Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print October 20, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.035006
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/2/470    most recent
biolreprod.104.035006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.
Agricola
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.
BIOLOGY OF REPRODUCTION 72, 470–478 (2005)
DOI: 10.1095/biolreprod.104.035006
© 2005 by the Society for the Study of Reproduction, Inc.

Seasonal Changes in Mesotocin and Localization of Its Receptor in the Prostate of the Brushtail Possum (Trichosurus vulpecula)

Jo W. Fink2, Bernie J. McLeod3, Stephen J. Assinder2, Laura J. Parry4, and Helen D. Nicholson1,2

Department of Anatomy and Structural Biology,2 Otago School of Medical Sciences, University of Otago, Dunedin, New Zealand AgResearch Invermay,3 Mosgiel, New Zealand Department of Zoology,4 University of Melbourne, Parkville, Victoria 3010, Australia


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The prostate gland in the brushtail possum grows and regresses seasonally. It has similarities to the human prostate and may therefore provide a unique model for investigating prostatic hyperplasia. Oxytocin has been implicated in the regulation of prostate growth in eutherian mammals, and the initial aim of this study was to identify and localize the marsupial equivalent, mesotocin, and its receptor in the prostate of the brushtail possum. Seasonal changes in prostatic mesotocin concentrations and receptor localization were then assessed and related to prostate growth. Mesotocin and mesotocin receptor gene transcripts with high sequence homology to eutherian oxytocin/oxytocin receptors were demonstrated, and mesotocin, neurophysin, and the receptor were all localized predominantly in the epithelial cells of the glandular acini. Western blot analysis confirmed the presence of a single immunoreactive receptor protein of ~60 Mr–3. Prostatic mesotocin concentrations were highest immediately before the increases in prostate weight associated with the autumn and spring breeding periods. At this time, mesotocin receptors were also present in the prostatic capsule in addition to those present in the glandular tissue. Mesotocin concentrations proceeded to decrease in association with the regression of prostate size toward the end of the breeding periods. No significant differences were present in serum testosterone or dihydrotestosterone throughout the year. The identification of mesotocin and its receptor in the possum prostate and the demonstration of seasonal changes in local mesotocin concentrations preceding changes in prostate size suggests that mesotocin may play a physiological role in regulating prostate growth and regression.

male reproductive tract, oxytocin, prostate, seasonal reproduction, testosterone


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Oxytocin is well known for its roles in milk let down and parturition in the female, but it has also been implicated in reproductive functions in the male. In the prostate of eutherian mammals, oxytocin has been implicated in growth of the gland. For example, administration of exogenous oxytocin increases epithelial height [1] and the size of the prostate by increasing the volume and stimulating mitosis of the epithelial cells that line the glandular acini [24]. These effects may be due to a direct action of oxytocin or related to its effects on androgen metabolism [5]. In the prostate, oxytocin stimulates activity of the enzyme 5{alpha}-reductase, resulting in increased concentrations of dihydrotestosterone [5], which is the major bioactive androgen in the prostate and is responsible for growth and secretory activity. In addition to prostatic growth, oxytocin also increases prostatic tone and contractility [6] and may be involved in the contraction of the prostate at ejaculation [7, 8].

Local synthesis of oxytocin in the human prostate has been demonstrated by the identification of oxytocin mRNA [8] and the presence of immunoreactive oxytocin [5]. The oxytocin receptor has been localized to the epithelial cells and stromal tissue of the primate prostate [9, 10]. Concentrations of oxytocin are higher in the prostate than in the peripheral circulation [5] and are modulated by gonadal steroids [11]. In the rat, both testosterone and dihdyrotestosterone decrease oxytocin concentrations, whereas estrogen has a stimulatory role [11]. This provides a feedback mechanism that may regulate dihydrotestosterone concentrations and thereby prostatic growth. In prostatic tissue from men with hyperplastic prostate disease, the regulation of prostatic oxytocin differs from that in healthy individuals, with androgens and estrogens both promoting oxytocin secretion [12].

Benign prostatic hyperplasia is a common disease that affects more than 50% of men over the age of 60. Studies of the regulation of prostatic hyperplasia are constrained by limited access to suitable animal models that display this phenomenon [13], particularly to species where the anatomy of male reproductive organs is similar to that in man [14]. However, an Australian marsupial, the common brushtail possum (Trichosurus vulpecula) has a prostate that bears some anatomical similarities to that in man, including having discrete zones, the anterior, central, and posterior regions, which completely encircle the urethra. Furthermore, the possum prostate undergoes seasonal changes in size in accordance with periods of breeding in females [1517]. These marked seasonal changes in prostate growth and regression suggest that the possum may be a unique model for investigating the regulation of prostate growth.

Possums and most other marsupials produce the pituitary peptide hormone mesotocin rather than the eutherian counterpart oxytocin. Mesotocin differs from oxytocin by the substitution of a single amino acid, isoleucine, for leucine at position 8. Mesotocin has been shown to be present in the Leydig cells of the possum testes [18, 19], but a receptor for the hormone has not yet been identified in the male reproductive tract [20]. However, in the tammar wallaby prostate, a mesotocin receptor with high sequence homology to the eutherian oxytocin receptor has been identified [21]. This receptor has a similar distribution to that seen in the primate prostate for oxytocin receptor, being present in the outer stromal capsule and the glandular epithelial cells [21].

The aims of this study were to establish if a mesotocin receptor and its ligand are present in the possum prostate and to investigate if seasonal changes in prostate growth are associated with differences in the concentration of mesotocin and/or localization of its receptor.


    MATERIAL AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Collection

Prostate tissue was collected from wild-captured, adult male possums that were housed as groups at the Invermay AgResearch facility at Mosgiel, New Zealand [22]. Samples were collected in every month of the year to include both the breeding and nonbreeding seasons [17, 23]. The autumn breeding period encompasses the months of April, May, and June; the spring breeding period, September and October; and the nonbreeding period, December, January, and February. Only animals that were sexually mature, weighing more than 2 kg [16], and displaying full spermatogenesis, as determined by histological analysis of testis sections, were included in the study. Approximately 6 ml of whole blood was obtained by intracardiac puncture, and animals were killed with an intracardiac injection of barbiturate (Euthal, Delta Veterinary Laboratories, Hornsby, NSW, Australia) while under halothane-induced anesthesia between 0830 and 1200 h. The prostate, testes, and epididymides were dissected immediately following death and weighed. The prostate was divided into central and posterior regions [24], and portions of each prostate region and the testes and epididymides were either snap frozen in liquid nitrogen or fixed in 10% neutral buffered formalin or modified Bouin fluid before paraffin embedding for histological examination and/or immunohistochemistry. The small anterior region of the prostate was not included in this study. Capture, housing, and the killing of these animals had been given prior approval by the AgResearch Invermay Animal Ethics Committee in accordance with the Animal Welfare Act, 1999.

Mesotocin and Mesotocin Receptor Gene Expression

A partial sequence of the possum mesotocin gene was first obtained using total RNA (2 µg) extracted from the hypothalamus of a male possum to generate cDNA template from random hexamers by reverse transcription using Multiscribe Reverse Transcriptase (Applied Biosystems, NJ) according to the recommendations of the manufacturer. Two microliters of the reverse transcription reaction was used in a polymerase chain reaction (PCR) using AmpliTaq Gold PCR Master Mix (Applied Biosystems) and tammar wallaby mesotocin-specific primers (forward, 5' ATCCTGGTCTCGCCTGCTG; and reverse, 5' ACGGCGAGGACAGGTAGCTC), which span the exon 1-intron 2-exon 2 boundaries of the mesotocin gene [25]. The PCR conditions comprised a 2-min denaturation at 95°C, followed by 45 cycles of 30 sec each of 92°C, 58°C, and 72°C. A single PCR product of approximately 250 base pairs (bp) was obtained and purified using the High Pure PCR product purification kit (Roche, Mannheim, Germany) for sequence analysis. This procedure was subsequently used to identify mesotocin transcripts in both the central and posterior regions of the possum prostate. However, it was necessary to dilute the first PCR reaction 100-fold with sterile dH20 to use as a template for a second nested PCR amplification using the internal tammar-specific primers 5' CAGAACTGCCCCATTGGTG and 5' TCGGTGGTGCCCAAGTAG to generate an amplicon.

A similar approach was taken to obtain sequence data for the possum mesotocin receptor. Total RNA was extracted from possum prostate and 5 µg used to generate cDNA with 0.5 µg/µl random hexamers and Superscript II RNase H reverse transcriptase (Invitrogen, Mulgrave, Victoria, Australia) in a total volume of 20 µl. Two microliters of the cDNA template were used in a touchdown PCR reaction (annealing temperatures 65– 55°C) with 0.2 U Taq DNA polymerase (Promega, Annandale, NSW, Australia) and 100 ng/µl oligonucleotide primers (forward primer, 5' ACCTGGTGGCAGTGTTTCAGGT or 5' TCGTCAAGTATCTGCAGGTGG; and reverse, 5' AAGAAGAAAGGCGTCCAGC). These correspond to highly conserved regions in exon 2 of the human and bovine oxytocin-receptor sequences [26, 27] and were used previously to obtain the tammar wallaby mesotocin-receptor sequence [21]. PCR products were separated on 1.8% Tris-borate-EDTA-agarose gels, visualized with ultraviolet light after ethidium bromide staining. Bands of the correct size were subcloned for sequencing as described previously [21].

Western Blot Analysis

Western blot analysis was performed to determine the presence of the mesotocin receptor and neurophysin, a component of the mesotocin precursor protein. Mesotocin itself cannot be identified due to the small size of the peptide. However, neurophysin, which is part of the same precursor complex, can be visualized.

Tissue extracts of central and posterior prostate were prepared by homogenizing 0.5 g of tissue in 2 ml PBS (154 mmol/L NaCl, 1.9 mmol/L NaH2PO4, 8.1 mmol/LNa2HPO4, pH 7.2) containing complete mini-protease-inhibitor cocktail tablets (Boehringer Mannheim) at the concentration recommended by the manufacturer. One hundred micrograms of total protein were mixed with SDS reducing buffer 1:1 (w/v) (62.5 mmol/L Tris, pH 6.8, 2% [w/v] SDS, 10% [v/v] glycerol, 100 mmol/L dithiothreitol, 0.05% [w/v] bromophenol blue) and denatured by incubation in a boiling water bath for 10 min. Proteins were separated according to size by SDS-PAGE under reducing conditions on 10% or 15% 24:1 bis-acrylamide gels for mesotocin receptor and neurophysin, respectively, and electroblotted onto polyvinylidene difluoride (Roche Diagnostics, Mannheim, Germany). Blots were blocked with PBS containing 0.02% (v/v) Tween 20 and 10% (w/v) nonfat milk powder for 1 h, washed for 1 h with PBS containing 0.02% (v/v) Tween 20 before incubation with primary antisera for 1 h at room temperature. Antiserum 020 was raised against a synthetic peptide, WQNLRLKTAAAA, from the predicted amino acid sequence of the third intracellular loop of the oxytocin receptor [28, 29] (diluted 1:1500 in PBS containing 0.02% [v/v] Tween 20 and 3% [w/v] nonfat milk powder). Anti-human neurophysin serum (anti-hNp1) [30] was diluted 1:2000 in PBS containing 0.02% (v/v) Tween 20 and 3% (w/v) nonfat milk powder. Membranes were washed for 1 h in frequent changes of PBS plus 0.02% (v/v) Tween 20 and then incubated with peroxidase-conjugated swine anti-rabbit IgG (DAKO, Carpintera, CA) at a 1:2000 dilution in PBS plus 0.02% (v/v) Tween 20 and 3% (w/v) nonfat milk powder for 1 h at room temperature. After further washing for 1 h in frequent changes of PBS plus 0.02% (v/v) Tween 20, detection of the bound antibody was achieved by chemiluminescence (POD, Roche Diagnostics, Mannheim, Germany) and exposure to Hyperfilm (Amersham, Buckinghamshire, England). Possum uterus was used as a positive-control tissue for antiserum 020 [31] and both human (NIDDK) and bovine oxytocin-associated neurophysin peptides [32] as positive-control samples for neurophysin.

Immunohistochemistry

Immunohistochemistry to determine the cellular localization of mesotocin, neurophysin, and its receptor, was performed on 5-µm sections of central and posterior prostate. Sections from at least two animals were examined in the months of February, March, April, May, June, August, and November.

Mesotocin

Sections were dewaxed in xylene, rehydrated through alcohol, and washed in Tris-buffered saline (25 mmol/L Tris, 0.15 mol/L sodium chloride, pH 7.6). This was followed by two 30-min washes in Tris-buffered saline containing 0.5% (v/v) Triton-X100 and one 30-min wash in Tris-buffered saline containing 0.5% (v/v) Triton-X100 and 3% (w/v) BSA. Endogenous biotin was blocked by incubation with avidin for 20 min, followed by incubation with biotin for 20 min (Avidin/biotin blocking kit; Vector Laboratories, Burlingame, CA). Sections were then rinsed in Tris-buffered saline before incubation for 1 h at room temperature and then overnight at 4°C with serum 86/4, raised in the Department of Anatomy at the University of Bristol, UK, against mesotocin coupled to thyroglobulin (diluted 1:100 in Tris-buffered saline containing 0.5% [v/v] Triton-X100 and 3% [w/v] BSA). Control sections were incubated with normal rabbit serum diluted to the same total protein concentration as the primary antibody. Sections were rinsed in Tris-buffered saline containing 0.5% (v/ v) Triton-X100 and incubated with biotinylated anti-rabbit IgG (LSAB2 system HRP kit; DAKO) for 1 h. The sections were rinsed twice in Tris-buffered saline for 20 min and incubated with streptavidin HRP (LSAB2 system HRP kit; DAKO) for 30 min. The sections were rinsed for 20 min in Tris-buffered saline three times and twice for 15 min in 25 mmol/L Tris (pH 7.6). Immunoreactive peptide was visualized using Fast DAB (diaminobenzidine; Sigma, St. Louis, MO). Sections were counterstained in hemotoxylin, dehydrated, and coverslipped with distrene dibutyl phthalate xylene. Possum pituitary and possum testes tissues were included as positive controls [19, 33].

Mesotocin Receptor and Neurophysin

A high-temperature antigen-retrieval step was included following rehydration of the sections. Sections were boiled in a microwave on high power for 10 min in EDTA (1 mmol/L, pH 8.0). After cooling for 15 min, the sections were stained using the same protocol described above for mesotocin. Antiserum 020 [29] diluted to 1:75 in Tris-buffered saline containing 0.5% (v/v) Triton-X100 and 3% (w/v) BSA was used to identify mesotocin receptor. Sections of rat uterus were included as positive controls. For neurophysin, serum anti-hNp1 was diluted 1:100 in Tris-buffered saline containing 0.5% (v/v) Triton-X100 and 3% (w/v) BSA. Sections of possum pituitary were used as positive controls.

Measurement of Mesotocin by Radioimmunoassay

Prostate tissues were extracted and concentrated by homogenizing in 10 ml/g (wet weight) acid extraction medium (1 mol/L HCl containing 1% [w/v] NaCl, 5% [v/v] formic acid, and 15% [v/v] trifluoroacetic acid). Samples were incubated overnight at 4°C, centrifuged at 4000 x g and the supernatants further purified by passing through octadecylsilica cartridges (Sep-pak cartridges; Waters, MA) using a method previously described [34]. Plasma samples (1.5–2.5 ml) were acidified with 50 µl 0.1 M HCl before purification with octadecylsilica cartridges. In some animals, there was insufficient plasma and/or tissue available to measure mesotocin concentrations as, samples had previously been used for reverse transcription-PCR (RT-PCR) and other hormone assays (unpublished work).

Mesotocin was measured in extracted plasma and prostate tissue by a specific radioimmunoassay using antiserum 86/4 [35], the validity of which was shown by the ability of samples to dilute in parallel with the standard curve (data not shown). Cross-reaction with oxytocin was <0.36% and with arginine vasopressin <0.001%. Mesotocin was iodinated using the chloramine T method [36]. The limit of detection of the assay was 30 pg/ml and the interassay coefficient of variation was 13%.

Measurement of Testosterone and Dihydrotestosterone by Radioimmunoassay

Testosterone and dihydrotestosterone (DHT) were extracted from plasma samples using diethyl ether. Testosterone was measured using antiserum 85/6 (raised in the Department of Anatomy, University of Bristol) in a radioimmunoassay as described by Yeung [37]. The antiserum cross-reacted ~20% with DHT. The limit of detection of the assay was 100 pg/ ml, and the interassay variation was 13%.

Extracted DHT samples were oxidized with 50 mmol/L KMnO4 and extracted further with diethyl ether before concentrations were determined using radioimmunoassay. Samples were diluted in Tris buffer (50 mmol/ L Tris, 4 mmol/L EDTA disodium salt, 0.1% [w/v] gelatin, pH 8.0) and assayed in triplicate. Diluted sample (100 µl) or serially diluted authentic DHT for the standard curve were incubated overnight at 4°C with 100 µl of antiserum (85/6, 1:46 000) and 100 µl of 5{alpha}-dihydro[1,2,4,5,6,7-3H]testosterone (10 000 cpm; Amersham, Buckinghamshire, England). The assay was incubated with 200 µl of dextran-coated charcoal in Tris buffer (250 mg/ml activated charcoal and 100 mg/ml dextran) for 15 min at 4°C before separation by centrifugation at 4000 x g for 30 min at 4°C. The radioactive supernatants were measured by liquid scintillation counting. The antiserum cross-reacted ~55% with testosterone. However, when the testosterone content of the oxidized samples was measured, no immunoreactive testosterone could be detected, confirming the efficacy of the reaction. The limit of detection of the assay was 200 pg/ml, and the interassay variation was 12%.

Statistical Analysis

Data are presented as mean ± SEM. Differences between groups (month of tissue collection) were determined by single-classification analysis of variance. March and August, the months immediately before the recognized female breeding periods, were compared with the breeding (autumn, April, May and June; spring, September, October) and nonbreeding (December, January, and February) periods as groups by post hoc comparison of means by Bonferroni corrected t-test, furnished by GraphPad Prism 4.0 software (GraphPad Software Inc., San Diego, CA). The significance level was set at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostate Weight and Morphology

Prostate weights varied significantly (ANOVA, P < 0.01) throughout the year, with two peaks occurring immediately before and encompassing the first half of each of the breeding periods (Fig. 1). No significant differences were found in the prostate weights present in March and August compared with the autumn and spring breeding periods they immediately precede. However, the weights in both March and August were significantly higher than in the nonbreeding period (t-test, P < 0.01).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Mean prostate weight/body weight (± SEM) in the sample groups throughout the year. The autumn and spring breeding periods are shown by the darkly shaded regions and the nonbreeding period by the lightly shaded region. Neither March nor August were significantly different from their respective breeding periods, although they were both significantly different (P < 0.01) from the nonbreeding period. Numbers of samples in each group are shown in parentheses

Histological examination of prostate tissue sampled throughout the year revealed seasonal changes in the size of the glandular tubules and acini. The glandular tissue comprises the majority of both the central and posterior regions of the prostate. This tissue is surrounded by an outer muscular capsule. When the prostate glands were enlarged, there was also an increase in the mass of the glandular tissue (data not shown). The lumina of the acini bordering the periurethral areas were larger in the breeding season (Fig. 2a) than in prostates collected in the nonbreeding season (Fig. 2b), when more stromal tissue appeared to be present between the glands. In addition, the tubules in the glandular areas were wider in the larger, breeding-season prostates (Fig. 2c) than in those from the nonbreeding season (Fig. 2d).



View larger version (125K):
[in this window]
[in a new window]
 
FIG. 2. Hematoxylin and eosin-stained prostate sections of the acini bordering the periurethral region in (a) March and (b) December, and the elongated acini in the glandular region in (c) March and (d) December showing the difference in acini size and the component of stromal tissue. Bar = 50 µm

There were no significant differences in the mean body weights of the animals throughout the year. In addition, no significant differences were observed in the mean weights of testes or epididymides (data not shown).

Mesotocin and Receptor Gene Expression

Nucleotide sequence analysis of PCR products obtained by RT-PCR with male hypothalamic cDNA using mesotocin-specific primers produced a consensus sequence of 246 bp (GenBank accession number AY534739). The derived amino acid sequence extended from the end of the signal peptide and included the nonapeptide region, with an additional 53 amino acids of the neurophysin. This sequence was 91% homologous with the equivalent region of the tammar wallaby mesotocin gene [25] and is more similar to eutherian oxytocin precursors than lower vertebrate mesotocin, isotocin, or vasotocin precursors. Confirmation that the possum produces mesotocin, rather than oxytocin, was evident in the nonapeptide region with an isoleucine residue replacing the leucine at position 8. The possum neurophysin molecule is similar in structure to all other known oxytocin-associated neurophysins, with highly conserved glycine, cysteine, and proline residues. The initial RT-PCR strategy failed to produce a mesotocin gene transcript in the possum prostate. However, a nested PCR of the original PCR products generated a single 146-bp amplicon, which was identical in sequence to the mesotocin transcript present in the male hypothalamus. Subsequent reactions confirmed the presence of mesotocin transcripts in both the central and posterior possum prostate (Fig. 3a).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 3. a) Mesotocin transcripts were detected in hypothalamus (lane 1) but not prostate (lane 2) with the F1R1 primers. Nested PCR with the F2R2 primers was able to detect transcripts in hypothalamus (lane 3) and prostate (lanes 4 and 5). However, no transcripts were visible in the PCR reactions, where non-reverse-transcribed template (lane 6) and water (lane 7) replaced the cDNA template. M, 100-bp DNA marker. b) Mesotocin receptor transcripts were obtained in the prostate using two different forward primers, resulting in PCR products of approximately 580 (lane 1) and 600 bp (lane 2). No product was detected when the cDNA template was replaced with water (lane 3). M, 100-bp DNA marker

The possum prostate also expresses a mesotocin receptor gene transcript (Fig. 3b). Two forward primers were used, resulting in PCR products of variable size (580 and 600 bp). Both fragments were sequenced and produced a consensus nucleotide sequence of 570 bp (GenBank accession number AY265415), which was shown to encode a peptide of 189 amino acids. This derived amino acid sequence has 92% homology to the equivalent region of the tammar wallaby mesotocin receptor [21] and 76–80% homology to the region extending from the second to the sixth putative transmembrane domain of the eutherian oxytocin receptor. Similar to the tammar wallaby mesotocin receptor is the identification of highly conserved regions in the III transmembrane domain and in the first and second extracellular loops.

Mesotocin Receptor and Neurophysin Protein Expression

Western blot analyses with receptor antiserum 020 showed the presence of an ~60 Mr–3 immunoreactive protein in both central and posterior prostate homogenates in all months of the year (Fig. 4a). A similar sized immunoreactive band was observed in the possum uterus positive-control tissue.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 4. a) Western blot analysis of prostate extracts incubated with receptor antiserum 020. Possum uterus was used as a positive control (lane 1). Immunoreactivity was present in both posterior (lanes 2 and 3) and central prostate (lanes 4 and 5). b) Western blot analysis of prostate extracts incubated with anti-hNp1. Bovine neurophysin was used as a positive control (lane 1). Immunoreactivity was present in both central (lane 2) and posterior prostate (lane 3)

Similarly, analysis with the anti-hNp1 showed the presence of a single ~15 M–3 immunoreactive band in the central and posterior prostate homogenates. This protein was slightly larger than that seen with the bovine oxytocin-neurophysin peptide (Fig. 4b).

Localization of the Mesotocin Receptor, Mesotocin, and Neurophysin

Immunoreactivity for the mesotocin receptor, mesotocin, and neurophysin was present in all of the central and posterior prostate sections examined.

In the glandular region of the prostate, mesotocin receptor immunoreactivity was present in all of the epithelial cells of the glandular tissue (Fig. 5, a and b). In the cells associated with the basement membrane and in the stromal tissue between the acini, some sporadic immunoreactivity was also present. In the outer muscular layer of the prostate gland, receptor immunoreactivity was present in all animals examined from March, April, and May (n = 5; Fig. 5c) but appeared absent in all animals examined in February and November (n = 8; Fig. 5d), with the exception of the central prostate from a single animal collected in February. In samples collected from June and August, immunoreactivity was present in 2 out of 3 animals.



View larger version (143K):
[in this window]
[in a new window]
 
FIG. 5. Immunohistochemical localization of mesotocin receptor, mesotocin, and neurophysin. Mesotocin-receptor immunoreactivity with antiserum 020 in glandular tissue from the (a) central and (b) posterior prostate and the outer capsule from (c) March and (d) February. Mesotocin immunoreactivity with antiserum 86/4 in glandular tissue from the (e) central and (f) posterior prostate. Neurophysin immunoreactivity with anti-hNp1 in glandular tissue from the (g) central and (h) posterior prostate. i) Mesotocin immunoreactivity in the outer muscular capsule. Immunoreactivity in the positive control tissues (j) rat uterus and (k) possum testis. l) Negative control section in which the incubation with primary antiserum was replaced with normal rabbit serum. Bar = 50 µm

For both mesotocin and neurophysin, immunoreactivity was present predominantly in the epithelial cells of the glands and acini in both the central and posterior prostate throughout the year (Fig. 5, e–h) and was not prevalent in the outer capsule (Fig. 5i). No notable seasonal differences in distribution were evident.

Immunoreactivity for the mesotocin receptor was present in the endometrial glands of the rat uterus control tissue (Fig. 5j) and for mesotocin and neurophysin (data not shown) in the Leydig cells of the possum testis (Fig. 5k). None of the sections incubated with normal rabbit serum in place of primary antiserum exhibited positive immunoreactivity (Fig. 5l).

Seasonal Changes in Mesotocin in Plasma and Prostate

Immunoreactive mesotocin was detected in the plasma (Fig. 6a) and central and posterior regions of the prostate (Fig. 6, b and c). The concentration of plasma mesotocin ranged from 5 pg/ml to 79 pg/ml and differed significantly between sample groups (ANOVA P < 0.01). Plasma mesotocin concentrations in March were significantly higher than in the autumn breeding period (t-test, P < 0.05). August plasma concentrations were not significantly different from the spring breeding period or the nonbreeding period. The concentrations of mesotocin in the prostate tissues ranged from 6 to 303 pg/g. Prostatic concentrations of mesotocin also differed significantly throughout the year (central prostate ANOVA, P < 0.01 [data from July excluded as n = 1]; posterior prostate ANOVA, P < 0.05). A similar pattern in the concentration of mesotocin was evident in both the central and posterior prostate, and the two regions did not differ significantly from each other. Concentrations peaked in March, which in the central and posterior prostate were significantly different from the autumn breeding period (t-test, P < 0.01 and P < 0.05, respectively) and from the nonbreeding period (t-test, P < 0.01). A second increase in mesotocin concentration occurred in August in both the central and posterior prostate, which was significantly different from the spring breeding period (t-test, P < 0.01) and the nonbreeding period (t-test, P < 0.05).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6. Mean concentrations (± SEM) of mesotocin (MT) in (a) plasma and (b) central and (c) posterior prostate extracts throughout the year. a) Plasma concentration in March was significantly higher (P < 0.05) than during the autumn breeding period. No differences existed between August and the spring breeding period or with the nonbreeding period. b) Central prostate concentrations were significantly higher (P < 0.01) in both March and August than their respective breeding periods, in addition to the nonbreeding period (March, P < 0.01; August, P < 0.05). c) Posterior prostate concentrations were also significantly higher in March (P < 0.05) and August (P < 0.01) than their respective breeding periods, in addition to the nonbreeding period (March, P < 0.01; August, P < 0.05). Numbers of samples in each group are shown in parentheses

Seasonal Changes in Testosterone and DHT in Plasma and Prostate

The concentrations of both testosterone and DHT in the plasma were highly variable within each sample month. Although differences in concentration throughout the year were apparent, these were not significant (ANOVA). Plasma testosterone ranged from 0.2 to 9.2 ng/ml (Fig. 7a), and plasma DHT from 0.8 to 80.0 ng/ml (Fig. 7b).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 7. Mean concentrations (± SEM) of (a) testosterone and (b) DHT in plasma extracts throughout the year. No significant differences were present. Numbers of samples in each group are shown in parentheses


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we have obtained partial cDNA nucleotide sequences of mesotocin and its putative receptor in the brushtail possum. The mesotocin sequence shows high homology to mesotocin in another marsupial, the tammar wallaby, and to oxytocin in eutherian mammals. The putative receptor sequence extending from the II to the VI putative transmembrane domain also shows high homology to the wallaby and eutherian oxytocin receptors. The specific amino acids in the various regions of the eutherian receptor that have been determined to be important in biological activities, such as receptor binding and activation [38], are also highly conserved in the possum receptor. While variation in amino acids is present in the third intracellular loop, the region involved with G-protein coupling, there was homology in the area encoding the sequence of the synthetic peptide that had been used to raise the 020 antiserum employed in this study.

RT-PCR of prostate RNA demonstrated that both mesotocin and mesotocin receptor genes are actively expressed in the possum prostate and Western analysis confirmed the presence of the translated peptides. Concentrations of mesotocin in the possum prostate are of a similar order of magnitude to those described for oxytocin in the rat and human prostates [11, 39] and were greater than those found in the plasma. Similarly, plasma concentrations of mesotocin were comparable with those measured previously in the possum [40]. Immunoreactive mesotocin and its associated neurophysin were identified in both the central and posterior regions of the prostate, and in both regions the two components of the mesotocin precursor were localized mainly to the epithelial cells of the glandular tissue. This is similar to the localization of oxytocin in the human prostate [41]. The presence of mesotocin mRNA in the possum prostate and both mesotocin and its associated neurophysin in the same cell type demonstrates the local production of the hormone in the prostate. In another marsupial species, the bandicoot, both oxytocin and mesotocin have been identified in the prostate [42]. In agreement with other authors [18, 40], we were unable to detect immunoreactive oxytocin by either immunoassay or immunohistochemistry in any of the possum prostatic tissues (data not shown).

Western analysis for the receptor showed a protein of ~60 Mr–3, a size similar to that described for the oxytocin receptor in the rat [43], ram [29], and primate [9]. Immunoreactive receptor protein was localized predominantly to the glandular epithelial cells, although, in the breeding season, immunoreactivity was also identified in the smooth-muscle cells of the capsule. This is similar to the localization of mesotocin receptor mRNA in the wallaby and oxytocin receptor protein in the eutherian prostate [9, 10, 41].

In the rodent, oxytocin appears to stimulate both mitosis and growth of the prostatic epithelial cells [24]. The localization of both mesotocin and its receptor in the epithelial cells of the possum prostate raises the possibility of a similar autocrine role in this marsupial species. Oxytocin also increases prostatic contractility in eutherian mammals [6]. The presence of mesotocin receptors on the smooth-muscle cells of the prostatic capsule during the breeding season, suggests that mesotocin may also play a role in contraction of the gland during ejaculation, as has been suggested for oxytocin in other species [8].

As in previous studies, mean prostatic weights were highest during the months of March–May, with a second peak in August–September, and lowest over the summer months of January and February. The initial increases in prostate weight occur just before, and presumably in preparation for, the estimated mating period with female animals. In this Otago possum population, 50% of successful matings occur in the autumn breeding period and 25% in the spring breeding period (B.J.M. and E.G. Thompson, unpublished data). This may be reflected in the relatively shorter duration and smaller peak in prostate weight associated with the spring breeding period in this study, compared with that associated with the major autumn breeding period.

Prostatic mesotocin concentrations also change with respect to the breeding periods, increasing before the breeding period and declining before the nonbreeding period. If mesotocin is involved in stimulating prostate growth, then it might be expected that local concentrations of the peptide would rise before the increase in prostate weight and fall before a decrease in prostate weight occurs. As can be seen in the schematic depiction shown in Figure 8, this is the case. Concentrations of prostatic mesotocin peak approximately 1–2 mo before the increase in prostate weight, immediately preceding the two main breeding periods. Mesotocin is localized in the epithelial cells and it is this glandular tissue that increases in mass during the breeding season. It is unclear why the depression in mesotocin concentration that occurs in the winter is more severe than that observed during the summer nonbreeding period of December–February. However, this effect may be accentuated by the small sample size present in July.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 8. Schematic diagram showing changes in prostate weight and prostatic mesotocin concentration throughout the year. The solid line represents prostate weight and the dashed line prostatic mesotocin

The possum produces sperm throughout the year and does not undergo seasonal changes in the size of the testes or epididymides; thus, alterations in the function of the accessory glands may hold the key to the promotion of fertility in the breeding season. The role peripheral androgens play in producing and maintaining changes in prostate size in the possum has not been clear. It has been suggested that peripheral testosterone concentrations rise, possibly 2 mo before the onset of breeding [15, 16]. However, we and other authors [44] have been unable to demonstrate this increase. Prostatic concentrations of testosterone and DHT have not been thoroughly investigated. However, to date, no significant differences in the concentration of these androgens have been identified between the breeding and nonbreeding periods [45]. Androgens are essential for the growth of the prostate during development. However, while DHT induces prostate growth in the adult rat, the same is not true for all species. In the dog, treatment with androgen alone does not induce prostatic hyperplasia [46], and in the aging human, benign prostatic hyperplasia occurs when both plasma and prostatic concentrations are declining [4749].

If prostatic androgens do not alter, what then drives the seasonal changes in prostate growth? Mesotocin may be a possible candidate for this role in the possum. In this study, increases in plasma mesotocin concentration occurred over the summer months, peaking in March, immediately before the autumn breeding period. No concurrent rise in concentration occurs before the spring breeding period. The increase in concentration also occurs prior to increases observed for prostatic mesotocin before the autumn breeding period. The surge in plasma mesotocin may, therefore, be preparatory for the tissue mesotocin surges.

The present data confirm earlier descriptions of seasonal changes in prostate size [1517]. However, the body weight of animals used did not differ significantly throughout the year, as has been observed by other authors [15, 17]. The use of an animal in this study was randomly determined by the availability of trapped animals and, if a constant population had been monitored, such seasonal differences may have become evident. Additionally, as wild-caught animals were used, the possible effect of dominance in the population could not be controlled for. This may or may not have influenced the levels of circulating androgens and the size of the prostate in some animals.

In conclusion, we have demonstrated the presence of a locally produced oxytocin-like peptide, mesotocin, and its receptor in the possum prostate, and have shown that these peptides have a similar localization in the possum and human [41]. The localization of these proteins in the epithelial cells of the gland and the seasonal changes in hormone concentrations immediately before increases and decreases in prostate weight suggest a physiological role for mesotocin in prostatic growth and regression. These findings raise the possibility of using the brushtail possum as a novel animal model for investigating the regulation of prostate growth.


    ACKNOWLEDGMENTS
 
The authors would like to Euan Thompson for his maintenance of the animal facility and involvement in tissue collection and Maree Gould for her technical assistance.


    FOOTNOTES
 
1 Correspondence: Helen Nicholson, Department of Anatomy and Structural Biology, Otago School of Medical Sciences, University of Otago, P.O. Box 913, Dunedin, New Zealand. FAX: 64 3 479 7254; helen.nicholson{at}stonebow.otago.ac.nz Back

Received: 5 August 2004.

First decision: 25 August 2004.

Accepted: 4 October 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Armstrong DT, Hansel W. Effects of hormone treatment on testis development and pituitary function. Int J Fert 1958 3:296-306
  2. Plecas B, Popovic A, Jovovic D, Hristic M. Mitotic activity and cell deletion in ventral prostate epithelium of intact and castrated oxytocin-treated rats. J Endocrinol Invest 1992 15:249-253[Medline]
  3. Popovic A, Jovovic D, Hristic M, Martinovic J. The effect of oxytocin on anterior pituitary gonadotrophic function in male rats. Yugosl Physiol Pharmacol Acta 1982 18:95-106
  4. Popovic A, Plecas B, Milicevic Z, Hristic M, Jovovic D. Stereologic analysis of ventral prostate of oxytocin-treated rats. Arch Androl 1990 24:247-253[Medline]
  5. Nicholson HD, Jenkin L. Oxytocin and prostatic function. Adv Exp Med Bio 1995 395:529-537[Medline]
  6. Bodanszky M, Sharaf H, Roy JB, Said SI. Contractile activity of vasotocin, oxytocin, and vasopressin on mammalian prostate. Eur J Pharmacol 1992 216:311-313[CrossRef][Medline]
  7. Carmichael MS, Humbert R, Dixen J, Palmisano G, Greenleaf W, Davidson JM. Plasma oxytocin increases in the human sexual response. J Clin Endocrinol Metab 1987 64:27-31[Abstract]
  8. Ivell R, Balvers M, Rust W, Bathgate R, Einspanier A. Oxytocin and male reproductive function. Adv Exp Med Biol 1997 424:253-264[Medline]
  9. Frayne J, Nicholson HD. Localization of oxytocin receptors in the human and macaque monkey male reproductive tracts: evidence for a physiological role of oxytocin in the male. Mol Hum Reprod 1998 4:527-532[Abstract/Free Full Text]
  10. Einspanier A, Ivell R. Oxytocin and oxytocin receptor expression in reproductive tissues of the male marmoset monkey. Biol Reprod 1997 56:416-422[Abstract]
  11. Jenkin L, Nicholson HD. Evidence for the regulation of prostatic oxytocin by gonadal steroids in the rat. J Androl 1999 20:80-87[Abstract/Free Full Text]
  12. Assinder SJ, Nicholson HD. Effects of steroids on oxytocin secretion by the human prostate in vitro. Int J Androl 2004 27:12-18[Medline]
  13. Mahapokai W, van Sluijs FJ, Schalken JA. Models for studying benign prostatic hyperplasia. Prostate Cancer Prostatic Dis 2000 3:28-33[Medline]
  14. Steiner MS, Couch RC, Raghow S, Stauffer D. The chimpanzee as a model of human benign prostatic hyperplasia. J Urol 1999 162:1454-1461[Medline]
  15. Gemmell RT, Cepon G, Barnes A. Weekly variations in body weight and plasma testosterone concentrations in the captive male possum, Trichosurus vulpecula. Gen Comp Endocrinol 1986 62:1-7[Medline]
  16. Oldham JM. Aspects of reproductive biology in the male brush-tail possum Trichosurus vulpecula. Auckland, NZ: University of Auckland; 1986. M.Sc. Thesis
  17. Gilmore DP. Seasonal reproductive periodicity in the male Australian brush-tailed possum (Trichosurus vulpecula). J Zool London 1969 157:75-98
  18. Bathgate RAD, Sernia C, Gemmell RT. Arginine vasopressin- and oxytocin-like peptides in the testis of two Australian marsupials. Peptides 1993 14:701-705[CrossRef][Medline]
  19. Bathgate RAD, Parry LJ, Fletcher TP, Shaw G, Renfree MB, Gemmell RT, Sernia C. Comparative aspects of oxytocin-like hormones in marsupials. Adv Exp Med Biol 1995 395:639-655[Medline]
  20. Bathgate RAD, Sernia C. Characterization of vasopressin and oxytocin receptors in an Australian marsupial. J Endocrinol 1995 144:19-29[Abstract]
  21. Parry LJ, Bathgate RAD. Mesotocin receptor gene and protein expression in the prostate gland, but not testis, of the Tammar Wallaby, Macropus eugenii. Biol Reprod 1998 59:1101-1107[Abstract/Free Full Text]
  22. McLeod BJ, Thompson EG, Crawford JL, Shackell GH. Successful group housing of wild-caught brushtail possums (Trichosurus vulpecula). Anim Welfare 1997 6:67-76
  23. Tyndale-Biscoe CH. Observations on the reproduction and ecology of the brush-tailed possum, Trichosurus vulpecula Kerr (Marsupialia), in New Zealand. Aust J Zool 1955 3:162-184
  24. Rodger JC, Hughes RL. Studies of the accessory glands of male marsupials. Aust J Zool 1973 21:303-320[CrossRef]
  25. Parry LJ, Bathgate RAD, Ivell R. Mammalian mesotocin: cDNA sequence and expression of an oxytocin-like gene in a macropodid marsupial, the tammar wallaby. Gen Comp Endocrinol 2000 118:187-199[Medline]
  26. Kimura T, Tanizawa O, Mori K, Brownstein MJ, Okayama H. Structure and expression of a human oxytocin receptor. Nature 1992 356:526-529[CrossRef][Medline]
  27. Bathgate RAD, Rust W, Balvers M, Hartung S, Morley S, Ivell R. Structure and expression of the bovine oxytocin receptor gene. DNA Cell Biol 1995 14:1037-1048[Medline]
  28. Adan RAH, van Leeuwen FW, Sonnemans MAF, Brouns M, Hoffman G, Verbalis JG, Burbach JPH. Rat oxytocin receptor in brain, pituitary, mammary gland, and uterus: partial sequence and immunocytochemical localization. Endocrinol 1995 136:4022-4028[Abstract]
  29. Whittington K, Assinder SJ, Parkinson T, Lapwood KR, Nicholson HD. Function and localization of oxytocin receptors in the reproductive tissue of rams. Reproduction 2001 122:317-325[Abstract]
  30. Nicholson HD, Swann RW, Burford GD, Wathes D, Porter DG, Pickering BT. Identification of oxytocin and vasopressin in the testis and in adrenal tissue. Regul Pept 1984 8:141-146[CrossRef][Medline]
  31. Sernia C, Garcia-Aragon J, Thomas WG, Gemmell RT. Uterine oxytocin receptors in an Australian marsupial, the brushtail possum, Trichosurus vulpecula. Comp Biochem Physiol 1990 95A:135-138
  32. Assinder SJ, Carey M, Parkinson T, Nicholson HD. Oxytocin and vasopressin expression in the ovine testis and epididymis: changes with the onset of spermatogenesis. Biol Reprod 2000; 63:448–456
  33. Hurpet D, Chauvet MT, Chauvet J, Acher R. Marsupial hypothalamo-neurohypophyseal hormones. The brush-tailed possum (Trichosurus vulpecula) active peptides. Int J Peptide Protein Res 1982 19:366-371[Medline]
  34. Nicholson HD, Guldenaar SEF, Boer GJ, Pickering BT. Testicular oxytocin: effects of intratesticular oxytocin in the rat. J Endocrinol 1991 130:231-238[Abstract]
  35. Parry LJ, Guymer FJ, Fletcher TP, Renfree MB. Release of oxytocic peptide at parturition in the marsupial, Macropus eugenii. J Reprod Fertil 1996 107:191-198
  36. Greenwood FC, Hunter WM, Glover JS. The preparation of 131I-labelled human growth hormone of high specific radioactivity. Biochem J 1963 89:114-123[Medline]
  37. Yeung WSB, Guldenaar SEF, Worley RTS, Humphrys J, Pickering BT. Oxytocin in Leydig cells: an immunocytochemical study of Percoll-purified cells from rat testes. Cell Tissue Res 1988 253:463-468[Medline]
  38. Barberis C, Mouillac B, Durroux T. Structural bases of vasopressin/ oxytocin receptor function. J Endocrinol 1998 156:223-229[CrossRef][Medline]
  39. Nicholson HD. Oxytocin: A paracrine regulator of prostatic function. Rev Reprod 1996 1:69-72[Abstract]
  40. Bathgate RAD, Sernia C, Gemmell RT. Mesotocin in the brain and plasma of an Australian marsupial, the brushtail possum (Trichosurus vulpecula). Neuropeptides 1990 16:121-127[Medline]
  41. Whittington K, Assinder S, Gould M, Samalia KP, Nicholson HD. Oxytocin, oxytocin associated neurophysin and oxytocin receptor in the human prostate. Cell Tissue Res 2004; 318:375–382
  42. Gemmell RT, Sernia C. The localization of oxytocin and mesotocin in the reproductive tract of the male marsupial bandicoot Isoodon macrourus. Gen Comp Endocrinol 1989 75:103-109[CrossRef][Medline]
  43. Soloff MS, Beauregard G, Potier M. Determination of the functional size of oxytocin receptors in plasma membranes from mammary gland and uterine myometrium of the rat by radiation inactivation. Endocrinology 1988 122:1769-1772[Abstract]
  44. Curlewis JD, Stone GM. Peripheral androgen levels in the male brush-tail possum (Trichosurus vulpecula). J Endocrinol 1985 105:63-70[Abstract]
  45. Curlewis JD, Stone GM. Some effects of breeding season and castration on the prostate and epididymis of the brushtail possum, Trichosurus vulpecula. Aust J Biol Sci 1985 38:313-326[Medline]
  46. Walsh PC, Wilson JD. The induction of prostatic hypertrophy in the dog with androstanediol. J Clin Invest 1976 57:1093-1097
  47. Pirke KM, Doerr P. Age related changes in free plasma testosterone, dihydrotestosterone and oestradiol. Acta Endocrinol 1975 80:171-181
  48. Walsh PC, Hutchins GM, Ewing LL. Tissue content of dihydrotestosterone in human prostatic hyperplasia is not supranormal. J Clin Invest 1983 72:1772-1777
  49. Shibata Y, Ito K, Suzuki K, Nakano K, Fukabori Y, Suzuki R, Kawabe Y, Honma S, Yamanaka H. Changes in the endocrine environment of the human prostate transition zone with aging: simultaneous quantitative analysis of prostatic sex steroids and comparison with human prostatic histological composition. Prostate 2000 42:45-55[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
M L Gould, P R Hurst, and H D Nicholson
The effects of oestrogen receptors {alpha} and {beta} on testicular cell number and steroidogenesis in mice
Reproduction, August 1, 2007; 134(2): 271 - 279.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
H. Thackare, H. D. Nicholson, and K. Whittington
Oxytocin--its role in male reproduction and new potential therapeutic uses
Hum. Reprod. Update, July 1, 2006; 12(4): 437 - 448.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/2/470    most recent
biolreprod.104.035006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.
Agricola
Right arrow Articles by Fink, J. W.
Right arrow Articles by Nicholson, H. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS