Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print October 6, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.035048
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/2/460    most recent
biolreprod.104.035048v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vernochet, C.
Right arrow Articles by Kanellopoulos-Langevin, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vernochet, C.
Right arrow Articles by Kanellopoulos-Langevin, C.
Agricola
Right arrow Articles by Vernochet, C.
Right arrow Articles by Kanellopoulos-Langevin, C.
BIOLOGY OF REPRODUCTION 72, 460–469 (2005)
DOI: 10.1095/biolreprod.104.035048
© 2005 by the Society for the Study of Reproduction, Inc.

Affinity-Dependent Alterations of Mouse B Cell Development by Noninherited Maternal Antigen1

Cécile Vernochet4, Stéphane M. Caucheteux3,4, Marie-Claude Gendron5, Josiane Wantyghem4, and Colette Kanellopoulos-Langevin2,4

Laboratory of Immune Regulations and Development,4 Department of Developmental Biology, and Flow Cytometry Unit,5 J. Monod Institute, UMR 7592 (CNRS and Universities Paris 6 and 7), 75251 Paris cedex 05, France


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We have examined the passage of maternal cells into the fetus during the gestation and postpartum in mice. Using enhanced green fluorescent protein (EGFP)-transgenic females, we showed that maternal cells frequently gain access to the fetus, mostly in syngeneic pregnancies, but also in allogeneic and outbred crosses. EGFP-transgenic cells, including B, T, and natural killer cells, can persist until adulthood, primarily in bone marrow and thymus. We then asked whether maternal cells, bearing antigens not inherited by the fetus, influence the development of fetal and neonatal B lymphocytes. We have used the B cell receptor 3-83 µ/{delta} transgenic mouse model, whose B cells recognize the major histocompatibility complex class I molecules H-2Kk and H-2Kb, with a high or moderate affinity, respectively. The fate of transgenic B cells in animals exposed to noninherited H-2Kk or H-2Kb maternal antigens (NIMA) during gestation and lactation was compared with those of nonexposed controls. In H-2Kk-exposed fetuses, NIMA-specific transgenic B cells are partially deleted during late gestation. Nondeleted cells have downmodulated their B cell receptor. In contrast, in NIMA H-2Kb-exposed neonates, transgenic B cells present an activated phenotype, including proliferation, upregulation of surface CD69, and preferential localization in the T cell zone of splenic follicles. This state of activation is still clearly detectable up to 3 wk of age. Thus, we show that fetal and neonatal B cell development is affected by maternal cells bearing antigens noninherited by the fetus and that this phenomenon is highly dependent on the affinity of the B cell receptor for the NIMA.

developmental biology, embryo, immunology, pregnancy


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although the fetal and maternal blood circulations are separated, numerous studies have demonstrated the passage of cells across the fetal-maternal interface in either direction. These observations took place in humans as well as in mice, both species presenting a hemochorial placenta.

In humans, the passage of fetal cells or DNA into the maternal circulation was detected by procedures designed to develop noninvasive prenatal diagnosis [1–4]. The long-term persistence of low numbers of fetal hematopoietic progenitors in the maternal peripheral blood, even for decades, has been demonstrated [5], and it has been proposed that this microchimerism could be playing a role in the development of autoimmune diseases [6–9].

The reverse transfer of nucleated maternal cells [10–13], DNA [14, 15], or antibodies [16] into the fetal circulation and organs [17] has also been described. If antibodies are important to confer a protective immunity to the newborn, it appears that, in some cases, specific maternal antibodies are able to induce autoimmune diseases, such as autoimmune ovarian disease or autoimmune diabetes [18, 19].

Moreover, the presence of maternal leukocytes in the fetal circulation might be a significant risk when umbilical cord blood is used for bone marrow transplantation [20– 22]. The transmission of maternal cells could also be responsible for the vertical transfer of infectious agents, such as HIV-1 [23, 24]. The transfer of a natural killer-cell lymphoma from mother to fetus has also been described [25]. Engraftment of maternal cells has been reported in immune-deficient children [26, 27] as well as in normal offspring, where maternal cells can persist for decades [28]. It has been postulated that these maternal cells could play a role in the pathogenesis of juvenile inflammatory myopathies [29].

If maternal microchimerism seems to have adverse consequences, it might also present beneficial ones. Thus, the migration of maternal cells into the fetus can induce it to become tolerant to its noninherited maternal antigens (NIMA) and contribute to the partial immunological tolerance observed in the adult [30]. In 1988, Claas et al. [31] observed that half of highly sensitized patients, waiting for a renal allograft and producing anti-human leukocyte antigens (HLA) antibodies that react with virtually all donors do not form antibodies to NIMA. In 1998, Burlingham et al. [32] studied the outcome of kidney transplantations between haplo-identical siblings. They found that the graft survival of kidneys, donated by haplo-identical siblings mismatched for the NIMA haplotype, was similar to that of kidneys donated by an HLA-identical sibling [32]. A recent study from Andrassy et al. [33] showed that mice exposed to noninherited maternal H-2d alloantigens tolerated H-2d-bearing heart or skin grafts much longer than control animals nonexposed to NIMA H-2d. The authors suggested that exposure to NIMA during gestation and lactation inhibited anti-NIMA T cell responses in the offspring, thus predisposing it to NIMA-specific transplantation tolerance as an adult. This hypothesis implies that the immune repertoire is shaped not only by self-MHC antigens but also by NIMA carried by maternal cells entering the offspring.

Previous studies on the frequency of maternal cell traffic into the fetus did not encompass the entire gestation and postnatal periods and yielded somewhat inconsistent results, possibly due to differences in the methods of analyses used [10–13; 34].

In the present work, we have used EGFP (enhanced green fluorescent protein)-transgenic (Tg) mice [35–36] to track maternal cells within the offspring. We have determined the frequency of maternal cell passage into the fetus, the gestational stage of this traffic, the localization and the nature of some maternal cells, and the importance of genetic differences between mother and fetus in this process.

We then addressed the question of the influence of these maternal cells on developing B lymphocytes. We have used 3-83 BcR (B cell receptor)-Tg mice, whose B lymphocytes recognize H-2Kk and H-2Kb MHC class I antigens with high and lower affinities, respectively [37]. BcR-Tg fetal and neonatal B lymphocytes exposed to noninherited maternal H-2Kk or H-2Kb antigens were studied and compared with their BcR-Tg counterparts nonexposed to NIMA during gestation and lactation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice

EGFP-Tg mice (on C57Bl/6 background) were provided by M. Okabe (Genome Information Research Center, Osaka, Japan) [35]. EGFP/+ females were crossed with C57Bl/6 (H-2b) or FvB (H-2q) males. The EGFP-Tg mice on ICR background were provided by A. Nagy (Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Canada) [36]. EGFP/+ females were crossed with ICR males. The non-Tg progeny was analyzed to detect EGFP-Tg maternal cells.

3-83 µ/{delta} BcR-Tg mice (on B10.D2 background), which express immunoglobulin M (IgM) and D (IgD) forms of the 3-83 antibody, were donated by Dr. D. Nemazee (Scripps Research Institute, La Jolla, CA) [37]. The 3-83 Tg BcR binds the H-2Kk MHC class I antigen with a high affinity and the H-2Kb antigen with a lower affinity. 3-83 BcR-Tg males were crossed with B10.D2 (H-2d) females as controls and with (B10.D2 x B10.BR)F1 (H-2d/k) or (B10.D2 x C57Bl/10)F1 (H-2d/b) females. 3-83 BcR-Tg B lymphocytes from the H-2d/d progeny were analyzed.

Mice were bred and maintained at the J. Monod Institute's facilities under specific pathogen-free conditions for the animals used in the NIMA experiments. All animal care and handling were performed according to institutional guidelines. The day of the vaginal plug was considered as Day 0.5 of gestation.

Detection of the EGFP Maternal Transgene in the Progeny

Cell suspensions Fetuses were carefully harvested and washed several times in PBS to avoid maternal cell contaminations. Nucleated cell suspensions were prepared from various organs of individual mice: fetal liver (FL) from Embryonic Day 13.5 (E13.5) to E14.5; FL, thymus, and spleen from E15.5 until birth; bone marrow (BM), thymus, and spleen at weaning (3 wk); BM, thymus, spleen, and peripheral blood in young adults (6 wk). Heparinized blood was obtained from anesthetized animals by intracardiac puncture. BM samples were flushed from the femurs and tibias with 4% fetal calf serum (FCS) in PBS. Spleen, thymus, and FL were gently pressed through a sieve using a syringe plunger and then suspended in this medium. Erythrocytes were eliminated from blood, spleen, and FL cell suspensions by osmotic shock in lysing buffer (0.17 M Tris and 8.3 g/L ammonium chloride, mixed 1/9 [v/v], pH 7.3). Viable cells were counted by Trypan blue exclusion. Cells resuspended in 199 tissue-culture medium, with 25 mM HEPES, 5% FCS, 5% normal mouse serum Ig to block Fc receptors, were used for panning experiments, and DNA was directly isolated from the remaining cell suspensions.

Panning Tissue-culture Petri dishes were coated overnight (ON) at 4°C with purified monoclonal antibodies (mAbs) in PBS. The following mAbs were used: 14.8 (rat/anti-B220, 3 µg/ml), 145-2C11 (hamster/anti-CD3{varepsilon}, 20 µg/ml), and PK136 (mouse/anti-NK1.1, 20 µg/ml). Plates were washed three times with PBS, and cell suspensions (106 cells/ml) were then incubated for 1 h at room temperature (RT). Nonretained cells were gently removed and retained cells were harvested by vigorous washing. DNA was isolated from each population. The purity of the retained cells was controlled by cytometry analysis and was over 90%.

Nested PCR In order to detect the maternal EGFP transgene, PCR analyses were performed in a final volume of 25 µl containing 100 ng of purified genomic DNA in PCR MgCl2-free buffer (Promega, Paris, France), 1/5 of Cresol Red (60% sucrose, 1 mM Cresol Red), 1.5 mM of MgCl2, 0.2 mM of each dNTP, 1 µM of the following primers specific for the EGFP transgene: 5' TGGTGAGCAAGGGCGAGGAG 3' and 5' TCAGGTAGTGGTTGTCGGGC 3,'; 1 U of Taq DNA polymerase (Promega), under the following conditions: a 1-min denaturing step at 94°C followed by 40 amplification cycles (1 min at 94°C, 1.5 min at 66°C, 1 min at 72°C), and a final 10-min elongation step at 72°C. Two microliters of the amplification products were then reamplified in PCR MgCl2-free buffer, 2 mM MgCl2, 1/5 Cresol Red, 0.2 mM of each dNTP, 1 µM of the following primers: 5' TTCAAGGAGACGGCAACTA 3' and 5' ATGGGGGTGTTCTGCTGGTA 3,', 1 U of Taq DNA polymerase as follows: 1 min at 94°C, 30 amplification cycles (1 min at 94°C, 1.5 min at 62°C, 1 min at 72°C) and 10 min at 72°C. The size of the amplification product was 269 base pairs.

Influence of NIMA on B Lymphocyte Development

Cell suspensions According to the developmental stage studied, cells were isolated from either the FL or BM and spleen of individual mice. Cell suspensions were obtained as described above in PBS containing 4% FCS and 0.1% sodium azide (PBS/FCS/NaN3). Viable cells were counted by Trypan Blue exclusion.

Immunofluorescence staining and flow cytometric analyses Commercial antibodies were purchased from Pharmingen (Le Pont de Claix, France). Aliquots of 106 nucleated cells were incubated for 40 min at 4°C with an optimal amount of the following antibodies: mAb anti-{lambda}-light chain coupled to FITC, polyclonal goat antimouse IgM antibodies coupled to FITC (Southern Biotechnology Associates, Montrouge, France), and biotin-coupled mAbs: anti-H2-Kb AF6-88.5, anti-H2-Kd SF1-1.1, anti-H2-Kk 36-7-5, anti-IgDa, anti-B220, anti-3-83 idiotype 54.1 (prepared according to conventional techniques). Cells were washed twice in PBS/FCS/ NaN3. Biotinylated antibodies were revealed by incubating cells for 20 min at 4°C with phyco-erythrin (PE)-coupled streptavidin. After washing, cells were analyzed on an Epics Elite-ESP flow cytometer (Beckman-Coulter, Roissy, France) equipped with a 488-nm argon laser (Coultronics, Margency, France). The cell populations analyzed were gated on the lymphoid cell population on the basis of forward and side-scatter criteria. At least 10 000 IgM or B220-positive cells were analyzed from each sample.

BrdU labeling BrdU (Sigma, Saint Quentin Fallavier, France) was administered continuously for 65 or 90 h to mothers in filtered, deionized drinking water at a concentration of 1 mg/ml with 5% glucose to overcome taste aversion. Cell suspensions were first labeled with mAb anti-B220 coupled to biotin and revealed by streptavidin PE. After fixing for 30 min in ice-cold 95% ethanol, cells were washed and permeabilized for 30 min at RT in 1% paraformaldehyde/0.01% Tween 20 in PBS. Cellular DNA was then denatured for 10 min at RT, using 10 µM HCl and 50 U of Dnase I. After two washes, cells were stained for 30 min at RT with FITC-conjugated anti-BrdU mAb (DAKO, Trappes, France). After washing, cells were resuspended and analyzed by flow cytometry.

Caspase-3 activity in B cells Cells (5 x 105) stained with mAb anti-B220 coupled to biotin and revealed by streptavidin-PE were pelleted, resuspended in 10 µl of PhiPhiLux (DEVD-rhodamine; Calbiochem, Fontenay-sous-Bois, France), and incubated for 1 h at 37°C. The reaction was stopped by adding 1 ml of PBS/FCS/NaN3 followed by centrifugation. Cells were resuspended in PBS/FCS/NaN3 and analyzed immediately by flow cytometry. The frequency of cells containing active caspase-3 was determined by monitoring the increase of free rhodamine fluorescence.

Immunocytochemical analysis E18.5 and 8.5-day-postpartum (dpp) spleens were removed, fixed in 4% paraformaldehyde in PBS for 1 h at 4°C and incubated ON at 4°C in 25% saccharose in PBS. They were embedded in Cryomatrix (Shandon, Eragny, France) and quickly frozen in liquid nitrogen. Six-micron cryosections (Leica, France) were placed on Superfrost-plus slides (CML, Nemours, France) and stored at –80°C. Air-dried cryosections were fixed for 20 min at 4°C with acetone. Slides were treated for 30 min at RT first with 1% H2O2 in PBS to block endogenous peroxidases, then with 1% BSA in PBS. Cryosections were incubated for 90 min at RT with the following biotin-coupled antibodies (in 0.1% BSA in PBS): anti-B220, anti-CD3{varepsilon} (145-2C11; e-Bioscience, Montrouge, France) or 54.1 mAb anti-3-83 idiotype. Cryosections were then washed several times with PBS/BSA 0.1%. Biotin-coupled antibodies were revealed by a peroxidase-coupled streptavidin (Vector Abcys, Paris, France) for 50 min at RT. After washes, the peroxidase activity was detected with 3-amino-9-ethyl-carbamazole into acetate buffer (pH 5) (AEC Staining Kit; Sigma). After counterstaining for 1 min with Mayer hematoxylin solution and washes, the slides were mounted in Immu-mount (Shandon) with coverslips, and examined under a light microscope (Leica) equipped with a DMX 1200 camera (Nikon France) and connected to a computer equipped with Lucia v4.5 software.

Statistical Analyses

Data were compared using the {chi}2 test, the Fisher test for small samples, or the Student t-test.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
EGFP-Tg Maternal Cells Gain Access to Fetal Organs During Gestation/Lactation and Persist Until Adulthood

To follow EGFP-Tg maternal cells into the offspring, EGFP-Tg/+ females were mated with non-Tg males. Three different crosses were analyzed: syngeneic mating, EGFP/ + C57/Bl6 (H-2b) female x C57/Bl6 (H-2b) male; allogeneic mating, EGFP/+ C57/Bl6 (H-2b) female x FvB (H-2q) male; and outbred mating, EGFP/+ ICR female x ICR male. This enabled us to study the effect of histocompatibility differences between mothers and fetuses on the passage of maternal cells into the progeny. Hematopoietic organs of individual offspring were harvested from Day E13.5 until birth, at 3 wk (weaning), and 6 wk of age (young adult). Special care was taken to avoid contamination by maternal cells during fetus manipulation. The DNA of each organ was extracted, and the EGFP transgene was detected using a nested PCR assay. The sensitivity of the assay was estimated by diluting EGFP/+ cells into non-Tg cell suspensions at ratios ranging from 1/5 to 1/106. EGFP/ + cells were still reproducibly detectable when they represented 1/105 cells, but not 1/(5 x 105) or 1/106 (data not shown).

Results are presented in Figure 1A. In all three crosses, EGFP maternal cells were detected as early as E13.5–14.5 in the fetal liver, which is the hematopoietic organ until birth, in 9% (syngeneic and allogeneic) to 22% (outbred) of the fetuses. After E15.5, maternal cells were found in greater frequency in syngeneic offspring. They were preferentially localized in the fetal liver (42% of the fetuses) and less often in the thymus (25%) or spleen (10%). No selective localization was observed in the two other matings (18% of fetal livers, 14% of thymus, and 8% of spleens in allogeneic pregnancies; 31% of fetal livers, 22% of thymus, and 25% of spleens in outbred pregnancies). Our results indicate that the passage of maternal cells is a common phenomenon in normal gestation and that antigenically different cells are less able to migrate into the fetus or that they are more easily eliminated in the progenies.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 1. EGFP-Tg maternal cells, including immune cells, gain access to fetal organs during gestation/lactation and persist until adulthood. Heterozygote EGFP-Tg females were mated with non-Tg males. Three types of crosses were analyzed: syngeneic EGFP-Tg C57/Bl6 (H-2b) females x C57/Bl6 (H-2b) males, allogeneic EGFP-Tg C57/Bl6 (H-2b) females x FvB (H-2q) males, outbred EGFP-Tg ICR females x ICR males. Fetal liver, thymus, and spleen were harvested before birth, and bone marrow, thymus, and spleen after birth. A) Nested PCR specific for the maternal EGFP transgene was performed on DNA extracted from the various organs. Frequency represents the ratio of the number of PCR-positive samples versus the total number of samples for each organ at every stage or age. For each cross, the size of the samples was as follows: n ≥ 20 E13.5–14.5 fetuses obtained from 4 mothers, n ≥ 80 E15.5 to birth animals obtained from 15 mothers, n ≥ 12 at weaning (3 mothers) and n ≥ 10 adults (from 3 mothers). B) B, T, or NK cells from the offspring's primary lymphoid organs were isolated by panning using specific monoclonal antibodies (14.8 anti-B220, 145-2C11 anti-CD3{varepsilon}, and PK136 anti-NK1.1). DNA extracted from purified cells was amplified using nested PCR specific for maternal EGFP transgene. Frequency was determined as above. For each cross, the size of the samples was as follows: n ≥ 10 E13.5–14.5 fetuses (from 2 mothers), n ≥ 42 E15.5-birth (from 10 mothers), n ≥ 12 at weaning (from 3 mothers), and n ≥ 10 adults (from 3 mothers)

To examine the extent of maternal cell persistence, organs were tested for the presence of the maternal EGFP transgene at different times after birth. At weaning, maternal cells were still detectable but more often in syngeneic or allogeneic matings than in outbred ones. They localized preferentially in the BM and thymus (46% and 38% in syngeneic; 43% and 43% in allogeneic; 25% and 25% in outbred crosses) and were observed in about 20% of the spleens in all three matings (23%, 26%, and 17%, respectively). Although the present study did not distinguish between transplacental transfer and cell passage through milk feeding, our observations suggest that 1) either the transfer of maternal cells also occurs via milk or that maternal cells engraft and divide in the progeny, especially in primary lymphoid organs such as BM and thymus; and 2) engraftment is facilitated in syngeneic or allogeneic offspring compared with outbred ones. This suggests that haploidentical cells can persist as well as identical ones in the progeny, whereas more maternal cells are eliminated by the outbred offspring's immune system, even though they persist in 25% of organs.

Maternal cells were very commonly found in young syngeneic and allogeneic adults, which supports the engraftment hypothesis. EGFP cells were found in 69% to 80% of the primary lymphoid organs (BM and thymus) despite the absence of a source of maternal cells between 3 and 6 wk of age. Maternal cells were also observed in 30% of the spleens as well as in peripheral blood in 30% to 38% of the offspring. In outbred progeny, maternal cells were detected mainly in BM and peripheral blood (40% and 38% of animals, respectively) and were very rare in spleen (6%) and thymus (12%) compared with the two other matings. This confirms the observations made at weaning and suggests that maternal cells can also persist at low range and engraft in fully mismatched offspring.

Maternal Cells Found in the Offspring Include B and T Lymphocytes and Natural Killer Cells

Previous studies have suggested that maternal cells found in the progeny included lymphoid cells [13, 34]. Panning experiments were carried out to specifically isolate B, T, and natural killer (NK) cells from offspring's lymphoid organs (fetal liver and fetal thymus, BM, and thymus postpartum). The EGFP transgene-specific nested PCR was then applied to these purified cell samples to detect maternal cells. Results are presented in Fig. 1B. As maternal cells did not exhibit any preferential localization, the results obtained from fetal liver and thymus, or from BM and thymus, were pooled.

In syngeneic crosses, maternal cells were detected at low frequencies during gestation. Only T cells were recovered from 17% of fetal organs at E13.5–14.5. This percentage was maintained until weaning and fell in young adults. Between E15.5 and birth, B and NK cells were observed, in 11% and 26% of the organs, respectively. These frequencies reached 50% of young-adult organs.

No immune maternal cells were detected at E13.5–14.5 in allogeneic animals, and they remained very rare from E15.5 until birth, with a maximum of 6% for NK cells in fetal organs. After birth, the frequency of detection of immune maternal cells in offspring's organs rose regularly to reach 40% for T and NK cells and 60% for B cells in young adults. These results suggest that maternal immune cells preferentially gain access to the neonate during lactation or that they are able to engraft and divide in lymphoid organs of syngeneic and allogeneic offspring.

In outbred progeny, very few maternal lymphoid cells were detected at E13.5–14.5, except for T cells in 17% of the fetuses. After E15.5, B, T, and NK cells were found in less than 20% of the organs studied, whatever the gestational stage or the mouse age. Maternal immune cells were detected in 10% of young-adult organs, and thus, they seem to have a limited capacity to engraft in these animals.

Thus, it appears that maternal cell microchimerism occurs regularly in normal pregnancy and can persist until adulthood. This raises the question of the potential role of these maternal cells in the offspring. Maternal cells, including mature immune cells expressing high levels of antigens and, in particular, MHC antigens, which have not been inherited by the fetus, could influence the developing fetal and neonatal immune system. Using the BcR 3-83 µ/{delta} Tg mouse model, we have studied the effect of NIMA on fetal and neonatal B lymphocytes.

3-83 Tg Mouse Model

We first analyzed the effect of H-2Kk NIMA exposure on the development of the progeny's B lymphocytes. The (B10.D2 x B10.BR) F1 females (H-2d/k) were mated with 3-83 µ/{delta} BcR-Tg males (H-2d/d) to study the influence of maternal H-2Kk as NIMA on the developing 3-83 Tg B lymphocytes of H-2d/d fetuses. The 3-83 BcR binds the MHC class I antigen H-2Kk with a high affinity. Control animals were obtained from B10.D2 females (H-2d/d) mated with 3-83 BcR-Tg males (H-2d/d).

B Lymphocytes Specific for H-2Kk NIMA Are Partially Deleted During Late Gestation in H-2Kk-Exposed Fetuses

On Day 18.5 postcoitum (dpc), the percentage of immature B cells (IgM+ IgDa–) specific for NIMA was decreased by 67% in the fetal liver and by 41% in the spleen from NIMA-exposed fetuses compared with controls (Figure 2A; P < 0.001). Thus, fetal immature B cells specific for NIMA were partially deleted during gestation. This partial deletion also affected mature B cells as the percentage of IgM+ IgDa+ cells was decreased by 28% in the liver and spleen of NIMA-exposed fetuses compared with controls (Fig. 2A; P < 0.01). Moreover, numbers of immature and mature B cells decreased similarly in NIMA-exposed fetuses (data not shown). This disappearance of B cells specific for NIMA was also observed in idiotype-positive B cells (data not shown). Percentages and numbers of B220+ B cells were also diminished in NIMA-exposed fetuses (data not shown). This indicates that the deficit of B cells in NIMA-exposed animals is not due to the modulation of the BcR from the cell surface because the B220 B cell marker is independent from the BcR.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 2. B lymphocytes are partially deleted in late gestation in H-2Kk NIMA-exposed fetuses. A, B) Liver and spleen B cells from E18.5 3-83 BcR-Tg H-2Kd/d fetuses exposed or not to maternal H-2Kk were analyzed by flow cytometry, using anti-IgM and anti-IgDa (specific for the BcR transgene) antibodies. nNIMA-exposed = 14 from 5 mothers; ncontrol = 14 from 4 mothers. *, P < 0.02; **, P < 0.01; ***, P < 0.001; Student t-test. A) Percentages of immature IgM+ IgDa– and mature IgM+ IgDa+ B cells. B) The sIgM mean fluorescence index (MFI) on immature and mature B cells. C, D) Representative cryosections of spleen from E18.5 3-83 BcR-Tg H-2Kd/d fetuses nonexposed (C) or exposed (D) to maternal H-2Kk. Sections treated with the 54.1 anti-idiotype mAb coupled to biotin were revealed with streptavidin-peroxidase and counterstained with Mayer hematoxylin. Bar = 100 µm

It appears that the remaining mature liver and spleen B cells had encountered the NIMA as their surface IgM (sIgM) were reduced by 18% (Fig. 2B; P < 0.05). This suggests a process of anergy, already described as a mechanism for autoreactive B cell to escape elimination. In contrast, liver and spleen immature B cells were not affected, as their sIgM mean fluorescence index (MFI) were identical to those of control fetuses (Fig. 2B).

These results were confirmed as early as E16.5, when we observed a 56% decrease in fetal liver immature B cell percentages in NIMA-exposed fetuses compared with controls (P < 0.01; data not shown). At this stage, mature B cell percentages were not affected, but the 25% decrease in their sIgM MFI (P < 0.001; data not shown) indicated that they had also encountered the antigen.

To visualize the disappearance of B cells in H-2Kd/d fetuses exposed to the maternal H-2Kk antigen, cryosections of E18.5 spleens were stained with the anti-idiotypic 54.1 mAb. Representative sections of spleen obtained from fetuses nonexposed (Fig. 2C) or exposed to the maternal H-2Kk antigen (Fig. 2D) showed that 54.1-positive cells were scattered in the central part of the spleen. However, in NIMA-exposed fetuses, these cells were less numerous. To quantify these differences, 54.1+ cells were counted in 300-µm x 220-µm areas. The mean number of 54.1+ cells per area was significantly different in H-2Kk-exposed versus control fetuses (P < 0.001; Student t-test; nNIMA-exposed = 28 areas and ncontrol = 18 areas from four different E18.5 fetal spleens from at least two mothers). An average of 87 ± 60 54.1+ B cells per area was obtained in H-2Kk-exposed spleens versus 280 ± 152 in control animals, thus confirming the partial deletion of B cells specific for H-2Kk in the spleen of NIMA-exposed fetuses. The deletion observed in spleen sections was more important than the one shown by flow cytometry. This may result from the low intensity of the 54.1 immunocytochemical staining in spleen sections of NIMA-exposed animals, leading to false negatives, and from differences in the sensitivity of the two techniques.

Impaired Proliferation and Caspase-3 Activation in B Lymphocytes from H-2Kk-Exposed Fetuses

We then asked whether this B cell deficit in H-2Kk NIMA-exposed fetuses was due to impaired cell proliferation or to cell death. BrdU was given to mothers in drinking water, and BrdU incorporation was measured in fetal liver and spleen B220+ cells from control and NIMA-exposed fetuses (Fig. 3A). Proliferation of B220+ cells recovered from E18.5 fetal liver was not impaired in H-2Kk NIMA-exposed fetuses compared with controls. In contrast, the percentage of B220+ cells, which had incorporated BrdU in E18.5 spleens of H-2Kk NIMA-exposed fetuses, was decreased by 50% compared with controls (P < 0.001). This indicates that fetal spleen B cells proliferate less as a consequence of exposure to H-2Kk NIMA.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 3. Impaired proliferation and increased caspase-3 activation in B lymphocytes from H-2Kk NIMA-exposed fetuses. A) BrdU was given to the mothers in the drinking water from 15.5 days postcoitum (dpc). Liver and spleen B cells from E18.5 3-83 BcR-Tg H-2Kd/d fetuses exposed or nonexposed to maternal H-2Kk were stained with anti-B220 and anti-BrdU antibodies and analyzed by flow cytometry. nNIMA-exposed = 8 from 4 mothers; ncontrol = 10 from 2 mothers. ***, P < 0.001; Student t-test. B) Liver and spleen B cells from E18.5 3-83 BcR-Tg H-2Kd/d fetuses exposed or nonexposed to maternal H-2Kk were stained with anti-B220 antibody, incubated with DEVD-rhodamine, and analyzed by flow cytometry. nNIMA-exposed = 8 from 2 mothers; ncontrol = 11 from 3 mothers. **, P < 0.01; ***, P < 0.001; Student t-test

We next measured the activity of caspase-3, which is one central mediator of apoptotic cell death, to find if increased apoptosis could be responsible for the B cell deficit observed in H-2Kk NIMA-exposed animals. This activity was measured in liver and spleen B220+ cells, using DEVD-rhodamine, a substrate containing the preferred caspase-3 recognition site and cleaved by caspase-3. This reagent can be used in intact cells and the cleavage activity can be measured by flow cytometry. It has been previously used and validated by Sandel et al. [38]. No difference in caspase-3 activity was observed in B220+ fetal liver cells from H-2Kk NIMA-exposed and control fetuses (Fig. 3B). In contrast, caspase-3 was activated in twice as many B220low and B220high splenic cells from H-2Kk NIMA-exposed fetuses than controls (P < 0.01; Fig. 3B). These results showed that a significant fraction of splenic B cells does not proliferate and die by caspase-3-dependent apoptosis in fetuses exposed to H-2Kk NIMA. Thus, when the NIMA is bound with high avidity by the 3-83 Tg BcR, this can impair B cell proliferation and induce a clonal deletion in spleen Tg B cells from late gestation fetuses.

B cells can use another mechanism, called receptor editing [39], to avoid deletion during the induction of tolerance to self-antigens. As the 3-83 BcR uses a {kappa} light chain, a switch toward {lambda} light chains was examined in fetal B cells. Extremely low percentages of B cells expressing {lambda} light chains in liver and spleen of H-2Kk-exposed fetuses as well as in control ones were found (data not shown). In late gestation, B cells did not use receptor editing to escape deletion in NIMA-exposed fetuses.

We wondered whether that tolerant state persists in older animals. No difference in the BcR-Tg B cell populations between animals exposed to H-2Kk during gestation and lactation versus control ones was observed at 3.5 dpp, 8.5 dpp, or at weaning. The tolerant B cell phenotype was not maintained after birth.

B Lymphocytes Specific for H-2Kb NIMA Present an Activated Phenotype in H-2Kb-Exposed Neonates

To determine whether the BcR-NIMA binding affinity influences B cell development, we examined the fate of 3-83 Tg B cells in animals exposed or not to the maternal MHC class I antigen H-2Kb during gestation and lactation. This antigen is recognized by the 3-83 Tg BcR with less affinity than the H-2Kk antigen. The (B10.D2 x C57Bl/10) F1 females (H-2d/b) were mated with 3-83 µ/{delta} Tg males (H-2d/d) to study the influence of maternal H-2Kb as NIMA. Control progenies were obtained from B10.D2 females (H-2d/d) mated with 3-83 Tg males (H-2d/d).

At 16.5 and 18.5 dpc, no effect of fetal exposure to H-2Kb NIMA could be detected on the fetal liver and spleen Tg B cells. In contrast, at 8.5 dpp, the percentage of IgM+ IgDa– immature B cells increased both in the BM (+50%) and spleen (+72%) of NIMA-exposed animals, compared with control ones (Fig. 4A; P < 0.001). The percentage of IgM+ IgDa+ mature B cells increased in the BM (+29%) of experimental animals (Fig. 4A; P < 0.01). Numbers of B cells were similarly increased in NIMA-exposed animals (data not shown). This phenomenon was confirmed by flow cytometry analyses of B cells stained with anti-IgM and anti-idiotype and with anti-B220 (data not shown).



View larger version (73K):
[in this window]
[in a new window]
  		FIG. 4. B lymphocytes present an activated phenotype in H-2Kb NIMA-exposed neonates. A, B) BM and spleen B cells from 8.5-days-postpartum (dpp) 3-83 BcR-Tg H-2Kd/d neonates exposed or nonexposed to maternal H-2Kb were analyzed by flow cytometry, using anti-IgM and anti-IgDa antibodies. nNIMA-exposed = 12 from 4 mothers; ncontrol = 11 from 4 mothers. **, P < 0.01; ***, P < 0.001; Student t-test. A) Percentages of immature IgM+ IgDa– and mature IgM+ IgDa+ B cells. B) The sIgM MFI on immature and mature B cells. C–F) Representative details of cryosections of spleen from 8.5-dpp 3-83 BcR-Tg H-2Kd/d neonates nonexposed (C, transverse section; E, longitudinal section) or exposed (D, transverse section; F, longitudinal section) to maternal H-2Kb. Sections were stained with 54.1 mAb coupled to biotin, revealed with streptavidin-peroxidase, and counterstained with Mayer hematoxylin. Bar = 50 µm

Mature B cells from BM and spleen displayed enhanced sIgM MFI, +26% and 20%, respectively (Fig. 4B; P < 0.01), indicating that the density of sIgM on mature B cells from animals exposed to the H-2Kb antigen was increased. This increase in B cell number, as well as in BcR density, suggests that neonatal Tg B cells exposed to a NIMA bound with a moderate affinity become activated.

At 3.5 dpp, a 44% increase in the percentages of BM immature B cells (IgM+ IgDa–) was already observed in H-2Kb NIMA-exposed fetuses compared with control ones (P < 0.01; data not shown).

These observations were confirmed when 8.5-dpp spleen cryosections were stained with the 54.1 anti-BcR mAb. Transverse (Fig. 4, C and D) and longitudinal (Fig. 4, E and F) sections show representative details of spleens from neonates exposed or not to the maternal H-2Kb antigen during gestation and lactation. In control spleens (Fig. 4, C and E), 54.1+ B cells were contained within the B cell zone of the follicles and were absent from the periarteriolar lymphoid sheath containing T cells. In contrast, in NIMA-exposed neonates (Fig. 4, D and F), 54.1+ B cells appeared to be more numerous in each follicle as well as scattered in the marginal zone and red pulp. Moreover, they were also clearly present in the T cell zone of the follicles. These observations strongly suggest that B cells specific for H-2Kb are activated in NIMA-exposed neonates.

The mean number of 54.1+ cells in 300-µm x 220-µm areas was significantly increased in the H-2Kb-exposed animals compared with controls for isolated B cells outside follicles as well as for follicular B cells (P < 0.001; Student t-test; nNIMA-exposed = 105 areas and ncontrol = 114 areas from four different 8.5-dpp neonate spleens from at least two mothers). An average of 204 ± 171 cells was counted in each area in H-2Kb-exposed and of 128 ± 121 in control spleens. This confirms the observation made in flow cytometry experiments, showing an increase of immature B cell numbers in the spleens of H-2Kb-exposed animals.

B220+ cell proliferation was then checked by BrdU incorporation in BM and spleen (Fig. 5A). B220+ cells from H-2Kb-exposed animals proliferate more actively in BM (x4) and spleen (x2) compared with control ones (P < 0.001). Moreover, the early activation marker CD69 was expressed in almost three times as many IgM+ B cells in neonates exposed to the H-2Kb antigen than in control ones (Fig. 5B; P < 0.001). These observations confirm that offspring's B cells are activated when they recognize the NIMA with a moderate affinity.



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 5. The proliferation rate and the percentage of B cells expressing the activation marker CD69 are increased in neonates exposed to H-2Kb NIMA. A) BrdU was given to the mothers in the drinking water from 4.5 dpp. BM and spleen B cells from 8.5-dpp 3-83 BcR-Tg H-2Kd/d neonates exposed or nonexposed to maternal H-2Kb were analyzed by flow cytometry, after staining with anti-B220 and anti-BrdU antibodies. nNIMA-exposed = 3 from 2 mothers, ncontrol = 4 from 2 mothers. ***, P < 0.001; Student t-test. B) BM and spleen B cells from 8.5-dpp 3-83 BcR-Tg H-2Kd/d neonates exposed or nonexposed to maternal H-2Kb were analyzed by flow cytometry, after staining with anti-IgM and anti-CD69 antibodies. nNIMA-exposed = 12 from 4 mothers, ncontrol = 7 from 2 mothers. ***, P < 0.001; Student t-test

Activated Phenotype of H-2Kb NIMA-Exposed B Lymphocytes Is Still Clearly Seen at Weaning

As shown in Figure 6A, the percentage of IgM+ IgDa+ mature B cells was augmented by 35% in the BM and by 24% in the spleen of H-2Kb-exposed animals compared with control ones (P < 0.05). Moreover, the percentage of immature IgM+ IgDa– B cells was also increased by 55% in the spleen of NIMA-exposed animals (P < 0.01). A parallel alteration of B cell numbers was observed in NIMA-exposed animals (data not shown) and was in agreement with the results of the IgM/idiotype staining (data not shown).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6. H-2Kb NIMA-exposed B lymphocytes still display an activated phenotype at weaning. BM and spleen B cells from 3-83 BcR-Tg H-2Kd/d 3-wk-old offspring exposed or nonexposed to maternal H-2Kb were analyzed by flow cytometry, using anti-IgM and anti-IgDa antibodies. nNIMA-exposed = 13 from 5 mothers, ncontrol = 17 from 5 mothers. *, P < 0.05; **, P < 0.01; ***, P < 0.001; Student t-test. A) Percentages of immature IgM+ IgDa– and mature IgM+ IgDa+ B cells. B) The sIgM MFI on immature and mature B cells

In H-2Kb-exposed animals compared with controls, sIgM were upregulated on IgM+ IgDa+ mature B cells in the BM and spleen (Fig. 6B), as the sIgM MFI was increased by 25% and 32%, respectively (P < 0.001). The density of sIgM was augmented only on immature BM B cells (+27% MFI, Fig. 6B; P < 0.01). All these results show that the activation phenotype observed in neonates persists at least until weaning. The time course of B cell activation in H-2Kb NIMA-exposed neonates is summarized in Figure 7.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 7. Time course of B cell activation in H-2Kb NIMA-exposed neonates. The ratios of mature (black squares) or immature (white squares) B cell mean percentages from H-2Kb NIMA-exposed versus control mice have been plotted according to the age of the animals, in bone marrow (A) and spleen (B). Likewise, the ratios of sIgM MFI from the same mature (black dots) or immature (white dots) B cell populations from H-2Kb NIMA-exposed versus control mice have been presented. A ratio of 1 means NIMA-exposed and control values are identical. Data from 3.5-dpp (also described in the Results section), 8.5-dpp (also presented in Fig. 4) and 3-wk-old (weaning) mice (also shown in Fig. 6) have been compiled in this figure


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Our results on maternal cell passage into mouse fetuses show that 1) maternal cell transmission to the fetus is frequent in normal gestation, 2) maternal cells are detectable in fetal organs as early as E13.5, 3) they localize preferentially in the primary lymphoid organs, 4) a higher frequency of maternal cell passage is observed reproducibly in syngeneic and allogeneic matings than in outbred gestations, and 5) maternal cells persist until adulthood. Interestingly, adult organs harbor maternal cells more frequently than fetal organs. This observation suggests that maternal cells can engraft in primary lymphoid organs, preferentially bone marrow and thymus, in syngeneic and allogeneic breedings and bone marrow in outbred mice. Moreover, maternal cells influence the development of the fetus and neonate's immune system. B lymphocytes of 3-83 Tg fetuses exposed to H-2Kk NIMA are subjected to tolerizing signals in late gestation as a result of high affinity recognition. In contrast, H-2Kb, which is recognized with a moderate affinity by the BcR, activates postnatal B lymphocytes.

Great disparities in the frequency and localization of maternal chimerism have been previously reported in mice. Hunziker et al. [10] recovered maternal cells exclusively in the liver of 1% of fetuses, while Shimamura et al. [11] found maternal cells only in neonatal pooled spleens. In contrast, Piotrowski and Croy [12] showed that, in late gestation fetuses, maternal cells were found extensively throughout the bone marrow. Using EGFP-Tg mice, Zhou et al. [13] observed that, in late-gestation, fetal liver, thymus, and spleen contain maternal cells at frequencies comparable with ours, but when they used EGFP mothers for foster nursing only, maternal cells transferred via lactation were present transiently and had disappeared by Day 9. Previous work by Andrassy et al. [33] also suggests that both gestation and lactation are required to obtain a detectable NIMA influence on the progeny. Along the same lines, in our study, progenies were born from and nursed by EGFP-Tg mothers, and chimerism could still be detected in 40% to 70% of adult bone marrows. Accordingly, Marleau et al. [34] also detected Tg-maternal cells by PCR in the bone marrow of all outbred CD1 mice of 6 to 12 wk of age they studied. Moreover, it remains to be seen whether maternal cells acquired in utero have an improved capacity for long-term engraftment, as it has been shown that adult CD4 T cells transferred into 4 day neonates or older ones proliferate less actively than cells transferred earlier [40].

The persistence of maternal cells in outbred offspring is consistent with the observation of Maloney et al. [28] that, in humans, HLA-mismatched maternal cells can remain in immunocompetent offspring during adult life. The presence of maternal cells or DNA in the umbilical cord blood is well known from studies designed to assess maternal contamination in cord blood samples used as a source of hematopoietic stem cells for transplantation [20–22]. The presence of CD34 maternal stem cells in cord blood samples suggests that some cells may engraft in the progeny [20], as maternal cells are also able to migrate from the peripheral circulation to fetal and neonatal organs [17]. This raises several nonexclusive hypotheses: 1) in utero and postnatally, the immune system of the progeny is not mature enough to eliminate all maternal cells in MHC-disparate offspring and 2) as the fetus and newborn are immunologically immature, space is available for engraftment of hematopoietic stem cells. Hence, maternal cells can successfully compete with host cells for growth in the bone marrow and thymus environments. This is also the case in syngeneic or allogeneic pregnancies. Different studies have shown that a neonatal lymphopenic environment promotes the proliferation of adult cells [40, 41].

Although some authors have proposed that maternal cells found in the offspring may include lymphocytes [13, 34], no clear evidence was obtained in immunocompetent mice. Arvola et al. [42] showed that maternal Ig-secreting cells can be transmitted to B cell-deficient offspring. To the best of our knowledge, we show for the first time in mice that maternal mature immune cells, including B and T lymphocytes and NK cells, are present in the lymphoid organs of a normal progeny. This raises the important question of the influence of maternal cells, bearing antigens noninherited by the offspring, on the development of the fetal and neonatal immune system.

In human transplantation, Claas et al. [31] reported that half of highly sensitized patients, waiting for a renal allograft, produce antibodies to their noninherited paternal HLA antigens (NIPA) but not to their NIMA. The authors hypothesized that NIMA-bearing cells, gaining access to the child during pregnancy or breast feeding, could induce a partial, but lifelong, tolerance in some individuals. Whether such an exposure to NIMA is of clinical benefit to patients who later receive an allograft was studied in the outcome of kidney transplantations between haplo-identical siblings. Burlingham et al. [32] found similar long-term graft survival when kidneys were donated either by a haplo-identical sibling mismatched for the NIMA haplotype or by an HLA-identical sibling. This phenomenon was not observed when kidneys were donated by a haplo-identical sibling mismatched for NIPA. An active mechanism of immune suppression would then be involved in the NIMA influence.

Although these studies and others [43–46] support the hypothesis that exposure of fetuses and neonates to NIMA has a life-long influence on the individual immune system, the cellular and molecular basis of this phenomenon remains unclear. In humans, Moretta et al. [47] showed that the stimulation of cord blood lymphocytes with paternal cells leads to the expansion of CD3+/CD8bright T cells, a phenotype associated with alloreactive CTL, while maternal cells stimulate the expansion of CD3–/CD8dim cells, a phenotype associated with NK cells. They hypothesized that tolerance is rather due to regulatory cells than to the deletion of NIMA-reactive cytotoxic cells. Recently, Andrassy et al. [33] described a NIMA effect in normal mice. More than half of the mice exposed to noninherited maternal H-2d allo-antigens tolerated H-2d-bearing heart or skin grafts much longer than control animals. Moreover, this NIMA effect would result from a profound inhibition of allo-specific T cell responses in the offspring rather than to immune deviation or deletion.

The present work addresses the question of the NIMA influence on the B cell compartment. For this purpose, we have used a BcR-Tg model that enabled us to precisely follow the NIMA-specific B cell populations. The 3-83 BcR-Tg mice are nearly monoclonal, with all B cells recognizing the H-2Kk,b antigens used as NIMA. Moreover, this model provides the possibility to test the effect of differences in NIMA binding affinities on the developing B cells.

When the offspring's B cells have a high affinity for the NIMA, a partial deletion of B cells and a modulation of the BcR in late gestation fetuses were observed. Interestingly, splenic B cells specific for NIMA showed an impaired proliferation in addition to sIgM downregulation and expressed a high level of active caspase-3, suggestive of death by BcR cross-linking-induced apoptosis. These results suggest that fetal B cells exposed to NIMA display a state of tolerance. In adult BcR-Tg mouse models, clonal deletion and anergy have been shown to be major mechanisms in establishing central [48, 49] and peripheral [37, 50] tolerance to self-antigens. In our experiments, immature and subsequently mature NIMA-specific B cells are deleted from fetal liver and spleen, suggesting that they have encountered NIMA in these different tissues. This agrees with the fact that we found maternal cells in fetal liver and spleen. Surprisingly, fetal liver B cells are deleted in NIMA-exposed animals, without any clear evidence of lower BrdU incorporation or increased caspase-3 activation. We have no explanation for this observation, except that our assays might lack the proper sensitivity or specificity required for fetal liver B cells. Previous studies have shown that deletion is more likely to occur when B cells bind multivalent membrane-bound antigens than mono or oligomeric soluble antigens [51]. This suggests that cell-borne NIMA is at least partially responsible for the deletion observed. However, we cannot exclude that soluble or membrane-associated NIMA may also play a role.

Receptor editing [39] is another major mechanism by which B cells can escape autoreactivity by changing their specificity through Ig light chain secondary rearrangements. In the present work, we found no evidence of such a mechanism, as very few idiotype-negative IgM-positive cells and no {lambda} B cells were detected. This may be due to the fact that we used Tg mice, where the transgene is not integrated in the Ig gene locus, thus preventing secondary rearrangements. Much higher frequencies of receptor editing have been shown in knock-in Tg mice [52] as well as in normal mice [53] compared with Tg mice.

As reported by Andrassy et al. [33], we have observed a significant degree of variability among NIMA-exposed fetuses and neonates. This may be a direct consequence of differences in the frequency of maternal cells gaining access to each fetus, as shown in the first part of the present study. In the 3-83 mouse model, Lang et al. [54] pointed out that the extent of clonal deletion in B cell self-tolerance is linked to the frequency of antigen encounter. Using mixed BM chimeras, they showed that deletion was complete in peripheral lymphoid organs when approximately one third of the cells expressed the antigen. With a lower frequency, the extent of the deletion was diminished, but a partial deletion was still observed in chimeric mice with antigen-bearing cell frequencies below the detection level of 0.1%. In recipients with incomplete deletion, most of the remaining idiotype-positive cells expressed reduced levels of sBcR, suggesting that they had encountered antigen. These observations are fully consistent with our results, where antigen-bearing maternal cells are very rare. Variations among individual mice have also been observed in a BcR-Tg model where B cells are autoreactive to erythrocytes [55]. Our results are also in line with the study by Claas et al. [31], where only about 50% of the patients were tolerant to NIMA and did not produce antibodies.

In contrast, when the NIMA is recognized with lower affinity by the offspring's B cells, we have observed a very different situation of B cell activation, including increased B cell numbers in bone marrow and spleen as detected by flow cytometry and section immunostaining, increased proliferation of B cells, upregulation of sIgM, expression of CD69, and invasion of T cell follicular zone by B cells in the spleen. This situation is seen only from birth. Such an activated phenotype has been observed in anti-double-strand DNA Tg B cells [56]. Consequently, the BcR affinity for the NIMA plays a major role both in the timing and quality of the response induced by the interaction. Remarkably, this situation is very different from B cell tolerance induction to self-antigens where ultralow affinity membrane-bound antigens are able to induce full central tolerance in autoreactive B cells [57].

Extrapolating from the study by Andrassy et al. [33], we would speculate that the state of tolerance induced during B cell development is likely to persist in a significant fraction of NIMA-exposed animals. On the other hand, the B cell activation triggered by low-affinity NIMA ligand might create an autoimmune-prone environment in the adult progeny [56].


   ACKNOWLEDGMENTS
 
The authors are indebted to Drs. D. Nemazee, A. Nagy, and M. Okabe for the supply of the Tg mice. They gratefully acknowledge the collaboration of S. Paturance and his staff for excellent animal care, and technical support from G. Lefèvre and M. Thomas.


   FOOTNOTES
 
1 Supported by the Ministère de l'Education Nationale, de la Recherche et de la Technologie and the Association pour la Recherche contre le Cancer. S.M.C. was supported by the Fondation pour la Recherche Médicale and the Ligue Nationale contre le Cancer. Back

2 Correspondence: Colette Kanellopoulos-Langevin, Laboratory of Immune Regulations and Development, J. Monod Institute, Tour 43, 2 place Jussieu, 75251 Paris cedex 05, France. FAX: 33 1 44275265;kanellopoulos{at}ijm.jussieu.fr Back

3 Current address: National Institute of Health, Bethesda, MD 20892 Back

Received: 11 August 2004.

First decision: 8 September 2004.

Accepted: 21 September 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bianchi DW, Flint AF, Pizzimenti MF, Knoll JH, Latt SA. Isolation of fetal DNA from nucleated erythrocytes in maternal blood. Proc Natl Acad Sci U S A 1990 87:3279-3283[Abstract/Free Full Text]
  2. Herzenberg LA, Bianchi DW, Schroder J, Cann HM, Iverson GM. Fetal cells in the blood of pregnant women: detection and enrichment by fluorescence-activated cell sorting. Proc Natl Acad Sci U S A 1979 76:1453-1455[Abstract/Free Full Text]
  3. Little MT, Langlois S, Wilson RD, Lansdorp PM. Frequency of fetal cells in sorted subpopulations of nucleated erythroid and CD34+ hematopoietic progenitor cells from maternal peripheral blood. Blood 1997 89:2347-2358[Abstract/Free Full Text]
  4. Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, Wainscoat JS, Johnson PJ, Chang AM, Hjelm NM. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998 62:768-775[CrossRef][Medline]
  5. Bianchi DW, Zickwolf GK, Weil GJ, Sylvester S, DeMaria MA. Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc Natl Acad Sci U S A 1996 93:705-708[Abstract/Free Full Text]
  6. Kuroki M, Okayama A, Nakamura S, Sasaki T, Murai K, Shiba R, Shinohara M, Tsubouchi H. Detection of maternal-fetal microchimerism in the inflammatory lesions of patients with Sjogren's syndrome. Ann Rheum Dis 2002 61:1041-1046[Abstract/Free Full Text]
  7. Evans PC, Lambert N, Maloney S, Furst DE, Moore JM, Nelson JL. Long-term fetal microchimerism in peripheral blood mononuclear cell subsets in healthy women and women with scleroderma. Blood 1999 93:2033-2037[Abstract/Free Full Text]
  8. Artlett CM, Smith JB, Jimenez SA. Identification of fetal DNA and cells in skin lesions from women with systemic sclerosis. N Engl J Med 1998 338:1186-1191[Abstract/Free Full Text]
  9. Klintschar M, Schwaiger P, Mannweiler S, Regauer S, Kleiber M. Evidence of fetal microchimerism in Hashimoto's thyroiditis. J Clin Endocrinol Metab 2001 86:2494-2498[Abstract/Free Full Text]
  10. Hunziker RD, Gambel P, Wegmann TG. Placenta as a selective barrier to cellular traffic. J Immunol 1984 133:667-671[Abstract]
  11. Shimamura M, Ohta S, Suzuki R, Yamazaki K. Transmission of maternal blood cells to the fetus during pregnancy: detection in mouse neonatal spleen by immunofluorescence flow cytometry and polymerase chain reaction. Blood 1994 83:926-930[Abstract/Free Full Text]
  12. Piotrowski P, Croy BA. Maternal cells are widely distributed in murine fetuses in utero. Biol Reprod 1996 54:1103-1110[Abstract]
  13. Zhou L, Yoshimura Y, Huang Y, Suzuki R, Yokoyama M, Okabe M, Shimamura M. Two independent pathways of maternal cell transmission to offspring: through placenta during pregnancy and by breast-feeding after birth. Immunology 2000 101:570-580[CrossRef][Medline]
  14. Lo YM, Lau TK, Chan LY, Leung TN, Chang AM. Quantitative analysis of the bidirectional fetomaternal transfer of nucleated cells and plasma DNA. Clin Chem 2000 46:1301-1309[Abstract/Free Full Text]
  15. Scaradavou A, Carrier C, Mollen N, Stevens C, Rubinstein P. Detection of maternal DNA in placental/umbilical cord blood by locus-specific amplification of the noninherited maternal HLA gene. Blood 1996 88:1494-1500[Abstract/Free Full Text]
  16. Adeniyi-Jones SC, Ozato K. Transfer of antibodies directed to paternal major histocompatibility class I antigens from pregnant mice to the developing fetus. J Immunol 1987 138:1408-1415[Abstract]
  17. Srivatsa B, Srivatsa S, Johnson KL, Bianchi DW. Maternal cell microchimerism in newborn tissues. J Pediatr 2003 142:31-35[CrossRef][Medline]
  18. Setiady YY, Samy ET, Tung KS. Maternal autoantibody triggers de novo T cell-mediated neonatal autoimmune disease. J Immunol 2003 170:4656-4664[Abstract/Free Full Text]
  19. Greeley SA, Katsumata M, Yu L, Eisenbarth GS, Moore DJ, Goodarzi H, Barker CF, Naji A, Noorchashm H. Elimination of maternally transmitted autoantibodies prevents diabetes in nonobese diabetic mice. Nat Med 2002 8:399-402[CrossRef][Medline]
  20. Hall JM, Lingenfelter P, Adams SL, Lasser D, Hansen JA, Bean MA. Detection of maternal cells in human umbilical cord blood using fluorescence in situ hybridization. Blood 1995 86:2829-2832[Abstract/Free Full Text]
  21. Lo YM, Lo ES, Watson N, Noakes L, Sargent IL, Thilaganathan B, Wainscoat JS. Two-way cell traffic between mother and fetus: biological and clinical implications. Blood 1996 88:4390-4395[Abstract/Free Full Text]
  22. Socie G, Gluckman E, Carosella E, Brossard Y, Lafon C, Brison O. Search for maternal cells in human umbilical cord blood by polymerase chain reaction amplification of two minisatellite sequences. Blood 1994 83:340-344[Abstract/Free Full Text]
  23. Sprecher S, Soumenkoff G, Puissant F, Degueldre M. Vertical transmission of HIV in 15-week fetus. Lancet 1986 2:288-289
  24. Schwartz DH, Sharma UK, Perlman EJ, Blakemore K. Adherence of human immunodeficiency virus-infected lymphocytes to fetal placental cells: a model of maternal -> fetal transmission. Proc Natl Acad Sci U S A 1995 92:978-982[Abstract/Free Full Text]
  25. Catlin EA, Roberts JD Jr, Erana R, Preffer FI, Ferry JA, Kelliher AS, Atkins L, Weinstein HJ. Transplacental transmission of natural-killer-cell lymphoma. N Engl J Med 1999 341:85-91[Free Full Text]
  26. Geha RS, Reinherz E. Identification of circulating maternal T and B lymphocytes in uncomplicated severe combined immunodeficiency by HLA typing of subpopulations of T cells separated by the fluorescence-activated cell sorter and of Epstein Barr virus-derived B cell lines. J Immunol 1983 130:2493-2495[Abstract]
  27. Knobloch C, Goldmann SF, Friedrich W. Limited T cell receptor diversity of transplacentally acquired maternal T cells in severe combined immunodeficiency. J Immunol 1991 146:4157-4164[Abstract]
  28. Maloney S, Smith A, Furst DE, Myerson D, Rupert K, Evans PC, Nelson JL. Microchimerism of maternal origin persists into adult life. J Clin Invest 1999 104:41-47[Medline]
  29. Artlett CM, Ramos R, Jiminez SA, Patterson K, Miller FW, Rider LG. Chimeric cells of maternal origin in juvenile idiopathic inflammatory myopathies. Childhood Myositis Heterogeneity Collaborative Group. Lancet 2000 356:2155-2156[CrossRef][Medline]
  30. van Rood JJ, Claas F. Both self and non-inherited maternal HLA antigens influence the immune response. Immunol Today 2000 21:269-273[CrossRef][Medline]
  31. Claas FH, Gijbels Y, van der Velden-de Munck J, van Rood JJ. Induction of B cell unresponsiveness to noninherited maternal HLA antigens during fetal life. Science 1988 241:1815-1817[Abstract/Free Full Text]
  32. Burlingham WJ, Grailer AP, Heisey DM, Claas FH, Norman D, Mohanakumar T, Brennan DC, de Fijter H, van Gelder T, Pirsch JD, Sollinger HW, Bean MA. The effect of tolerance to noninherited maternal HLA antigens on the survival of renal transplants from sibling donors. N Engl J Med 1998 339:1657-1664[Abstract/Free Full Text]
  33. Andrassy J, Kusaka S, Jankowska-Gan E, Torrealba JR, Haynes LD, Marthaler BR, Tam RC, Illigens BM, Anosova N, Benichou G, Burlingham WJ. Tolerance to noninherited maternal MHC antigens in mice. J Immunol 2003 171:5554-5561[Abstract/Free Full Text]
  34. Marleau AM, Greenwood JD, Wei Q, Singh B, Croy BA. Chimerism of murine fetal bone marrow by maternal cells occurs in late gestation and persists into adulthood. Lab Invest 2003 83:673-681[Medline]
  35. Okabe M, Ikawa M, Kominami K, Nakanishi T, Nishimune Y. ‘Green mice’ as a source of ubiquitous green cells. FEBS Lett 1997 407:313-319[CrossRef][Medline]
  36. Hadjantonakis AK, Gertsenstein M, Ikawa M, Okabe M, Nagy A. Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mech Dev 1998 76:79-90[CrossRef][Medline]
  37. Russell DM, Dembic Z, Morahan G, Miller JF, Burki K, Nemazee D. Peripheral deletion of self-reactive B cells. Nature 1991 354:308-311[CrossRef][Medline]
  38. Sandel PC, Monroe JG. Negative selection of immature B cells by receptor editing or deletion is determined by site of antigen encounter. Immunity 1999 10:289-299[CrossRef][Medline]
  39. Tiegs SL, Russell DM, Nemazee D. Receptor editing in self-reactive bone marrow B cells. J Exp Med 1993 177:1009-1020[Abstract/Free Full Text]
  40. Min B, McHugh R, Sempowski GD, Mackall C, Foucras G, Paul WE. Neonates support lymphopenia-induced proliferation. Immunity 2003 18:131-140[CrossRef][Medline]
  41. Ichii H, Sakamoto A, Hatano M, Okada S, Toyama H, Taki S, Arima M, Kuroda Y, Tokuhisa T. Role for Bcl-6 in the generation and maintenance of memory CD8+ T cells. Nat Immunol 2002 3:558-563[CrossRef][Medline]
  42. Arvola M, Gustafsson E, Svensson L, Jansson L, Holmdahl R, Heyman B, Okabe M, Mattsson R. Immunoglobulin-secreting cells of maternal origin can be detected in B cell-deficient mice. Biol Reprod 2000 63:1817-1824[Abstract/Free Full Text]
  43. Smits JM, Claas FH, van Houwelingen HC, Persijn GG. Do noninherited maternal antigens (NIMA) enhance renal graft survival?. Transpl Int 1998 11:82-88[CrossRef][Medline]
  44. van Rood JJ, Loberiza FR Jr, Zhang MJ, Oudshoorn M, Claas F, Cairo MS, Champlin RE, Gale RP, Ringden O, Hows JM, Horowitz MH. Effect of tolerance to noninherited maternal antigens on the occurrence of graft-versus-host disease after bone marrow transplantation from a parent or an HLA-haploidentical sibling. Blood 2002 99:1572-1577[Abstract/Free Full Text]
  45. Bishara A, Sherman L, Raizman S, Popovtzer M, Brautbar C. Negative response to noninherited maternal antigens confirmed by ELISA. Transplant Proc 1999 31:1879-1880[CrossRef][Medline]
  46. Tsafrir A, Brautbar C, Nagler A, Elchalal U, Miller K, Bishara A. Alloreactivity of umbilical cord blood mononuclear cells: specific hyporesponse to noninherited maternal antigens. Hum Immunol 2000 61:548-554[CrossRef][Medline]
  47. Moretta A, Locatelli F, Mingrat G, Rondini G, Montagna D, Comoli P, Gandossini S, Montini E, Labirio M, Maccario R. Characterisation of CTL directed toward non-inherited maternal alloantigens in human cord blood. Bone Marrow Transplant 1999 24:1161-1166[CrossRef][Medline]
  48. Nemazee DA, Burki K. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes. Nature 1989 337:562-566[CrossRef][Medline]
  49. Goodnow CC, Crosbie J, Adelstein S, Lavoie TB, Smith-Gill SJ, Brink RA, Pritchard-Briscoe H, Wotherspoon JS, Loblay RH, Raphael K, Trent RJ, Basten A. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 1988 334:676-682[CrossRef][Medline]
  50. Goodnow CC, Crosbie J, Jorgensen H, Brink RA, Basten A. Induction of self-tolerance in mature peripheral B lymphocytes. Nature 1989 342:385-391[CrossRef][Medline]
  51. Hartley SB, Crosbie J, Brink R, Kantor AB, Basten A, Goodnow CC. Elimination from peripheral lymphoid tissues of self-reactive B lymphocytes recognizing membrane-bound antigens. Nature 1991 353:765-769[CrossRef][Medline]
  52. Pelanda R, Schwers S, Sonoda E, Torres RM, Nemazee D, Rajewsky K. Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification. Immunity 1997 7:765-775[CrossRef][Medline]
  53. Melamed D, Nemazee D. Self-antigen does not accelerate immature B cell apoptosis, but stimulates receptor editing as a consequence of developmental arrest. Proc Natl Acad Sci U S A 1997 94:9267-9272[Abstract/