hUECs were mitotically inactivated with 10 µg/ml mitomycin C (Sigma) for 1.5 h and washed three times with PBS. Mitotically inactivated hUECs were then trypsinized with trypsin-EDTA (GibcoBRL/Invitrogen) and washed twice with culture medium. The dissociated hUECs were counted and plated on gelatin-coated four-well plates at 8.0 x 105 cells per well (Nunc, Roskilde, Denmark).
Culture of Human Embryos
Cryopreserved human pronuclear (PN)-stage embryos were donated following IRB approval and the receipt of informed consent by couples undergoing in vitro-fertilization treatment. Eight rapidly thawed PN-stage embryos were first cultured in G1.2 medium until the eight-cell stage, and then transferred to G2.2 medium (Vitrolife, Denver, CO) [7, 32]. After 3– 4 days of prolonged culture, seven fully expanded blastocysts were collected to isolate ICMs.
Immunosurgery
Cultured blastocysts were first removed from the zona pellucida using 0.5% Pronase (Sigma). These blastocysts were exposed to 100% anti-human-serum antibody (Sigma) for 20 min and washed three times with PBS for 5 min. Washed blastocysts were transferred to guinea pig complement (Life Technologies, Karlsruhe, Germany) at 37°C in 5% CO2 [32]. After 20 min, the blastocysts were washed and the isolated ICMs were transferred onto mitotically inactivated hUEC feeder layers.
Culture of hES Cells
Immunosurgery was performed on seven blastocysts to obtain their ICMs. To culture isolated ICMs, the culture medium for feeder cells was changed to DMEM/F12 containing 20% knockout serum replacement, 1 mM glutamine, 0.1 mM ß-mercaptoethanol, 1% nonessential amino acids, and 4 ng/ml bFGF (GibcoBRL/Invitrogen). Transferred ICMs were cultured on hUEC feeder layers for 6–8 days in the initial passage, after which the cultured cells formed colonies. These colonies were split onto newly prepared hUEC feeder layers, and the culture was prolonged. After 10 passages of the culture, the colonies were split every 5 days.
Immunocytochemistry
After 20 passages of the culture on hUEC feeder layers, hES cells were tested for the expression of pluripotent cell-specific markers. To detect APase activity, cultured cells were fixed with 4% paraformaldehyde. Fixed cells were permeabilized with 0.2% Triton X-100 and washed three times with PBS. APase staining was performed using a kit containing NBT/BCIP as the substrate (Roche Molecular Biochemicals, Indianapolis, IN). When continuously proliferating cells appeared dark blue, we observed the stained colony under light microscopy. The expressions of surface marker antigens were confirmed using SSEA-3, -4 (positive), and -1 (negative). Fixed cells were incubated with each primary antibody and were localized with biotinylated secondary antibody conjugated with avidin and horseradish peroxidase complex (Vectastain ABC system; Vector Laboratories, Burlingame, CA). The localization, color reaction, and visualization of red staining by light microscopy were performed using a Vector NovaRED substrate kit (Vector Laboratories).
Cell Line Identification and Karyotyping
We extracted each genomic DNA from Miz-hES-9, -14, -15, and hUEC and applied DNA fingerprinting using short tandem repeat (STR) loci amplified by PCR to identify established hES cell lines [32]. The STR loci that we used were D3S1358 (Chromosome 3p), vWA (12p12-pter), FGA (4q28), amelogenin (X:p22.1
22.3 &Y:p11.2), TH01 (11p15.5), TPOX (2p23-2per), CSF1PO (5q33.3-34), D5S818 (5p22-31), D13S317 (13q2231) and D7S820 (7q11.2122).
To analyze the karyotypes of hUEC feeder cells and hES cells, cell division was blocked by 0.1 µg/ml colcemid (Gibco/Invitrogen) in metaphase for 1–2 h. Cells were then trypsinized and resuspended in hypotonic KCl solution (Sigma), incubated for 20 min at 37°C, and fixed with 3:1 methanol:acetic acid. Chromosomes were visualized using G-band staining. More than 100 cells were examined in this way.
Differentiation of hES Cells In Vivo and In Vitro
The hES cell colonies that were cultured for longer than 20 passages on hUEC feeder layers were harvested clear of feeder cells. Prepared colonies were injected with a sterile 25-gauge needle into the right testis of 4-wk-old SCID-beige mice according to the statement on the use of animals in our institute. The injected mice were killed 12 wk after this injection and the resulting tumors were fixed with 4% paraformaldehyde and embedded in paraffin. The paraffin blocks were sectioned at 10 µm, stained with hematoxylin-eosin, and the tumors observed under a light microscope.
To confirm the differentiation of hES cells in vitro, they were harvested mechanically and washed to remove the feeder cells. Harvested hES cells were transferred into embryoid body (EB) culture medium (DMEM/F-12 supplemented with 20% serum replacement, 1 mM glutamine, 0.1 mM ß-mercaptoethanol, and 1% nonessential amino acids except for bFGF) and cultured continuously. At days 7, 14, and 24 after the beginning of culture, EBs were prepared for RNA isolation. Total RNA isolation from hES cells and differentiated cells was performed using TRIzol reagent according to the manufacturer's protocol (GibcoBRL/Invitrogen). Isolated RNA was quantified with a spectrophotometer (Spec3000; Bio-Rad, Hercules, CA) and reverse transcription (RT) was performed with 1 µg of total RNA in each sample. To confirm the differentiation ability of hES cells, PCR was performed with various differentiation-marker primers: ectoderm (NF-68: forward, acgctgaggaatggttcaag; reverse, tagacgcctcaatggtttcc; keratin: forward, aggcccaatacgaggagatt; reverse, atagccactggagatggtgg), mesoderm (CMP: forward, aaaaagggcaatgacaccag; reverse, ttgtgcagtctctgaggtgg; kallikrein: forward, gctttctcagccaggacatc; reverse, tattctttgcctcccaggtg; enolase: forward, gttcaatgtcatcaatggcg; reverse, gtgaacttctgccaagctcc), and endoderm (
-FP: forward, tgaaaaccctcttgaatgcc; reverse, tcttgcttcatcgtttgcag; 1-AT: forward, actgtcaacttcggggacac; reverse, ccccattgctgaagacctta). Oct-4 (forward, gacaacaatgagaaccttcaggaga; reverse, ttctggcgccggttacagaacca) was used as a positive control for undifferentiated hES cells [3, 5–8]. PCR cycles consisted of an initial denaturation step at 94°C for 5 min, followed by 30 cycles of 30 sec of denaturation at 94°C, 30 sec of annealing at 62°C, and 30 sec of extension at 72°C. A final extension was performed at 72°C for 10 min. PCR products were visualized by ethidium bromide staining following 1.5% agarose gel electrophoresis.
Flow Cytometry
To analyze the DNA content of hES cells, Miz-hES-9, -14, and -15 colonies were harvested with 0.1% collagenase IV (Sigma) and washed twice with PBS. These colonies were dissociated into single cells with 0.5 mM EDTA (Sigma). Separated cells were fixed with 70% ethanol at 4°C for more than 1 h and then washed clear. Fixed cells were stained with 100 µg/ml propidium iodide (Sigma) containing 100 µg/ml RNase, and measured by flow cytometry (Epics Altra; Beckman Coulter, Miami, FL).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Three hUEC lines were isolated and cultured: two (Miz-endo1 and -2) from endometrial tissues obtained at the midproliferative phase, and the third (Miz-endo3) from the tissue obtained at the midluteal phase. Miz-endo1 and -2 could be cultured for more than 25 passages, whereas Miz-endo3 showed limited proliferation. Frozen-thawed hUECs isolated at the midproliferative phase exhibited similar growth characteristics. Miz-endo1 and -2 showed similar growth patterns, and hence we mainly used Miz-endo1 in this experiment. The morphology of Miz-endo1 cells was different from that of MEF feeder cells (Fig. 1). Miz-endo1 and -2 were split every 5 days because they reached confluence within a short period of time. At passage 3, cultured hUECs were first used as feeders to support the establishment and maintenance of hES cells and were used continuously until they became senescent.
|
Maintenance of hES Cell Lines Established on hUEC Feeder Layers
In the culture of donated embryos, seven blastocysts were obtained from eight cultured PN-stage embryos, and the ICMs of these blastocysts were isolated by immunosurgery. Three transferred ICMs were attached to hUEC feeder layers and continuously proliferated in the initial passage. Proliferating cells formed colonies after 7–8 days in the culture, and these colonies were split onto newly prepared hUEC feeder layers. They exhibited slow proliferation compared with the growth of other hES cells (Miz-hES-1, National Institutes of Health registered) until passage 7 or 8. Miz-hES-9, -14, and -15 were in continuous cultures for 55, 40, and 50 passages, respectively. They have been split onto new feeder layers every 5–6 days. The hES cells cultured on hUEC feeder layers were thinner, flatter, and more angular than MEF-based hES cells, and boundaries between hES cells and feeder cells were more evident (Fig. 2).
Expression of Pluripotent Cell-Specific Markers
The expression of several cell-surface markers was confirmed by immunocytochemistry. Miz-hES-9, -14, and -15 expanded on hUEC feeder layers showed the same expression patterns of pluripotent cell-specific markers as MEF-based hES cells. The hUEC-based hES cells were positive for SSEA-3 and -4 and APase but were negative for SSEA-1 (Fig. 3). Feeder cells were negative for all surface makers used in this experiment.
DNA Finger Printing and Karyotype Analysis
All hES cell lines could be distinguishable because they showed different STR loci, including D3S1358 (chromosome 3p), vWA (12p12-pter), FGA (4q28), amelogenin (X: p22.122.3 &Y:p11.2), TH01 (11p15.5), TPOX (2p23-2per), CSF1PO (5q33.334), D5S818 (5p22-31), D13S317 (13q2231), and D7S820 (7q11.2122) (Fig. 4, A–C).
|
Karyotype analysis was performed with hUECs and hES cells expanded on hUEC feeder layers. Miz-endo1, and Miz-hES-9, -14, and -15 showed normal 46, XX karyotypes (Fig. 4D), as did the frozen-thawed hUECs (data not shown). Karyotype analysis was performed every 6 mo.
Formation of Teratomas and EBs
SCID-beige mice were killed 12 wk after being injected with undifferentiated hES cells to confirm the formation of teratomas. Teratomas had formed in the right testes of all three mice injected with Miz-hES-9, -14, and -15 and appeared as well-differentiated tumor-like structures, including kidney-like structure, primitive neural tube, skin, gastrointestinal epithelium, tooth-like structure, and cartilage (Fig. 5).
|
EBs cultured for 7, 14, and 24 days in suspension also showed the expression of tissue-specific markers. Almost all of the tissue-specific markers were expressed in differentiated EBs, with the expression level gradually increasing with time from the induction of differentiation. However NF-68, kallikrein, and enolase were also expressed in undifferentiated hES cells, and the expression of Oct-4 gradually decreased in differentiated cells (Fig. 6).
|
Proliferation Properties of hES Cells
MEF and hUEC feeder cells comprised 10.0% and 10.24% of proliferating cells, respectively, but the composition of proliferating cells was higher in Miz-hES-9 (47.6%), -14 (48.6%), and -15 (48.2%) lines than in feeder cells. Each hES cell line established and maintained on hUEC feeder layers showed a slightly higher composition of proliferating cells than MEF-based Miz-hES-3 (40.4%). Miz-hES-3 expanded on hUECs for more than 20 passages showed a slightly increased proportion of the cells in the S phase (44.6%; Fig. 7).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In feeder-free culture conditions for hES cells, ECMs, including laminin, collagen, and fibronectin, play an important role in maintaining hES cells in an undifferentiated state. In 2001, Xu and colleagues [10] were the first to demonstrate that the expression levels of integrin6 and ß1 in hES cells cultured on Matrigel or laminin were similar to those in MEF-based hES cells, and that these ECM-based hES cells maintained typical hES cell characteristics. The expression level of laminin and proliferation capacity were slightly higher in hUECs and hES cells cultured on hUECs. We thought that the expression level of laminin in feeder cells may affect the maintenance of hES cells in an undifferentiated state and that other factors expressed in feeder cells, such as LIF and TGFß1, may regulate the growth of hES cells. There are previous reports that LIF and TGFß are expressed in normal human endometrium and regulate downstream signaling through the activation of JAK/STAT kinase and Smads, respectively. Oct-4 and Nanog are associated with hES cell self-renewal, and the expression of these factors is regulated by LIF, BMP, and TGFß [33–35]. The hES cells maintained on hUEC feeder cells might be regulated by their proliferation and differentiation by spontaneous expression of these factors in hUEC feeder cells.
The hUECs directly interact with embryos and regulate the embryonic development and successful implantation in vivo. Although the characteristics of these cells differed with the endometrial phase, some factors, including ECMs, growth factors, and cytokines are expressed in hUECs throughout the menstrual cycle. Richards and colleagues [16] attempted to use hUECs as feeder cells to support the growth of hES cells and reported that adult glandular endometrium and adult stromal endometrium cannot maintain hES cells in an undifferentiated state. However, we have established and maintained three hES cell lines on hUEC feeder cells in our institute. Our different results may be attributable to the different endometrial phases used. Miz-endo1 and -2 obtained from the midproliferative phase can support the continuous growth of hES cells and maintain hES cells in an undifferentiated state, whereas Miz-endo3 obtained from the midluteal phase cannot.
The hUECs have the advantage that they can be used for many passages, whereas MEF feeder cells exhibit a limited number of passages when they were used as feeders. However, hUECs showed a similar capacity to support the continuous growth of hES cells before they become senescent. An hUECs feeder cell line can be used for more than 1 yr, allowing the long-term culturing of hES cells under stable conditions. In addition to this, human feeder cells are more convenient than primary cultured MEF feeder cells in terms of the absence of a requirement for animal facilities.
For the eventual application in cell-based therapy, hES cells should be free from the risks of pathogen transmission and viral infection, and it is ideal that hES cells are cultured under stable xeno-free culture condition. Until now, however, it has been hard to eliminate animal materials completely for establishment and expansion of hES cells. Immunosurgery, a common method to isolate ICMs of blastocysts, has been performed by using anti-human-serum antibody purified from rabbit and guinea pig complement [1, 3, 6, 7]. Although these materials do damage to only trophoectoderms, there is still a possibility of exposure to animal and/or viruses. Also, animal serum (usually FBS or FCS) has been used for attachment and growth of feeder cells to support the establishment and growth of hES cells [1–3, 6, 7, 11, 14–16, 32]. Although hES cells are cultured under feeder-free condition risks of pathogen transmission and viral infection still remains because the materials from animal sources such as feeder-CM and ECM gel (usually Matrigel) have still been used for the growth of hES cells [10, 12, 13]. Up to now, there have been no hES cell lines established and maintained under complete xeno-free culture condition even though some have been represented as a xeno-free culture system for the culture of hES cells without animal serum and by preventing direct interaction with animal cells [14, 16]. In our experiment, we also partially used animal materials for immunosurgery and culture of hUECs. However, Miz-hES-9, -14, and -15 were established and maintained without direct interaction with animal cells and animal serum. Therefore, we thought that our results are in the process of becoming complete xeno-free culture conditions.
Our results demonstrate that hES cell lines can be established and maintained on hUEC feeder layers. Newly established hES cell lines have typical hES cell characteristics such as continuous growth, expression of cell surface markers, normal karyotype, and differentiation capacity. These hES cells show elevated proliferation capacity, which might be due to the effects of the expression levels of ECMs and embryotrophic factors in feeder cells (data not shown). The establishment and expansion of hES cells under a completely xeno-free culture system might be helpful to cell-based therapies. Therefore, continuous investigation for the improving culture condition should be performed to make complete xeno-free culture systems. These will lead us to obtaining available hES cells under xeno-free culture system in the near future.
|
FOOTNOTES |
|---|
2 Correspondence: Hyun Soo Yoon, Division of Stem Cell Biology, Medical Research Center, MizMedi Hospital, 701-4, Naebalsan-dong, Kangseo-ku, Seoul 157-280, Korea. FAX: 82 22 007 1852; yoon{at}mizmedi.net
Received: 24 June 2004.
First decision: 19 July 2004.
Accepted: 17 August 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  C. E. Gargett, K. E. Schwab, R. M. Zillwood, H. P.T. Nguyen, and D. Wu Isolation and Culture of Epithelial Progenitors and Mesenchymal Stem Cells from Human Endometrium Biol Reprod, June 1, 2009; 80(6): 1136 - 1145. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R Placzek, I-M. Chung, H. M Macedo, S. Ismail, T. Mortera Blanco, M. Lim, J. Min Cha, I. Fauzi, Y. Kang, D. C.L Yeo, et al. Stem cell bioprocessing: fundamentals and principles J R Soc Interface, March 6, 2009; 6(32): 209 - 232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Unger, H. Skottman, P. Blomberg, M. Sirac Dilber, and O. Hovatta Good manufacturing practice and clinical-grade human embryonic stem cell lines Hum. Mol. Genet., April 15, 2008; 17(R1): R48 - R53. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Batten, N. A Rosenthal, and M. H Yacoub Immune response to stem cells and strategies to induce tolerance Phil Trans R Soc B, August 29, 2007; 362(1484): 1343 - 1356. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Mannello and G. A. Tonti Concise Review: No Breakthroughs for Human Mesenchymal and Embryonic Stem Cell Culture: Conditioned Medium, Feeder Layer, or Feeder-Free; Medium with Fetal Calf Serum, Human Serum, or Enriched Plasma; Serum-Free, Serum Replacement Nonconditioned Medium, or Ad Hoc Formula? All That Glitters Is Not Gold! Stem Cells, July 1, 2007; 25(7): 1603 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mantel, Y. Guo, M. R. Lee, M.-K. Kim, M.-K. Han, H. Shibayama, S. Fukuda, M. C. Yoder, L. M. Pelus, K.-S. Kim, et al. Checkpoint-apoptosis uncoupling in human and mouse embryonic stem cells: a source of karyotpic instability Blood, May 15, 2007; 109(10): 4518 - 4527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Allegrucci and L.E. Young Differences between human embryonic stem cell lines Hum. Reprod. Update, March 1, 2007; 13(2): 103 - 120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Skottman and O. Hovatta Culture conditions for human embryonic stem cells. Reproduction, November 1, 2006; 132(5): 691 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Trounson The Production and Directed Differentiation of Human Embryonic Stem Cells Endocr. Rev., April 1, 2006; 27(2): 208 - 219. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
