| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Molecular Biology and Pharmacology,3 Washington University School of Medicine, St. Louis, Missouri 63110
Departments of Pathology4
Molecular and Cellular Biology,5 Baylor College of Medicine, Houston, Texas 77030
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
subunit resulted in single-chain analogues that were bioactive in vitro. The ability of such large structures to bind their cognate receptors with high affinity supported the hypothesis that extensive flexibility exists between the ligand and receptor to establish a functional complex. To further characterize the extent of this conformational flexibility, we engineered a single-chain analogue that consists of sequentially linked thyroid-stimulating hormone (TSH) ß, follicle-stimulating hormone (FSH) ß, and chorionic gonadotropin (CG) ß subunits to the subunit and expressed this chimera in transfected CHO (Chinese hamster ovary) cells. Because the four subunits are genetically linked and expressed as a single-chain, this analogue presumably lacks significant native structural features of the individual heterodimers. However, it exhibited FSH, CG, and TSH activities in vitro. Here, we test whether this nonnative structure would be stable in vivo and thus biologically active. Using a variety of bioassay protocols, we demonstrate that the analogue elicits multihormone activities when injected in vivo. First, treatment with the analogue caused increases in ovarian and uterine weights and resulted in elevated serum estradiol. Second, the analogue-stimulated ovarian follicle growth and pharmacologically rescued in vivo FSH deficiency similar to recombinant human FSH or equine CG (eCG) as confirmed by induction of aromatase in the ovaries of FSHß knockout mice. Third, in a superovulation protocol, when primed with eCG, the analogue elicited a dose-dependent ovulatory response comparable with that by native heterodimeric human CG. Finally, the analogue-stimulated thyroxin production in hypothyroid mice similar to the pituitary-derived human TSH standard. Based on these data, we conclude that a single-chain tetradomain glycoprotein hormone analogue, despite its presumed altered conformation, is stable and biologically active in vivo. Our results establish the permissiveness and conformational plasticity with which the glycoprotein hormones are recognized in vivo by their target cell receptors.
aromatase, follicle-stimulating hormone, hypothyroid, luteinizing hormone, ovulation, pituitary, single chain, thyroid-stimulating hormone
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
subunit that is noncovalently associated with a hormone-specific ß subunit [1, 2]. Heterodimeric subunit assembly is critical for hormone-specific glycosylation, efficient secretion, and hence the biological activity of these hormones [3]. Site-directed mutagenesis studies have defined the roles of various amino acids and oligosaccharides associated with subunit assembly and secretion [4–6]. However, this approach precluded detailed structure-function analyses due to mutagenesis-induced defects in subunit assembly [3, 7]. To bypass the subunit-assembly step, the and ß subunits were genetically fused, resulting in novel single-chain glycoprotein analogs [8–11]. Earlier studies demonstrated successful generation of an analogue in which one chain was fused in tandem with one or more ß subunits [8–11]. Based on these studies, dually active novel single-chain analogs comprised of two different ß subunits and a single subunit were expressed from transfected Chinese hamster ovary (CHO) cells [8–11].
More recent studies using the single-chain model employed genetic fusion of the common subunit in tandem with TSHß, FSHß, and CGß subunits [11]. Because the subunit presumably cannot heterodimerize with three ß subunits simultaneously and the analogue presumably lacks much of the structure generated by individual subunit contact sites, this chimera represents an excellent candidate for testing whether hormone signaling was dependent on the determinants generated by /ß heterodimeric contacts. Despite the structural complexity of this analogue, it was secreted from CHO cells and it bound to cognate receptors and stimulated cAMP production in vitro [11]. These data supported the hypothesis that there is extensive flexibility in the receptor that recognizes and establishes a functional complex with a larger multidomain ligand in vitro. However, it is unknown if this analogue is stable in vivo and elicits the biological responses corresponding to the individual heterodimers, i.e., LH, FSH, and TSH. If, for example, glycosylation patterns are altered significantly compared with the heterodimeric hormones, the analogue will be unstable in vivo, which would be reflected in a decreased circulatory half-life and the inability of the analogue to elicit maximal biological responses in vivo.
Here, we examined the in vivo biological activity of the tetradomain analogue. We employed superovulation protocols using immature female FSHß knockout mice and a hypothyroid mouse model to determine, respectively, the LH/FSH and TSH in vivo bioactivities of the analogue. Our data demonstrate that this analogue elicits FSH, LH, and TSH bioactivities in vivo comparable with the native heterodimers. These results imply a remarkable permissiveness and conformational flexibility with which the glycoprotein hormones are recognized in vivo by their target cell receptors.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Tissue culture media, G-418, Trizol, and reverse transcription (RT)-PCR reagents were all purchased from Invitrogen (Carlsbad, CA). Centricon preparative concentrator was purchased form Amicon Inc. (Beverley, MA). Ultrafree centrifugal filter devices were purchased from Millipore, Inc. (Bredford, MA). Agarose and ethidium bromide were obtained from Shelton Scientific (Shelton, CT). 3,3,'5-Triiodo-L-thyronine, hyaluronidase from bovine testes (type IV-S), and M-2 medium were obtained from Sigma Chemicals (St. Louis, MO). Equine chorionic gonadotropin (eCG) (200 IU/ml) and hCG (1000 IU/ml) were obtained from St. Lukes Hospital (Houston, TX). Human TSH standard (I-8; 8 IU/mg) was purchased from Hormone Distribution Program (Los Angeles, CA). Recombinant hFSH (6.5 IU/mg) was provided by Organon (Oss, The Netherlands). Radioimmunoassay (RIA) kits for hCG and hFSH were purchased from Diagnostic Products (Los Angeles, CA). Total T4 and ultrasensitive third-generation estradiol RIA kits were purchased from Diagnostic Systems Laboratories, Inc. (Webster, TX). Microtainer serum separator tubes were obtained from Beckton Dickinson (Franklin Lakes, NJ). Oligonucleotide primers were ordered from SeqWright (Houston, TX). All other analytical-grade chemicals were DNase, RNase, and protease-free and purchased from EM Science (Gibbstown, NJ).
Mice
All the mice used were on C57/129 hybrid genetic background. FSHß knockout mice were described earlier [12]. The wild-type and mutant FSHß alleles were identified by Southern blot or genomic PCR analysis of tail DNA as described [12, 13]. For superovulation experiments, immature female mice at 21–23 days were used. Mice were supplied with food and water ad libitum and maintained on a 12L:12D cycle. All the protocols were approved by Baylor College of Medicine Animal Care Committee as per National Institutes of Health (NIH) guidelines.
Construction and Expression of hTSHß, hFSHß, hCGß, hCG Tetradomain Glycoprotein Hormone Analogue In Vitro
The single-chain tetradomain analogue comprising the hTSHß, hFSHß, hCGß, and hCG subunits was constructed using an overlapping PCR strategy as described previously [11]. The construct was designed to contain carboxy terminal peptide (CTP) of CGß subunit as a linker in between the ß subunits (Fig. 1). The final single-chain PCR product was sequenced to ensure that no errors occurred during PCR amplification. Stable CHO cell lines expressing the analogue were G418 selected as previously described [11]. Stable cell lines expressing the hFSHß subunit were characterized as described earlier [14]. Collection media were concentrated using either a Centricon preparative concentrator or an ultrafree centrifuge filter device (Millipore Corp., Bedford, MA) and frozen in aliquots at –80°C until further use.
|
Radioimmunoassays
The immunoreactivity of the analogue corresponding to each of the hormones was estimated by individual heterodimer-specific RIAs (FSH and hCG), as described [11]. TSH was measured using an Advia Centaur automated immunoassay system (Bayer Diagnostics, Tarry Town, NY) with third generation assay reagents at The Methodist Hospital (Houston, TX). Each of the above assays is hormone specific with minimal cross-reactivity (<0.1%) to the other glycoprotein hormones. The immunoreactivity of the analogue was as follows: CG (463 IU/ml), FSH (47 IU/ml), and TSH (80 IU/ ml). For testing each of the hormone bioactivities in vivo, the IU equivalents of the analogue, based on a potency comparison of the appropriate heterodimer standards, were injected into mice.
FSH Bioassay
Immature female mice at 21–23 days were injected with either 100 µl of saline, eCG (7.5 IU per mouse, i.p.) or two different doses of the analogue (5 IU and 2.5 IU equivalent of FSH immunoreactivity), 46 h later, all groups of mice were injected with hCG (5 IU per mouse, i.p.) and mated overnight with wild-type males (two females per one male). The cumulus masses from oviducts were collected into hyaluronidase prepared in M-2 medium and the number of ova counted as described [12, 15]. The FSH bioassay experiment was performed twice. Ovaries and uteri were isolated, weighed, and fixed in buffered formalin (pH 7.2) at room temperature for at least 12 h and processed for histology as described earlier [12, 16].
Ovarian Aromatase mRNA Expression by a Semiquantitative RT-PCR Assay
Wild-type and immature female FSHß knockout mice were injected with saline, control medium, eCG (5 IU), recombinant hFSH (2.5 or 5 IU per mouse; i.p.), or the analogue (1.25 IU, 2.5 IU, 5.0 IU equivalents per mouse; i.p.), and 48 h later, ovaries were collected, weighed, and immediately homogenized in Trizol reagent to isolate total RNA. One microgram of total RNA was reverse transcribed (RT) and the cDNAs were used in separate PCR reactions using primers specific for aromatase and cyclophilin A and the linear range of amplifications were standardized. Subsequently, semiquantitative RT-PCR reactions were carried out using the cDNA samples. The amplified products were separated on a 1.5% agarose gel and visualized by ethidium bromide staining using negative contrast imaging. The following primers were used based on the GenBank sequences. Aromatase (610 base pairs [bp]): sense: 5' AAGATGTTCTTGG AAAT GCTGAA 3'; antisense: 5' AGGAAGAGCATGTTAGA GGTGT 3'. Cyclophilin A (550 bp): sense: 5' CGTC TCCTTCGAGCTGTTTGCAGAC 3'; antisense: 5' AATGAGGAAAATATG GAA CCCAAA 3'. The PCR conditions were 30 cycles of 94°C (30 min), 60°C (30 min), 72°C (60 min) for aromatase, and 23 cycles of 94°C (30 min), 58°C (30 min), 72°C (60 min) for cyclophilin A. Primers for amplifying cycloxygenase-2 (Cox2) and LH-receptor (Lhr) and the PCR conditions were described earlier [17, 18]. Serum samples were assayed for estradiol using an ultrasensitive third-generation RIA kit as described earlier [19].
Human CG Bioassay
The bioassay protocol for testing hCG activity was similar to that for FSH bioassay using the standard superovulation protocol. Immature female mice at 21–23 days were injected with either 100 µl of saline or eCG (5 IU per mouse, i.p.), and 46 h later, both groups of mice were injected with hCG (5 IU per mouse, i.p.) or the analogue (5 IU and 2.5 IU equivalent of hCG immunoreactivity, i.p.) and mated overnight with wild-type males (two females per one male). The cumulus masses from oviducts were collected into hyaluronidase prepared in M-2 medium and the number of ova counted as described [12]. The hCG bioassay experiment was performed three times.
TSH Bioassay
Male mice at 4–8 wk were used for TSH bioassay as described [20]. To create hypothyroid conditions, mice were supplied with T3 at a final concentration of 3µg/ml in drinking water. The treatment continued for 10 days, with fresh T3 containing water replenished once in every 2 days. Untreated saline-injected mice served as euthyroid controls. On Day 10, mice were injected with either saline or an NIH I-8 standard hTSH (25 IU, i.p.) or different doses of the analogue (2.5 µl and 1 µl, corresponding to 4 IU or 1.5 IU; i.p.) in a final volume of 100 µl with phosphate-buffered saline, pH 7.2, containing 2% BSA. Six hours later, mice were anesthetized by isofluorane and blood was collected by closed cardiac puncture and allowed to clot at room temperature. Serum was later obtained using Microtainer serum separator tubes and stored frozen at –20°C until used. The total T4 content in serum was later estimated by a solid-phase radioimmunoassay kit. This bioassay experiment was performed twice.
Histological Procedures
Ovaries and uterine horns were surgically removed from various groups of mice, weighed, and used for histological analyses. To analyze the histology, ovaries in different experiments were collected into buffered formalin, fixed overnight at room temperature. and paraffin embedded. Five-micrometer sections were cut and stained by hematoxylin/periodic acid-Schiff reagent and observed under a Zeiss microscope [12]. The images were digitally captured and analyzed using the Adobe Photoshop software.
Western Blot Analysis
Aliquots of serum samples containing the analogue were separated on 8% SDS polyacrylamide gels under nonreducing conditions and transferred to nylon membranes. The blots were probed with a polyclonal subunit antiserum and visualized with a Tropix chemiluminiscent detection system (Tropix, Bedford, MA) as described [11].
Statistical Analysis
All the data were analyzed by one-way ANOVA or Student t-test using a Microsoft Excel software program. A P value of <0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
To test whether the analogue elicits biological response in vivo, immature wild-type female mice were injected with the analogue (5 IU hFSH equivalent) or saline or medium obtained from hFSHß-transfected CHO cells (control medium, unassembled ß subunits are biologically inactive). The ovarian and uterine weights of the analogue-injected mice were significantly increased after 48 h compared with those treated with either saline or control medium (Fig. 2, A and B). Most importantly, the analogue induced the expression of various ovarian markers, including aromatase, cox-2, and LH receptor when compared with that of saline or control medium treatment (Fig. 2C). Finally, serum estradiol levels were also significantly elevated in analogue-treated mice compared with the controls (Fig. 2D). These results confirm that the analogue shows FSH- and/or LH-like bioactivities in vivo. Because hFSHß is biologically inactive and the CHO cell medium containing this subunit, similar to saline controls, did not elicit any bioactivity (Fig. 2, A–D), these data indicate that the observed responses are not due to any substances in the culture medium per se, but represent true biological activities of the analogue.
|
FSH Bioactivity: Pharmacological Rescue of FSHß Knockout Female Mice
FSH is essential for early follicle growth and is required for priming the follicles before hCG induction of ovulation in immature female mice [12]. To determine whether the analogue exhibits FSH activity, immature female mice were treated with the analogue and, 48 h later, the ovaries were examined histologically (Fig. 3). In contrast with the ovaries from saline-injected control mice (Fig. 3A), the analogue-primed ovary showed full growth of the follicles, including many antral follicles, confirming the presence of an FSH activity (Fig. 3, C and D). These ovaries were histologically identical to those treated with a similar dose of eCG (Fig. 3B). Although there is some thecal stimulation noted by 48 h in the analogue-treated ovaries, after 24 h of analogue stimulation, they appeared identical to that seen by eCG treatment (data not shown). There were no corpora lutea present in the ovaries of analogue-treated mice, indicating absence of full premature luteinization and, following an hCG injection, ova were recovered after 72 h (see Table 1). Additionally, the analogue-primed immature mice, similar to those primed by eCG, superovulated when injected with hCG and produced comparable numbers of ova (Table 1). Thus, these data suggest the analogue exhibits FSH activity in vivo using this protocol.
|
|
To further assess the FSH bioactivity, FSHß gene knockout female mice were used in a pharmacological rescue paradigm. These mutant female mice do not contain any circulating FSH and demonstrate a folliculogenesis block in the ovary at the secondary stage but retain full FSH responsiveness [12, 16]. Aromatase, an FSH downstream marker gene in the ovary, is completely suppressed in the absence of FSH in these mutant mice [21]. Similar to the response seen in wild-type mice (Fig. 2), injection of the analogue increased ovarian and uterine weights and serum estradiol production (Fig. 4, A, B, and D). Data from the semiquantitative RT-PCR assay indicated that, in contrast with mice treated with control medium (Fig. 4C), saline, or hCG (5 IU or 25 IU), a single injection of the analogue pharmacologically rescued FSH deficiency and induced ovarian aromatase gene expression after 48 h (Fig. 5). The extent of induction was the same as that obtained by a single injection of recombinant FSH at the equivalent dose (Fig. 5). A combination of hCG (25 IU) and rhFSH (2.5 IU) also induced aromatase expression similar to 2.5 IU (FSH equivalent dose) of the analogue (Fig. 5). There was no amplified product visible in the negative control (no cDNA), whereas the product was amplified in the testis cDNA, a positive control (Fig. 5). Together, the above data confirm that the analogue contains FSH bioactivity and efficiently induces ovarian aromatase gene expression in the absence of endogenous mouse FSH.
|
|
Human CG Bioactivity: Superovulation of Immature Female Mice
Standard superovulation regimen includes priming of immature female mice by eCG that supports ovarian follicle growth followed by an ovulatory dose of hCG (LH activity) that results in release of multiple ova into the oviducts [15, 22, 23]. To test whether the analogue elicits an hCG/LH-like activity, eCG-primed immature female mice were injected with either hCG or different doses of the analogue, and the number of ova in the oviduct was counted the next day. In this superovulation assay, the analogue elicited an hCG/LH-like activity and induced multiple ovulations similar to that by the native hCG dimer. Furthermore, the analogue elicited a dose-dependent response, i.e., the lowest dose tested (2.5 IU) induced production of approximately 50% less fertilized ova than those elicited by the highest dose tested (5 IU; Table 2). These results indicate that the analogue elicits a dose-dependent LH response in vivo comparable with that elicited by native hCG dimer.
|
TSH Bioactivity: Stimulation of Thyroxine Production in Hypothyroid Mice
TSH production from the pituitary thyrotropes is dependent on hypothalamic thyrotropin-releasing hormone (TRF). In response to TSH stimulation, the thyroid produces thyroid hormones, tri-iodo thyronine (T3) and thyroxine (T4) [24–27]. T3 is a potent suppressor of TRF release from the hypothalamus, and high levels of T3 can cause hypothyroidism [24–27]. Exogenous TSH causes stimulation of T4 in a hypothyroid mouse, and this principle is used for quantifying the TSH activity of many preparations. Because it is difficult to measure TSH response in euthyroid mice, to evaluate the effects of the analogue on T4 production, we created hypothyroid mice by supplementing them with T3 in drinking water [20]. This treatment, when continued for 10 days, resulted in a suppression of total T4 in the serum compared with the untreated euthyroid controls in which total T4 levels in serum remained high (Fig. 6). Both an NIH standard of hTSH and the analogue stimulated serum total T4 to levels significantly higher than those in saline-injected hypothyroid controls. Interestingly, greater stimulation was observed with lower doses of the analogue (Fig. 6, see Discussion below). These data show that the analogue elicits TSH bioactivity in vivo and stimulates the production of T4 in a hypothyroid mouse model comparable with native hTSH heterodimer.
|
Incubation of the Analogue with Mouse Serum
To elicit multiple hormone activities, the analogue must be stable in vivo. Because the analogue is a tetradomain protein with three different ß subunits linked in tandem with the subunit, when injected into mice, it may get degraded in vivo, resulting in release of multiple biologically active fragments with proper conformations. To address this point, normal mouse serum was incubated with the analogue at doses used to test each of its biological activities. Following incubation, aliquots of the mixture at different times were analyzed by Western blots using a polyclonal antiserum against the subunit. Chemiluminiscence detection assay indicated that the analogue remained intact (97.4 kDa, indicated by an arrow) after 48 h of incubation with serum (Fig. 7, lanes 2 and 4). This band is similar to that seen in the lane (lane 1) that contained the concentrated medium (containing the analogue) used as a standard. As expected, no signals were observed when mixtures contained only mouse serum (lanes 3 and 4). Furthermore, there were no lower size fragments detected on the blot. Thus, the analogue is stable and apparently not cleaved into multiple functional fragments that are immunoactive with the subunit antiserum (Fig. 7).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
subunits was shown to productively interact in vitro with receptors specific to each of the heterodimeric hormones [11]. However, it was not known whether these analogs, presumably lacking a conformation of the heterodimeric -ß contacts present in native heterodimers, are stable and are capable of eliciting a biological response in vivo. This issue is critical because, given the large size of the tetradomain analogue and presumed changes in conformation relative to an individual heterodimer, it would be difficult to predict its fate in vivo. Our data demonstrate that this single-chain analogue elicits three distinct hormone activities when tested in vivo using bioassays specific to FSH, LH, and TSH. Although the analogue appears equipotent compared with individual heterodimers, we cannot make a definitive conclusion because the quantitation was based on RIAs; purified analogue will be required to determine the precise quantitative dose-response relationship. The in vivo data suggest that the large extracellular ligand-binding domain in the glycoprotein hormone receptor is highly flexible and can be activated in vivo by large multidomain ligands. One possibility for the multihormone activities of the analogue could be that distinct peptide fragments capable of activating each of the receptors were generated due to random proteolytic cleavage in vivo. However, this is unlikely, because prolonged incubation of (up to 48 h) the analogue with normal mouse serum did not result in detection of smaller immunoreactive fragments. Moreover, because the subunits are tandemly linked (with TSHß at the N-terminus and at the C-terminus), random cleavage of the analogue will not result in fragments containing both -ß subunit contact sites corresponding to three distinct heterodimers. Our earlier results also confirm that an intact analogue is secreted into the CHO cell medium [11], and hence the medium that was injected into mice (in all the experiments described in this study) contained only the intact analogue but not smaller functional fragments. Previously, we have genetically and pharmacologically rescued FSHß knockout mice [16]. Here, we tested the FSH bioactivity of the analogue in these mice because they lack an endogenous FSH. A single injection of the analogue promoted follicle growth and quantitatively induced the expression of aromatase, an FSH-sensitive marker in the ovaries of FSHß knockout mice. During folliculogenesis, FSH induction of the aromatase expression is necessary for estrogen production and is critical for subsequent morphological and developmental changes of the follicles [21]. Consistent with this, the analogue induced estradiol production both in wild-type and FSHß knockout mice compared with saline or control medium. Hence, the analogue-induced morphological changes are well correlated with the functional activation of the gene expression in the FSHß mutant ovarian follicles.
In routine superovulation protocols, eCG (FSH activity) drives the follicles to maturity until a bolus of hCG given at least 2 days later induces ovulation. In this protocol, the follicles are not exposed to both FSH and LH at the same time. Developmentally synchronized activation of first FSH and subsequently LH receptors is essential for normal ovulation and luteinization [15, 22]. Despite an intrinsic LH activity of the analogue, the analogue unexpectedly promoted full growth of the follicles, caused ovulations upon further hCG stimulation, and efficiently rescued the FSH deficiency. Similarly, when primed by eCG, the analogue caused superovulation similar to a standard hCG response without premature luteinization. This is a unique response because any asynchronous stimulation by FSH and LH often results in premature luteinization [28–31]. It suggests that, although both FSH and LH activities are present in the analogue, the follicles did not acquire LH responsiveness until they are appropriately primed by the FSH activity of the analogue. This raises a fundamental question as to why, in normal female reproductive physiology, two temporally orchestrated gonadotropin activities are required for optimal follicle development and ovulation. One way to further examine the gonadotropin bioactivity of the analogue would be to test whether a single injection of the tetradomain or triple domain analogue (that contains both LH and FSH activities) alone, without prior priming by eCG, elicits a typical LH-like ovulation induction response.
It is unknown why only a low dose of the analogue relative to the NIH standard of hTSH was effective to stimulate T4 induction in hypothyroid mice. One possibility is that the TSH-like epitopes generated by -TSHß contacts in the analogue are highly efficient in recognizing and activating the TSH receptors on the thyroid in vivo. This is consistent with the high affinity binding of the analogue to TSH receptors compared with that of native TSH heterodimer in vitro [11]. Future epitope mapping and structural and biophysical studies should clarify this discrepancy. The presence of both gonadotropin and thyrotropin activities in a single protein is reminiscent of an evolutionarily ancestral protein in some of the early vertebrates that elicits FSH, LH, and TSH responses [11]. As the species have evolved, these activities subsequently must have become distinct and are encoded as three specific heterodimers in higher mammals. These observations are consistent with the general principles of physiology that normal reproductive function is dependent on optimal thyroid status.
The presence of multiple hormone activities in a single tetradomain analogue raises interesting possibilities for the pleiotropic responses it exerts in vivo through activation of distinct receptors on the gonads and the thyroid. The analogue must have at least some native -ß contacts to elicit immunological and biological activities corresponding to individual heterodimers. Whether the plasticity is specified by structural randomness of the analogue or by coexistence of distinct populations of molecules with heterodimeric contact sites remains to be determined. Conformationally less constrained single-chain -ß hCG and -ß hFSH may have a more distinct quaternary structure than the corresponding native heterodimers but demonstrate similar immunologic and biological activities compared with heterodimers [9, 32–34]. In any case, it is evident that the large tetradomain analogue is capable of interacting with each receptor to generate the appropriate biological response. Therefore, it does seem reasonable to conclude that the receptor does possess a significant amount of flexibility to accommodate such a large ligand.
In summary, our data show that a single-chain tetradomain analogue elicits three distinct, i.e., FSH, LH, and TSH, bioactivities in vivo. These studies further emphasize the conformational plasticity with which glycoprotein hormones are recognized by their target cell receptors. Our studies may have implications for further understanding and treatment of clinical and veterinary cases of thyroid dysfunction that are often associated with impaired fertility.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
2 Correspondence and current address: T. Rajendra Kumar, Department Molecular and Integrative Physiology, University of Kansas Medical Center, 3011 WHE, Mailstop 3043, 3901 Rainbow Blvd., Kansas City, KS 66160. FAX: 913 588 0455; tkumar{at}kumc.edu
Received: 7 May 2004.
First decision: 2 June 2004.
Accepted: 7 September 2004.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  A. Jablonka-Shariff, T. R. Kumar, J. Eklund, A. Comstock, and I. Boime Single-Chain, Triple-Domain Gonadotropin Analogs with Disulfide Bond Mutations in the {alpha}-Subunit Elicit Dual Follitropin and Lutropin Activities in Vivo Mol. Endocrinol., June 1, 2006; 20(6): 1437 - 1446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
