Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print September 8, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.029835
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/2/266    most recent
biolreprod.104.029835v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.
Agricola
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.
BIOLOGY OF REPRODUCTION 72, 266–275 (2005)
DOI: 10.1095/biolreprod.104.029835
© 2005 by the Society for the Study of Reproduction, Inc.

Characterization of a Murine Alpha 2 Macroglobulin Gene Expressed in Reproductive and Cardiovascular Tissue1

Hong He3, Daniel J. McCartney3, Qingxia Wei5, Souad Esadeg3, Jianhong Zhang3, Robert A. Foster4, M. Anthony Hayes4, Chandrakant Tayade3, Fred Van Leuven6, and B. Anne Croy2,3

Departments of Biomedical Sciences3 Pathobiology,4 University of Guelph, Guelph, Ontario, Canada N1G 2W1 Labatts Brain Tumor Research Center,5 Hospital for Sick Children, Toronto, Ontario, Canada M5G 1X8 Experimental Genetics Group,6 Department of Human Genetics, K.U. Leuven, B-3000 Leuven, Belgium


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Full-length cDNA for a mouse gene A2-macroglobulin induced by pregnancy (A2mp) was cloned from mesometrial decidua at Gestation Day 10. The 4622-base pair cDNA encodes a protein of 1473 AA with >70% sequence identity and all typical domains of other A2M-family members in humans and rodents, despite unique absence of hepatic expression. The bait region is most distinct and has the greatest sequence similarity with rat acute-phase A2m. Northern blotting, reverse transcription and real-time-PCR, and in situ hybridization studies using C57Bl/6 mice revealed uterine induction of A2mp during decidualization and strong, midgestational association with modifying spiral arteries. Ovaries, testes, lactating mammary glands, heart, and kidney were the only additional organs with A2mp expression that was localized to granulosa and cumulus cells in secondary follicles; primary seminiferous epithelium, including Sertoli cells, mammary alveolar, and ductal epithelium; cardiac endothelium; and renal collecting tubules, respectively. Infusion of native human A2M into pregnant alymphoid or interferon-gamma gene-ablated mice overcame blocks to pregnancy-induced spiral artery modification in these strains. Activated human A2M was also effective, suggesting mechanisms independent of proteinase inhibition. Identification of cytokines, growth factors, or other molecules bound to A2MP should provide new insights into decidualization, spiral artery modification, and cardiovascular adaptation to pregnancy.

cytokines, decidua, mammary glands, ovary, testis


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A2-macroglobulin (A2M) gene-family products are major plasma proteinase inhibitors synthesized predominantly by the liver. A2Ms inhibit and regulate all four proteinase subclasses and bind endogenous or foreign peptides, providing a barrier against pathogens. A2Ms inhibit proteinases by steric trapping, forming a cage-like structure around the proteinase and simultaneously exposing their receptor domain for clearance of A2M-proteinase complexes [1–4]. A2Ms also bind cytokines and growth factors by a mechanism distinct from proteinase trapping that leads to clearance or stabilization of biologically active molecules, preventing clearance [1, 5]. Two A2Ms are reported in humans, prototypic A2M and pregnancy zone protein [PZP; 6, 7]. Neither are acute-phase reactants, although plasma PZP is induced to significant levels only in pregnancy [8, 9]. Three rat A2Ms are described, i.e., prototypic A1M, the acute phase A2M, an IL-6-regulated reactant, and a decidua-associated form named RPZP or DAP [10, 11]. Four mouse A2M genes are known, i.e., mouse A2m (MAM) and three murinoglobulins (Mug) 1–3, the single chain family members also known in rats [12].

The maternal-fetal interface is a dynamic locale, rich in cytokines and proteinases. Human uterus expresses A2M in the secretory phase of the menstrual cycle as decidualization is initiated [13]. PZP is expressed after implantation and has been localized to placental villous parenchyma and placental blood vessels [14]. In rats and mice, decidualization begins on the antimesometrial side of the uterus at implantation and is essential for pregnancy success. Rodent decidualization rapidly advances toward the mesometrium, where systemic vascular and neuronal connections are found, and regresses antimesometrially. Mesometrial decidua, commonly called decidua basalis, persists throughout gestation [15] and, in rats, A2Ms are localized to decidua [11, 16].

In rodents, mesometrial decidualization is accompanied by a massive influx of natural killer lymphocytes (NK cells) that synthesize IFN{gamma}. Uterine (u)NK-cell derived interferon (IFN){gamma} maintains decidual transformation of endometrial fibroblasts and sensitizes spiral arteries, the major vascular channels to placentae, permitting pregnancy-associated arterial modification, (i.e., reduced wall structure, lumen dilation, and vessel elongation). This is a process restricted in women with preeclampsia [17–19]. To address potential targets of uNK cell-derived IFN{gamma}, a gene-profiling study (GEM array custom service provided by Genome Systems Inc., St. Louis, MO) was conducted using pregnant C57Bl/ 6J (B6) females. Poly(A) RNA was isolated from the pooled mesometrial triangles of 25 mice at Gestation Day (gd) 6, the day uNK cells first appear in significant numbers, and from the pooled mesometrial lymphoid aggregates of pregnancy of a further 25 mice at gd10, the day peaks in uNK cell numbers and IFN{gamma} production are achieved. This analysis (unpublished) revealed genes encoding A2m and its receptor, low-density lipoprotein receptor-related peptide (Lrp), were upregulated two- to threefold. More strongly upregulated (>eightfold at gd10) was message hybridizing to a 529-base pair (bp) expressed sequence tag (EST) #444715, a sequence described as "similar to human A2M-precursor." The full-length cDNA sequence, designated A2-macroglobulin induced by pregnancy (A2mp) has been cloned and its expression studied. Here, we report this newly defined gene is expressed in reproductive tissues, including spiral arteries during their pregnancy-induced modification, and in cardiovascular tissues that undergo adaptation during pregnancy. These findings suggest that the roles of PZP in human pregnancy merit further study.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice

C57Bl/6J (B6) and Ifn{gamma}o/o mice on a B6 background were purchased from Jackson Laboratories (Bar Harbor, ME). Mice of genotypes Rag2o/o/ {gamma}co/o [20] and MAMo/o/Mug1o/o [21] were bred at Guelph under barrier husbandry. The former mice lack all lymphocyte lineages and it was established by transplantation that their aberrant placental defect is due only to the lack of NK lineage cells [18, 22, 23]. The latter strain has a relative deficiency of decidua and overgrowth of the placenta [24]. All procedures complied with approved animal utilization protocols. For timed mating, females selected for estrus were paired to strain-matched males, then examined for copulation plugs. Plug detection was called gd0. Preimplantation, gd3 pregnancy was confirmed by blastocyst flushing. For uNK cell [23] or RNA isolation, mice were killed by CO2 and tissues were dissected and processed immediately. For histological study, mice were anesthetized and slowly perfused (4% paraformaldehyde [PFA], 0.1 M sucrose in PBS). Fixed uteri were cut into implantation sites, processed into paraffin, serially sectioned, and stained using hematoxylin and eosin (hematoxylin-eosin) for general histology or one of periodic acid Schiff reagent or Dolichos biflorus agglutinin histochemistry [25] to reveal uNK cells. Line and area morphometry and cell enumeration were performed on 11 sections from each of six different implantation sites from multiple dams when available and statistical analyses were performed as previously described [18], using Optimas 6.2 image analysis software (Optimas Corporation, Bothwell, MA) and one-way ANOVA with Tukey test.

Full-Length cDNA Cloning

Total RNA was isolated from mesometrial deciduas of 10 gd10 B6 mice (RNeasy Mini Kit, Qiagen). A cDNA library was constructed using SMART cDNA Library Construction Kit (Clontech). EST #444715 was purchased from Genome Systems Inc. (St. Louis, MO), cloned into the Topo TA Cloning Kit (Invitrogen), and used to probe the library. From the library, five positive clones (1.2–1.4 kilobases [kb]) were selected and sequenced (University of Guelph, Molecular Biology Super Centre). These clones had similar DNA sequences and each contained the full 529-bp EST # 444715. From the 5' end of the longest clone, GSP1 primer (TGTCCTTCTGCTGCTGGGAGAGACCA) was designed and used to obtain the full-length cDNA clone using the SMART RACE cDNA Amplification Kit (Clontech). From this cDNA sequence, end primers were designed (AGCCAGGTCTCCAGTCCTCT from the 5' end, designated GSP11, and TTGATGGATAGATATGAAAG from the 3', end designated GSP12). The 4.6-kb PCR product derived with these primers subcloned into the Topo TA kit gave eight clones that appeared similar by restriction digestion using EcoRI.

Sequence alignment was established using the Clustal W multiple sequence alignment tool (www.ebi.ac.uk/clustalw/index.html). EnSembl BLAST alignment (www.Ensembl.org/Mus-musculus) of the A2mp sequence determined chromosomal location and Conserved Domain-Search (www.ncbi.nlm.nih.gov/structure/cdd/cdd.shtml) was used to compare gene family members.

A2mp Expression

A2mp expression in uterus and liver was first studied by Northern blotting [26] using EST #444715 and 7S RNA as probes. Band intensities were compared by phosphoimaging using 7S for standardization. To identify tissues with A2mp expression, reverse transcription-polymerase chain reaction (RT-PCR) was employed. Total RNA was isolated from 13 male, 14 nonpregnant female, or 18 pregnant female tissue sources of 3- and 8-mo-old male mice (n = 5) and of multiple female mice at each of three different reproductive states, virgin, gd10, and nonpregnant postpartum (ranging from two to four parities) and from purified mouse uNK cells [24] using RNeasy Mini Kits (Qiagen). From 1–3 µg of each sample, cDNA was obtained using the First-Strand cDNA Synthesis Kit (Amersham). Primers for RT-PCR and predicted amplicon sizes were

A2mp: Pf(GTGACCGCCTTGGAGTCAAT) Pr(TATGCCGCTCGTTCATACAG), 474 bp;
Mug1: Pf(GTTTTGACTATGGCATGGTT) Pr(GCACACTCATCTGCATGCTT), 447 bp;
Mug2: Pf(TCCATAGACACTGCTGGCTT) Pr(GCACTCCTAAGTCCCCCTTC), 247 bp;
A2m: Pf(CCTGTCAACAGCATCCAAGA) Pr(GATCCTGACCCTTTGGTGAC), 276 bp;
Actb: Pf(TTCTTTGCAGCTCCTTCGTT) Pr(CTGGGTCATCTTTTCACGGT), 411 bp.
RT-PCR conditions were 94°C, 6 min; 30 cycles of 94°C, 30 sec; 56°C, 1 min; 72°C, 1 min; then 7-min extension and storage at 4°C. Amplicons were separated and visualized by electophoresis using 1% agarose gels.

Real-time PCR (LightCycler, Roche) was also employed to quantify temporal gene expression in the uterus, using the same primer sets and Quantitect SYBR green I mix (Qiagen). Beta 2 microglobulin (ß2m) was used as the standard for relative quantification and detected using the primers Pf (ACTGAATTCACCCCCACTGA) Pr (CTTTCTGCGTGCATAAATTG); product size 190 bp. LightCycler reactions were performed in 20 µl of total reaction volume as per manufacturer's instructions. PCR products were gel purified, quantified, and diluted serially to generate standard curves for A2mp and ß2m. Each reaction mixture contained 2 µl of cDNAs, 10 µl of SYBR green I master mix, 1 µl of sense and antisense primers each (0.5 µM), and 6 µl PCR-grade water supplied with the kit. The standardized LightCycler program for each gene was denaturation (947°C, 15 min); PCR amplification and quantification (95°C/10 sec, 58°C/ 5 sec, 72°C/20 sec) with the fluorescence measurement at specific acquisition temperatures for 5 sec repeated for 45–55 cycles. The melting program was 70–95°C at the rate of 0.1°C/sec with continuous fluorescence measurement, with the final cooling step at 40°C. Data were quantified using RelQuant LightCycler analysis software. Second-derivative maximum analysis, arithmetic baseline adjustment, and polynomial calculation methods were used for the quantification. Baseline curve, melting curve, melting point, crossing point, slope error (0.1–0.5), and correlation (r – 1) were critically monitored for each round of analysis. The ratio between A2mp and ß2m was used as a level of mRNA gene expression.

In Situ Hybridization

Tissues for in situ hybridization were fixed (4% PFA in PBS), wax embedded by hand, and sectioned under Rnase-free conditions. Virgin uteri and gd6, 8, 10, and 12 implantation sites from B6 and Rag2o/o/{gamma}co/o were studied, as were B6 tissues expressing RT-PCR transcripts. These included testes from males of proven fertility; heart and kidney from adult virgin, gd10, and parous females; ovaries from cycling and gd10 females; and mammary glands from peripartum (±24 h) dams. Liver was included as a specificity control. Hybridization was conducted according to the Nonradioactive In Situ Hybridization Application Manual (Roche). EST #444715 (529 bp) was subcloned into the Topo TA Cloning Kit (Invitrogen) as the probe, using T3 and T7 RNA polymerases to obtain sense RNA (negative control probe used in every assay) and antisense RNA (experimental probe).

Treatment with Human {alpha}2M

Pregnant RAG-2o/o/{gamma}co/o and IFN{gamma}o/o mice do not show spiral artery modification [18, 22]. Native or methylamine-transformed (activated) huA2M from plasma [27] was given intravenously to females of these genotypes from gd6 to 11, at 0.3, 1.5, or 3.0 mg/day. Four to six mated females were treated at each dose as available. Control RAG-2o/o/{gamma}co/o received PBS while control IFN{gamma}o/o pregnancies were unmanipulated. Mice were killed at gd12 for spiral artery morphometry as described above.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Isolation of A2mp Full-Length cDNA Clone

Five cDNA clones (1.2–1.4 kb) were identified by screening our gd10 B6 mesometrial decidual cDNA library with EST #444715. Except for a single base pair, these sequences were identical, contained poly(A) tails, and included the entire EST #444715 sequence. For 5'-RACE extensions, a 20-bp primer was designed and, in combination with a nested universal primer, a 3.5-kb RT-PCR product was obtained and subcloned. RT-PCR with primers designed at each end of the A2mp cDNA sequence yielded a 4.6-kb product that was subcloned and sequenced from both ends. It was identical to the 3.5-kb A2MP sequence. The full-length cDNA was designated A2mp and deposited (GenBank AY185125). The sequence of the predicted, translated protein (Fig. 1A) showed all the classical features of the A2M family, i.e., a signature bait region, the receptor binding domain, and the internal thiol ester region (Fig. 1C; [28]). The most distinctive features are the bait region at AA 692–731 and a short stretch at AA 1177–1197, shared with MAM, but different from other family members. A2MP has greatest amino acid sequence similarity to the acute phase rat A2M (Fig. 1D). Significantly, and most interestingly, this homology is very pronounced in the bait region. A2MP is more similar to the human than murine A2M gene family and homology with human PZP is greater than with rat PZP. The cDNA corresponded to a gene that mapped in the A2M gene cluster on mouse chromosome 6 (Fig. 1B).



View larger version (64K):
[in this window]
[in a new window]
  		FIG. 1. a) The AA sequence of A2mp (1473 AA) derived from the cDNA sequence deposited as GenBank AY185125. The bait region is bold and underlined, the thiol ester region is bold, the receptor-binding domain is underlined, and the unique 20 AA stretch is bold italic. b) The region of mouse chromosome 6 (adapted from Ensembl Blastview/Contigview) around the area of significant alignment with A2mp nucleotide sequence after BLASTN sequence comparison of the mouse genome. Area labeled A2MP is an Ensembl-predicted novel gene (3289 bp) 96% similar to the obtained A2mp nucleotide sequence. c) The A2mp gene with its two conserved domains (dark) within the AA sequence, A2M family N-terminal region and C-terminal region, identified by Conserved Domain-Search. Other areas are regions of the gene not associated with conserved domains. The central area contains bait region of A2mp sequence. d) Graphical representation of A2MP AA sequence similarity of different functional areas (thiol ester [TE] region, receptor binding domain [RBD], bait region) to other A2M family members; rat A2M (rA2M), rat pregnancy zone protein (RPZP), human A2M (hA2M), human pregnancy zone protein (hPZP), murinoglobulin-1 (MUG1), mouse A2M (MAM). Percent values indicate sequence similarity and were obtained using Clustal W multiple sequence alignment tool

Time-Course of A2mp Expression in Uterus

The time course of A2MP expression in uteri of adult B6 and alymphoid RAG-2o/o/{gamma}co/o mice was established by Northern blotting and real-time PCR (Fig. 2). Northern analyses of RNAs from mesometrial tissues of gd3 to gd14 and from liver revealed that A2mp mRNA was not present in liver or in the virgin or preimplantation, nondecidualized uterus in multiple experiments. A2mp mRNA was readily detected in B6 mesometrial decidua at gd6, increased sevenfold relative to 7S RNA at gd8 and gd10, then decreased at gd12 and 14. In a second series of pregnant B6 females, examined by real-time PCR, A2mp expression was detected at very low levels in nonpregnant and gd6 uteri, with the highest expression being at gd8–10; expression then declined over the rest of gestation, reaching that of the nonpregnant uterus at gd18 and 19. A2mp was also expressed in uteri from pregnant alymphoid mice but at lower, more variable levels.



View larger version (50K):
[in this window]
[in a new window]
  		FIG. 2. A) Northern analysis of the gestational time course for expression of A2mp versus 7S RNA in uterus and in virgin liver for C57Bl/6J (rows 1 and 2) and for alymphoid Rag2o/o/{gamma}co/o mice (rows 3 and 4). No A2mp expression was detected in liver although the same samples showed expression of A2m and Mug1 (not shown). Expression was also absent from virgin uterus (NP) and from pregnant, nondecidualized uterus (gd3). Uterine expression was present in both strains on gd6, 8, 10, 12, and 14. B) Densitometry suggested signal increased equivalently on a per cell basis in both strains between gd6 and 10 and then declined with relative loss of signal more rapid in alymphoid mice. C) Illustrates tissue expression of mouse A2M family members in female B6 mice. Because Mug2 and -3 are not translated, Mug2 was used as representative of both genes and Mug3 was not analyzed. Mug1 translates to protein [12]. The entire study was repeated with male mice except that testes replaced ovarian and uterine samples. Testes expressed all transcripts studied. For other organs, results in males were the same as those in virgin females. The tissues sampled are listed at the top with PLN representing a pool of subcutaneous LN; MLN the mesenteric LN chain; Liv, liver; Spl, spleen; Kid, kidney; MG, mammary gland, SI, small intestine; Ut, uterus; and BM, bone marrow. The second row indicates the reproductive status of the tissue donor: M, multiparous; P, pregnant; and V, virgin. Fe represents gd10 fetus; Pl, the gd10 placenta; DB gd10, decidua basalis; Ml, the mesometrial lymphoid aggregate of pregnancy; NK, purified gd12 uNK cells; and Co, the amplified water control lacking only RNA. The left lane in each row is a 100-bp DNA ladder. The genes studied were mouse ß actin (Actb), A2mp, Mug1, Mug2, and A2M, as listed to the left of the image. D) Real-time PCR for the expression of A2mp in uterus throughout murine gestation. ß2m was used as an internal housekeeping gene standard. Values are expressed as a ratio between A2mp and ß2m mRNAs

A2mp Expression in Other Tissues

To define A2mp expression in other tissues and assess changes in transcription of A2M family members during pregnancy, total RNA was isolated from multiple organs of male mice or female mice that were virgin, pregnant at midgestation or parous, nonpregnant, nonlactating. From pregnant females, further RNA samples were prepared from four microdomains within gd10 implantation sites and from purified uNK cells isolated from decidua basalis at gd10– 13. Multiple animals were used for each category and provided independent replicate findings. RT-PCR was conducted using primers from the bait regions of A2mp, A2m, Mug1, and Mug2 [12]. Amplification of Actb mRNA served as an internal control. These results are summarized for female mice in Figure 2B. A2m, Mug1, and Mug2 transcripts were detected in liver but an A2mp transcript was not, even at midpregnancy. All four genes were constitutively expressed in ovary and in testes (not shown). A2m and A2mp transcripts were detected in uteri of various reproductive states, although Northern analysis indicated no significant expression of A2mp until decidualization. Mug1 and -2 were not expressed in uterus. A2m and A2mp were expressed by gd10 fetuses, placentas, decidua basalis, and gd10 (not shown) and 12 uNK cells. Real-time PCR analyses of decidual uNK cells from gd11 and 13 pregnancies confirmed A2mp's expression and showed its expression had declined eightfold in uNK cells at gd13 relative to ß2m (not shown). A2mp was the only family member expressed by the mesometrial lymphoid aggregate of pregnancy. A2mp was also the only family member transcribed in mammary tissue. Transcription correlated with the pregnant state. Real-time PCR time-course studies suggested initiation of elevated transcription in mammary tissue occurred at gd18 (not shown).

A2mp and A2m (but not Mug1 or -2) were expressed in the heart, independent of reproductive status or sex. A2m alone was expressed in lung of all females and males and in small intestine while Mug1 was expressed in stomach. Gastrointestinal transcription was not dependent on reproductive status or sex. A2m and A2mp transcripts were detected in kidneys of virgin, pregnant, parous, and male mice while renal Mug1 and Mug2 RNA were induced in postpartum mice.

In Situ Hybridization for A2mp in Implantation Sites, Gonads, Mammary Glands, Heart, Kidney, and Liver

In gd6 B6 implantation sites, A2mp mRNA was localized to lateral decidual cells. In gd-matched Rag2/o/{gamma}co/o, signal also localized to decidual cells but was weaker and more antimesometrial (Fig. 3), suggesting a slight delay in decidualization in alymphoid mice. The position of A2mp-expressing cells was not static and, in normal and alymphoid mice, hybridization moved mesometrially into decidua basalis. From gd8–12, the most intense signals were perivascular to the spiral arteries. At all time points studied, hybridization was always stronger in normal compared with alymphoid mice (Fig. 3). The only difference noted between the strains was at midgestation, when a strong signal was detected in undifferentiated mesometrial fibroblasts located between the myometrium and decidua basalis in alymphoid mice. This region in B6 did not express A2mp.



View larger version (122K):
[in this window]
[in a new window]
  		FIG. 3. Implantation sites from B6 and Rag2o/o{gamma}co/o at gd6, 8, 10, and 12 hybridized to A2mp. The mesometrial (M) side is at the top of each image; signal was stronger in B6 at all gd. At gd6, signal is most prominent in the lateral, secondary decidualization zone of B6 and in the primary, antimesometrial (AM) decidualization zone of Rag2o/o{gamma}co/o. No signal is found mesometrially. EC, Embryonic crypt; UL, residual uterine lumen. At gd8, the signal is strong in decidua basalis but absent from placenta (P) and from the interface between the mesometrial myometrium and fibroblasts. The strongest hybridization is in the central decidua over vessels called spiral arteries (arrow). Spiral arteries do not undergo histologically detectable wall thinning for approximately another 36 h [22]. The mesometrial lymphoid aggregate of pregnancy does not hybridize strongly. At gd10, the signal remains very strong over the central region of the implantation site and in association with spiral arteries (arrows), which are now modified in B6 but unmodified in Rag2o/o/{gamma}co/o. The interface between the myometrium and nondecidualized fibroblasts of Rag2o/o{gamma}co/o but not B6 has become strongly reactive (arrowhead). At gd12, hybridization is greatly diminished in each strain. A residual signal is detectable surrounding the spiral arteries (SA), shown at high power. Endothelial cells did not hybridize. Original magnification gd6 x50; gd8, gd10 x100; and gd12 x400

A2mp mRNA expression in ovaries was restricted to granulosa and cumulus cells of secondary antral follicles of virgin and gd10 B6 mice (Fig. 4). Primary follicles and corpora lutea did not express the A2mp message. Expression in testes was restricted to the ablumenal cell layers of seminiferous tubules that contain spermatogonia, primary spermatocytes, and Sertoli cells. Regularly spaced, single cells, thought to be Sertoli cells, showed a much stronger signal. Mammary glands from peripartum B6 showed hybridization over alveoli and ducts. Heart showed A2mp expression in the atria and in endothelial cells of the coronary arteries and their surrounding vascular supporting tissues. No signal was detected on myocytes (Fig. 4). A2mp expression in the kidney was localized to collecting tubules and individual cells within glomerular tufts (Fig. 4). The probe did not hybridize to liver, indicating its specificity for A2mp and inability to detect A2m or Mug (Fig. 4).



View larger version (163K):
[in this window]
[in a new window]
  		FIG. 4. In situ RNA hybridizations of A2mp to (A) ovary (gd10), (B) testes, (C) heart (virgin female), (D) mammary tissue (<24 h postpartum), (E) liver (multiparous), renal (F) medulla, and (G) cortex (gd15). Ovarian expression is in granulosa cells (arrows) surrounding the ovum and surrounding the antrum (A) of secondary (arrowhead) and preovulatory follicles. Expression was not detected in primary follicles or corpora lutea (CL). In testes, the basal cells of seminiferous tubules were labeled. These include spermatogonia, primary spermatocytes, and Sertoli cells. Some regularly spaced single cells expressed A2mp more strongly than the others. Interstitial cells were nonreactive. Upper and lower inserts are x2 magnifications of the tubule wall hybridized with the antisense probe (upper) and the sense probe (lower). A2mp hybridization in heart was to the atria, nonmyocyte perivascular cells of branches from coronary arteries, endothelium in vessels, including the aorta and linings of the heart chambers. A2mp was expressed in the newly lactating mammary gland with stronger expression in alveolar epithelium than ductal. Liver did not express A2mp, while renal expression was strong over the tubules shown in the medulla and seen in some of the cells of the glomerular tuft and its capsule (arrow). Original magnification A x100; B, C, G x400; and D–F x200

Assessment of Implantation Sites in Mice Treated with hu{alpha}2M

A bioassay of daily cytokine treatment of pregnant alymphoid mice is available [18], which could address the hypothesis that A2mp is a key gene upregulated by uNK cell-derived IFN{gamma} to promote the spiral artery sensitization that facilitates pregnancy-induced arterial modification. Because the A2mp gene product is not available, we used huA2M to see if this available, well-characterized member of the A2M family could compensate for reduced A2mp expression in the unmodified spiral arteries of pregnant alymphoid mice. At gd12, following 6 days of treatment, Rag2o/o/{gamma}co/o females that received native or activated huA2M, at each of three dosages tested, showed spiral artery modification when compared with PBS-treated controls (Table 1). The changes were similar in extent to those measured in Rag2o/o/{gamma}co/o receiving IFN{gamma} [18] and to changes in spiral artery parameters measured in normal gd12 B6. To further address the role of IFN{gamma} in this regulatory pathway, mated Ifngo/o females were given native huA2M at the intermediate dose for 6 days. This treatment induced spiral artery changes matching those in gd-matched B6 (Table 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Morphometric analysis of spiral arteries from gd12 pregnant control. Rag2o/o/{gamma}co/o and Ifngo/o mice treated daily from gd 6–11 with native or activated (*) human A2M

A2mp Expression in Implantation Sites of MAMo/o/Mug1o/o Mice

Spiral arteries of MAMo/o/Mug1o/o mice are dilated at midgestation but structurally anomalous, being surrounded by cuffs of trophoblast cells that show unusually rapid (precocious) invasion to the circular layer of the myometrium [24]. If A2Ms are key molecules regulating pregnancy-associated spiral arterial changes, A2mp expression should be maintained in MAMo/o/Mug1o/o implantation sites. In situ hybridizations on gd6 and 10 revealed strong A2mp expression. At gd6, hybridization was detected across the decidua, with strongest signals laterally and weak to no signal mesometrially. At gd10, hybridization localized mesometrially in decidua basalis and associated with spiral arteries (Fig. 5). Signal was detected in single, dispersed decidual cells (upper insert) as well as in larger perivascular cells (lower insert). The latter were previously shown to be cytokeratin-positive, prematurely deep, invading trophoblasts [24]. No signal associated with spiral arterial segments lying in the region of the mesometrial lymphoid aggregate of pregnancy, external to the circular smooth muscle or with endothelial cells.



View larger version (179K):
[in this window]
[in a new window]
  		FIG. 5. In situ hybridization of A2mp to gd6 and 10 implantation sites from MAMo/o/Mug1o/o. At gd6, (A) the signal was strong in primary antimesometrial (AM) and secondary lateral decidua (LD). Signal advanced (B) with the wave of secondary decidualization across the mesometrial side (M) of the implantation site. Myometrium (My) was negative; EC, embryonic crypt. At gd10, the signal was strongest across the decidua basalis and was focused centrally about the spiral arteries (arrowheads). The circular smooth muscle (My) remained none reactive, The mesometrial lymphoid aggregate of pregnancy was weakly reactive perivascularly. The higher power insets of gd10 decidua basalis show (C) dispersed reactive cells that may include uNK cells (see Fig. 2B) and (D) perivascular reactive trophoblast cells. Original magnification A, B x50; C x200; D x400


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
A2mp, a novel cDNA of the mouse A2M gene family, was molecularly cloned and found not to be transcribed in the liver but to be induced in the uterus by pregnancy. Characterization of tissue expression and cellular localization in virgin, midgestation, and postpartum normal and immune-deficient mice revealed a pattern of gene expression restricted to reproductive tissues and the key organs providing early maternal cardiovascular adaption to pregnancy. Pregnancy-induced and reproductive tissue-associated A2Ms are known in humans (PZP) and rats (RPZP or DAP; [6, 10, 11]), but their sites of synthesis are not thoroughly characterized. No PZP-like molecule has been reported previously in mice nor has an A2M without hepatic expression. Ovary, testes, heart, and kidney showed constitutive expression of A2mp, while significant uterine, conceptus, and mammary expression was gestation induced.

A2mp is induced in decidua and moves with the wave of decidualization from antimesometrium to mesometrium, a pattern of expression similar to RPZP [11]. As suggested by Gu and colleagues [16] for rat decidual A2m, A2mp appears concentrated at the leading edge of remodeling tissue and at interfaces with extensive angiogenesis. Here, roles of A2MP could be maintenance of undifferentiated decidual stem or progenitor cells, release of such cells into active differentiation or regulation of factors involved in vascular change. Of special significance may be A2M's affinity for fibroblast growth factor (FGF)-4 [29] because FGF-4 is essential for maintenance of trophoblast stem cells [30]. A2mp is expressed by cells perivascular to spiral arteries and may contribute to mobilization of vascular smooth muscle cells during vessel elongation [31]. In rats and humans, spiral artery-associated A2M is endothelial [11, 13], suggesting that different family members provide related but distinct microdomain regulation due both to position and to differences in bait region function. A2mp transcription was localized to similar sites in alymphoid and normal mice, at each gestation day studied, but was much weaker in the alymphoid animals. These mutants have only 1/10 of normal levels of mesometrial decidual IFN{gamma} [19]. Thus, lymphocyte-derived IFN{gamma} provides important regulation of A2mp transcription but neither initiates nor terminates it.

Because purified mouse A2MP protein is unavailable, isolated huA2M was used to assess possible actions of A2M family members on the unmodified spiral arteries of pregnant alymphoid mice. Modification was induced by activated as well as by native huA2M, strongly indicating that mechanisms involved cytokine binding rather than proteinase inhibition, the function destroyed during A2M activation [5, 32]. A2MP may have greater potency than A2M in spiral artery modification because spiral arteries modify in females of genotype MAMo/o/Mug1o/o [24] and A2mp is expressed in these gene-ablated mice at locations similar to those in normal mice (Fig. 5). These results, plus the spiral arterial responses of pregnant Ifngo/o mice to native huA2M, are consistent with the hypothesis that A2mp is a key gene regulated by uNK cell-derived IFN{gamma} during spiral artery destabilization. Because activated A2M is rapidly cleared from circulation, high levels of synthesis of both A2MP and its binding partners are predicted within implantation sites.

In other tissues, A2mp's localization is complementary to that of A2Ms of other species. A2Ms in seminal plasma, epididymis, and seminiferous tubules are thought to limit damage from degenerating spermatozoa. In humans, Sertoli cells are the major source of testicular A2M, LRP is expressed by Leydig cells. In rats, Sertoli cells and elongating spermatids show immunoreactive A2M, spermatogonia and spermatocytes do not [33–35]. Mouse testicular cells expressing A2mp were not elongating spermatids but had positions and shapes of spermatogonia and Sertoli cells (Fig. 4).

Ovarian A2M (rat and human) regulates activin and inhibin [36] and is increased in preovulatory follicles and follicular fluids of women responding to controlled ovarian hyperstimulation [37]. Changes in A2M levels are associated with gains in vascular permeability and prolactin-regulated production from granulosa and luteal cells [38–42]. A2mp expression localizes to granulosa and cumulus cells of secondary follicles but not to corpora lutea, suggesting a more time-restricted role for A2MP than for rat A2M. In mice, Mug transcripts have not been previously reported in ovary or testes. Bovine, human, and porcine milks contain complexed A2Ms, with highest levels during the first lactation event [43]. A2M and LRP expression is by myoepithelial and ductal mammary epithelial cells [44] while A2mp is expressed by alveolar and ductal epithelia.

Cardiovascular adaptations are the earliest physiological changes during pregnancy in nonreproductive organs (by Week 2 of human gestation). Increased cardiac output and altered heart structure accompany decreased renal vascular resistance and increased glomerular filtration rates to give the increases in blood volume and body tonicity characteristic of pregnancy [45, 46]. Heart showed constitutive coexpression of A2mp and A2m but no Mug expression. A2mp was expressed by vascular tissue but not myocytes, the cells that express A2M in rats [47]. A2M, by binding TGFß1, FGF-1, -2, -4, -6, and VEGF, promotes endothelial cell growth [29, 37, 48, 49]. Kidney constitutively transcribed A2m and A2mp and parous females also transcribed Mug1 and -2. The precise timing of onset of Mug1 and -2 transcription has not been defined and may be late gestation (i.e., after our midgestational d10 study time point), peri-, or postpartum. Renal Mug transcription might result from aging, as increased PZP concentrations are reported in sera from both older men and women [8]. However, transcription of Mug was not found in older male mice (>244 days), suggesting that gestation induces Mug1 and -2 transcription that is sustained postpartum. This apparently permanent change in gene usage in the postpartum kidney is a novel observation and may provide a link to the clinical finding that risk for preeclampsia is reduced by a first pregnancy. While complex mechanisms regulate body-fluid dynamics, localization of A2mp expression to the renal collecting tubules and to some cells within the glomerular tufts and capsule is consistent with proximal convoluted tubule and ascending nephron loops, solute resorption function, and secondary feedback relationship with the glomerulus to increase glomerular filtration rates [46]. Interestingly, salusins, recently described as hemodynamically active peptides, have a very similar renal distribution to A2mp [50].

Induction and progressive elevation of circulating A2MP from decidua and conceptuses may be key regulatory components for maternal gestational cardiovascular adaptation and have clinical importance. Circulating, uterine-derived A2MP could augment the roles of A2MP produced by heart and kidney that may include antagonizing A2M's functions in these tissues. Circulating A2MP may also act as a rheostat or osmostat to coordinate systemic vascular changes with vascular changes occurring within implantation sites. Decline of the signal from midgestation suggests not only that gd8–10 are the critical times for A2mp gene function but also that other mechanisms are involved in responding to near-term fetal vascular demands that support growth and that these late demands are placed onto a fully modified vascular system. Several PZP binding partners have been associated with preeclampsia, a dangerous but common placental and vascular complication of human pregnancy. VEGF, PDGF, TGFß1, and lipoprotein A have all been documented as having concentration-dependent preeclampsia risk association [51–56]. Our findings suggest that greater definition of sources and functions of circulating PZP will be essential for full understanding of normal and disordered physiology during human pregnancy.


   ACKNOWLEDGMENTS
 
We thank the staff of the OMAFRA Isolation Unit for their dedicated care of our immune-deficient mice, Drs. J. LaMarre and R. Pijnenborg for helpful discussions, and Ms. M.E. Junkins for assistance in preparation of figures.


   FOOTNOTES
 
1 Supported by awards from the Natural Science and Engineering Council, Canada, the Ontario Ministry of Agriculture, Food and Rural Affairs, and Fonds voor Wetenschappelijk Onderzoek-Vlaanderen (FWO-Vlaanderen). Back

2 Correspondence: B. Anne Croy, Department of Anatomy and Cell Biology, Queen's University, Kingston, ON, Canada K7L 3N6. FAX: 613 533 2566; croya{at}post.queensu.ca Back

Received: 17 March 2004.

First decision: 13 April 2004.

Accepted: 27 August 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gonias SL. {alpha}2-macroglobulin: a protein at the interface of fibrinolysis and cellular growth regulation. Exp Hematol 1992 20:302-311[Medline]
  2. Lorent K, Overbergh L, Delabie J, Van Leuven F, Van den Berghe H. Distribution of mRNA coding for alpha-2-macroglobulin, the murinoglobulins, the alpha-2-macroglobulin receptor and the alpha-2-macroglobulin receptor associated protein during mouse embryogenesis and in adult tissues. Differentiation 1994 55:213-223[CrossRef][Medline]
  3. Umans L, Serneels L, Overbergh L, Lorent K, Van Leuven F, Van den Berghe H. Targeted inactivation of the mouse a2-macroglobulin gene. J Biol Chem 1995 270:19778-19785[Abstract/Free Full Text]
  4. Sottrup-Jensen L, Sand O, Kristensen L, Fey GH. The alpha-macroglobulin bait region. Sequence diversity and localization of cleavage sites for proteinases in five mammalian alpha-macroglobulins. J Biol Chem 1989 264:15781-15789[Abstract/Free Full Text]
  5. LaMarre J, Wollenberg GK, Gonias SL, Hayes MA. Cytokine binding and clearance properties of proteinase-activated alpha 2-macroglobulins. Lab Invest 1991 65:3-14[Medline]
  6. Sand O, Folkersen J, Westergaard JG, Sottrup-Jensen L. Characterization of human pregnancy zone protein. Comparison with human alpha 2-macroglobulin. J Biol Chem 1985 260:15723-15735[Abstract/Free Full Text]
  7. Devriendt K, Vanden Berghe H, Cassiman JJ, Marynen P. Primary structure of pregnancy zone protein. Molecular cloning of a full-length PZP cDNA clone by the polymerase chain reaction. Biochim Biophys Acta 1991 1088:95-103[Medline]
  8. Folkersen J, Teisner B, Grunnet N, Grudzinskas JG, Westergaard JG, Hindersson P. Circulating levels of pregnancy zone protein: normal range and the influence of age and gender. Clin Chim Acta 1981 110:139-145[CrossRef][Medline]
  9. Ekelund L, Laurell CB. The pregnancy zone protein response during gestation: a metabolic challenge. Scand J Clin Lab Invest 1994 54:623-629[Medline]
  10. Hayashida K, Tsuchiya Y, Kurokawa S, Hattori M, Ishibashi H, Okubo H, Sakaki Y. Expression of rat alpha 2-macroglobulin gene during pregnancy. J Biochem (Tokyo) 1986 100:989-993[Abstract/Free Full Text]
  11. da Silva GC, Teixeira N, Pringle JH, Bell SC. Expression of mRNA encoding decidualization-associated protein, a variant of acute-phase alpha 2 macroglobulin, by rat uterine tissues during pregnancy and pseudopregnancy. J Reprod Fertil 1996 108:289-298
  12. Overbergh L, Hilliker C, Lorent K, Van Leuven F, Van den Berghe H. Identification of four genes coding for isoforms of murinoglobulin, the monomeric mouse alpha 2-macroglobulin: characterization of the exons coding for the bait region. Genomics 1994 22:530-539[CrossRef][Medline]
  13. Sayegh RA, Tao XJ, Isaacson KB. Immunohistochemical localization of alpha-2 macroglobulin receptor/low-density lipoprotein receptor-related protein, receptor-associated protein, and Gp330 in the human endometrium. J Soc Gynecol Invest 1995 2:748-753[CrossRef][Medline]
  14. Lin TM, Halbert SP. Placental localization of human pregnancy-associated plasma proteins. Science 1976 193:1249-1252[Abstract/Free Full Text]
  15. Tan J, Paria BC, Dey SK, Das SK. Differential uterine expression of estrogen and progesterone receptors correlates with uterine preparation for implantation and decidualization in the mouse. Endocrinology 1999 140:5310-5321[Abstract/Free Full Text]
  16. Gu Y, Jayatilak PG, Parmer TG, Gauldie J, Fey GH, Gibori G. Alpha 2-macroglobulin expression in the mesometrial decidua and its regulation by decidual luteotropin and prolactin. Endocrinology 1992 13:1321-1328
  17. Peel S. Granulated metrial gland cells. Adv Anat Embryol Cell Biol 1989 115:1-112[Medline]
  18. Ashkar AA, Di Santo JP, Croy BA. Interferon gamma contributes to initiation of uterine vascular modification, decidual integrity, and uterine natural killer cell maturation during normal murine pregnancy. J Exp Med 2000 192:259-270[Abstract/Free Full Text]
  19. Ashkar AA, Croy BA. Interferon-gamma contributes to the normalcy of murine pregnancy. Biol Reprod 1999 61:493-502[Abstract/Free Full Text]
  20. Colucci F, Soudais C, Rosmaraki E, Vanes L, Tybulewicz VL, Di Santo JP. Dissecting NK cell development using a novel alymphoid mouse model: investigating the role of the c-abl proto-oncogene in murine NK cell differentiation. J Immunol 1999 162:2761-2765[Abstract/Free Full Text]
  21. Umans L, Serneels L, Overbergh L, Stas L, Van Leuven F. Alpha2-macroglobulin- and murinoglobulin-1-deficient mice. A mouse model for acute pancreatitis. Am J Pathol 1999 155:983-993[Abstract/Free Full Text]
  22. Guimond MJ, Wang B, Croy BA. Engraftment of bone marrow from severe combined immunodeficient (SCID) mice reverses the reproductive deficits in natural killer cell-deficient tg epsilon 26 mice. J Exp Med 1998 187:217-223[Abstract/Free Full Text]
  23. Borzychowski AM, Chantakru S, Minhas K, Paffaro VA, Yamada AT, He H, Korach KS, Croy BA. Functional analysis of murine uterine natural killer cells genetically devoid of oestrogen receptors. Placenta 2003 24:403-411[CrossRef][Medline]
  24. Esadeg S, He H, Pijnenborg R, van Leuven F, Croy BA. Alpha-2 macroglobulin controls trophoblast positioning in mouse implantation sites. Placenta 2003 24:912-921[CrossRef][Medline]
  25. Paffaro VA, Bizinotto MC, Joazeiro PP, Yamada AT. Subset classification of mouse uterine natural killer cells by DBA lectin reactivity. Placenta 2003 24:479-488[CrossRef][Medline]
  26. Sambrock J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989
  27. Gonias SL, Balber AE, Hubbard WJ, Pizzo SV. Ligand binding, conformational change and plasma elimination of human, mouse and rat alpha-macroglobulin proteinase inhibitors. Biochem J 1983 209:99-105[Medline]
  28. Van Leuven F, Torrekens S, Overbergh L, Lorent K, De Strooper B, Van den Berghe H. The primary sequence and the subunit structure of mouse A2M deduced from protein sequence of the isolated subunits and from molecular cloning. Eur J Biochem 1992 210:319-327[Medline]
  29. Asplin IR, Wu SM, Mathew S, Bhattacharjee G, Pizzo SV. Differential regulation of the fibroblast growth factor (FGF) family by alpha (2)-macroglobulin: evidence for selective modulation of FGF-2-induced angiogenesis. Blood 2001 97:3450-3457[Abstract/Free Full Text]
  30. Tanaka S, Kunath T, Hadjantonakis AK, Nagy A, Rossant J. Promotion of trophoblast stem cell proliferation by FGF4. Science 1998 282:2072-2075[Abstract/Free Full Text]
  31. Cipolla MJ, Binder ND, Osol G. Myoendometrial versus placental uterine arteries: structural, mechanical, and functional differences in late-pregnant rabbits. Am J Obstet Gynecol 1997 177:215-221[CrossRef][Medline]
  32. Webb DJ, Wen J, Lysiak JJ, Umans L, Van Leuven F, Gonias SL. Murine alpha-macroglobulins demonstrate divergent activities as neutralizers of transforming growth factor-beta and as inducers of nitric oxide synthesis. A possible mechanism for the endotoxin insensitivity of the alpha2-macroglobulin gene knock-out mouse. J Biol Chem 1996 271:24982-24988[Abstract/Free Full Text]
  33. Cheng CY, Grima J, Stahler MS, Guglielmotti A, Silvestrini B, Bardin CW. Sertoli cell synthesizes and secretes a proteinase inhibitor, alpha 2-macroglobulin. Biochemistry 1990 29:1063-1068[CrossRef][Medline]
  34. Metayer S, Dacheux F, Dacheux JL, Gatti JL. Comparison, characterization, and identification of proteinases and proteinase inhibitors in epididymal fluids of domestic mammals. Matrix metalloproteinases are major fluid gelatinases. Biol Reprod 2002 66:1219-1229[Abstract/Free Full Text]
  35. Moestrup SK, Gliemann J, Pallesen G. Distribution of the alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein in human tissues. Cell Tissue Res 1992 269:375-382[CrossRef][Medline]
  36. Vaughan JM, Vale WW. Alpha 2-macroglobulin is a binding protein of inhibin and activin. Endocrinology 1993 132:2038-2050[Abstract/Free Full Text]
  37. McElhinney B, Ardill J, Caldwell C, Lloyd F, McClure N. Ovarian hyperstimulation syndrome and assisted reproductive technologies: why some and not others?. Hum Reprod 2002 17:1548-1553[Abstract/Free Full Text]
  38. Curry TE Jr, Mann JS, Estes RS, Jones PB. Alpha 2-macroglobulin and tissue inhibitor of metalloproteinases: collagenase inhibitors in human preovulatory ovaries. Endocrinology 1990 127:63-68[Abstract/Free Full Text]
  39. Zhu C, Woessner JF Jr. A tissue inhibitor of metalloproteinases and alpha-macroglobulins in the ovulating rat ovary: possible regulators of collagen matrix breakdown. Biol Reprod 1991 45:334-342[Abstract]
  40. Gaddy-Kurten D, Hickey GJ, Fey GH, Gauldie J, Richards JS. Hormonal regulation and tissue-specific localization of alpha sub(2)-macroglobulin in rat ovarian follicles and corpora lutea. Endocrinology 1989 125:2985-2995[Abstract/Free Full Text]
  41. Henninghausen L, Robinson GW, Wagner KU, Xiuwen L. Prolactin signaling in mammary gland development. J Biol Chem 1997 272:7567-7569[Free Full Text]
  42. Dajee M, Fey GH, Richards JS. Stat 5b and the orphan nuclear receptors regulate expression of the alpha2-macroglobulin (alpha2M) gene in rat ovarian granulosa cells. Mol Endocrinol 1998 12:1393-1409[Abstract/Free Full Text]
  43. Perez MD, Sanchez L, Aranda P, Sala FJ, Calvo M. Time-course levels of alpha 2-macroglobulin and albumin in cow colostrum and milk and alpha 2-macroglobulin levels in mastitic cow milk. Ann Rech Vet 1989 20:251-258[Medline]
  44. Clavel C, Chavanel G, Birembaut P. Detection of the plasmin system in human mammary pathology using immunofluorescence. Cancer Res 1986 46:5743-5747[Abstract/Free Full Text]
  45. McLaughlin MK, Roberts JM. Hemodynamic changes. In: Lindehimer MD, Roberts JM, Cunningham FG (eds.), Chesley's Hypertensive Disorders in Pregnancy, 2nd ed. Stamford, CT: Appleton and Lang; 1999: 69–102
  46. Durr JA, Lindheimer MD. Control of Volume and Body Tonicity. In: Lindehimer MD, Roberts JM, Cunningham FG (eds.), Chesley's Hypertensive Disorders in Pregnancy, 2nd ed. Stamford, CT: Appleton and Lang; 1999:103–166
  47. Rajan S, Radhakrishnan J, Rajamanickam C. Direct injection and expression in vivo of full-length cDNA of the cardiac isoform of alpha-2 macroglobulin induces cardiac hypertrophy in the rat heart. Basic Res Cardiol 2003 98:39-49[CrossRef][Medline]
  48. Arandjelovic S, Freed TA, Gonias SL. Growth factor-binding sequence in human alpha (2)-macroglobulin targets the receptor-binding site in transforming growth factor-beta. Biochemistry 2003 42:6121-6127[CrossRef][Medline]
  49. Bhattacharjee G, Asplin IR, Wu SM, Gawdi G, Pizzo SV. The conformation-dependent interaction of alpha 2-macroglobulin with vascular endothelial growth factor. A novel mechanism of alpha 2-macroglobulin/growth factor binding. J Biol Chem 2000 275:26806-26811[Abstract/Free Full Text]
  50. Shichiri M, Ishimaru S, Ota T, Nishikawa T, Isogai T, Hirata Y. Salusins: newly identified bioactive peptides with hemodynamic and mitogenic activities. Nat Med 2003 9:1166-1172[CrossRef][Medline]
  51. Teng H, Zhang WY, Zhu FQ. A study on the serum pregnancy zone protein levels in pregnant women and patients with gynecological tumors. Chin Med J 1994 107:910-914[Medline]
  52. Djurovic S, Schjetlein R, Wisloff F, Haugen G, Husby H, Berg K. Plasma concentrations of Lp(a) lipoprotein and TGF-beta1 are altered in preeclampsia. Clin Genet 1997 52:371-376[Medline]
  53. Sacks GP, Studena K, Sargent K, Redman CW. Normal pregnancy and preeclampsia both produce inflammatory changes in peripheral blood leukocytes akin to those of sepsis. Am J Obstet Gynecol 1998 179:80-86[CrossRef][Medline]
  54. Vuorela-Vepsalainen P, Alfthan H, Orpana A, Alitalo K, Stenman UH, Halmesmaki E. Vascular endothelial growth factor is bound in amniotic fluid and maternal serum. Hum Reprod 1999 14:1346-1351[Abstract/Free Full Text]
  55. Bielecki DA, Klonowska-Dziatkiewicz E, Jarocki S, Urban J. Growth factors in pregnancy complications with preeclampsia. Ginekol Pol 2002 73:422-429[Medline]
  56. Taylor RN, Grimwood J, Taylor RS, McMaster MT, Fisher SJ, North RA. Longitudinal serum concentrations of placental growth factor: evidence for abnormal placental angiogenesis in pathologic pregnancies. Am J Obstet Gynecol 2003 188:177-182[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J EndocrinolHome page
T. Takahashi, O. Yamada, M. J Soares, and K. Hashizume
Bovine prolactin-related protein-I is anchored to the extracellular matrix through interactions with type IV collagen
J. Endocrinol., February 1, 2008; 196(2): 225 - 234.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/2/266    most recent
biolreprod.104.029835v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.
Agricola
Right arrow Articles by He, H.
Right arrow Articles by Croy, B. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS