Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print December 1, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.033746
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/4/851    most recent
biolreprod.104.033746v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seenundun, S.
Right arrow Articles by Robaire, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seenundun, S.
Right arrow Articles by Robaire, B.
Agricola
Right arrow Articles by Seenundun, S.
Right arrow Articles by Robaire, B.
BIOLOGY OF REPRODUCTION 72, 851–861 (2005)
DOI: 10.1095/biolreprod.104.033746
© 2005 by the Society for the Study of Reproduction, Inc.

Cloning and Characterization of the 5{alpha}-Reductase Type 2 Promoter in the Rat Epididymis1

Shayesta Seenundun, and Bernard Robaire2,

Departments of Pharmacology and Therapeutics and of Obstetrics and Gynecology, McGill University, Montreal, Quebec, Canada H3G 1Y6


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Steroid 5{alpha}-reductase converts testosterone to the more potent androgen, dihydrotestosterone. The molecular mechanisms responsible for maintaining high concentrations of the 5{alpha}-reductase type 2 mRNA in the caput epididymidis and for regulating its region-specific expression are unknown. To gain insight into its transcriptional regulation, the cloning and characterization of the 5' upstream region of 5{alpha}-reductase type 2 were undertaken. Sequential deletion analysis was done to map the 2243-base pair (bp) cloned 5' upstream region, and the constructs were transfected into epididymal PC1 cells and prostatic PC3 cells. In both cell lines, regulatory elements and the minimal promoter were mapped to the 485-bp region upstream of the start codon. Primer extension and 5' RACE identified one transcriptional start site at 33-bp upstream of the start codon. Using electrophoretic mobility shift assay, a specific band was observed in the –68- to –32-bp region in the presence of nuclear extracts. Supershift and mutational studies confirmed the binding of SP1 and, to a lesser extent, SP3 to the two potential SP1 binding sites and the preference of these proteins to one binding site over the other. SP1 and SP3 were both predominantly immunolocalized to the principal cells of the epididymis and follow distinct distribution patterns in this tissue. These results provide a framework crucial in the further investigation of the transcriptional regulation of 5{alpha}-reductase type 2 in the rat epididymis.

epididymis, gene regulation, male reproductive tract, steroid hormones, testosterone


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Testosterone, the most abundantly produced androgen, is reduced by 5{alpha}-reductase to the more potent dihydrotestosterone (DHT). DHT mediates many of the actions ascribed to androgens, including the differentiation of the male external genitalia and prostate during fetal development, virilization at puberty, and male sexual and aggressive behavior [13]. It may also play a role in several endocrine disorders, such as benign prostatic hyperplasia, male pattern baldness, acne, and hirsutism [49]. In the epididymis, a single, highly convoluted tubule linking the efferent ducts of the testis to the vas deferens, 5{alpha}-reductase is found at high concentrations [10]. DHT is the main androgen responsible for maintaining the structure of this tissue and for carrying out its functions in sperm maturation and storage [11]. The epididymis consists of a lumen and an epithelium made up of four major cell types: principal, basal, clear, and halo cells [11, 12]. Principal cells outnumber the other cell types combined by a ratio of more than three to one [13] and are very active with respect to transport and secretion of small organic molecules, protein synthesis and secretion, and absorption of both fluid and particulate matter [13]. 5{alpha}-reductase is localized to this cell type [14, 15].

Steroid 5{alpha}-reductase is a membrane-bound, NADPH-dependant enzyme [16]. Two forms of this enzyme have been identified, and the two isozymes have been named type 1 and type 2, based on their order of discovery [1619]. These isozymes share 46% sequence homology; they have similar gene structures, substrate preferences, and hydropathy profiles [17, 20, 21]. They are, however, products of different genes [2123] and differ with respect to their tissue distribution profile and their pharmacological characterization [16, 1820]. In humans, mutations in the 5{alpha}-reductase type 2 gene are responsible for 5{alpha}-reductase deficiency, a rare form of male pseudohermaphroditism. This condition is characterized by internal Wolffian duct structures but female external genitalia [17, 20, 21, 24]. While the type 1 isozyme is more broadly distributed, 5{alpha}-reductase type 2 mRNA is found predominantly in male sex accessory tissues such as the epididymis, the prostate, and the seminal vesicles [5, 19, 25]. In the epididymis, 5{alpha}-reductase type 2 mRNA is expressed at higher levels than in any other rat tissue; it is predominantly expressed in the caput segment of the epididymis [19]. The two isozymes are differentially regulated in this tissue, with respect to age, longitudinal distribution, and response to testicular factors [26].

The molecular mechanisms responsible for the high levels of type 2 mRNA expression in the rat caput epididymidis, and for its region- and cell-specific expression are unknown. To gain insight into the transcriptional regulation of 5{alpha}-reductase mRNA type 2 gene expression, we have undertaken the cloning and characterization of the 5' upstream region of this gene. We have also immunolocalized SP1 and SP3, transcription factors found to interact with the 5{alpha}-reductase type 2 promoter, in the epididymis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of 5{alpha}-Reductase Type 2 Upstream Region

A Wistar-Furth genomic library prepared in the lambda bacteriophage Charon 35 was screened by phage plaque hybridization using a 209-base pair (bp) EcoRI-PstI digested cDNA probe encoding the N-terminus of rat 5{alpha}-reductase type 2 [27]. This probe was radiolabeled by random priming using an oligolabeling kit (Amersham Biosciences Inc., Baie d'Urfé, QC) with dCTP (Amersham Biosciences Inc.). The plate replicas were incubated overnight at 42°C in a formamide containing hybridization buffer (48 ml formamide, 24 ml 20x SSC, 1 ml Tris-HCl pH 7.6, 1 ml Denhardt solution, 20 ml dextran sulfate, 0.1 g SDS, 5 ml distilled water, and 10 mg salmon sperm DNA). After they were washed, the plate replicas were exposed to autoradiographic film for 2–4 days and the positive clones were isolated. The phages corresponding to the positive clones were replicated and their DNA extracted [27]. The insert was isolated from the phage vector and submitted to restriction analysis. A 2.6-kilobase (kb) BamHI/ SmaI fragment hybridizing with the 0.2-kb probe was subcloned into the BamHI/SmaI site of pUC18 (Amersham Biosciences Inc.) and sent for sequencing. This fragment contains the 5' upstream sequence of 5{alpha}-reductase type 2 or the 2243 bp upstream of the ATG start codon (GenBank accession AY587954). DNA sequencing and all primer and oligonucleotide synthesis were done at the Sheldon Biotechnology Centre, McGill University (Montreal, QC).

Construction of Plasmids for Transfection

Polymerase chain reaction (PCR) primers were used to produce sequentially smaller fragments in the 5' end. The sequence of these primers, used to generate fragments inserted in the positive and negative orientations of the vector, is shown in Table 1. The sense and antisense strands for fragments –49bpATG and –25bpATG, in the positive and negative orientations, with the appropriate overhangs and 5' phosphorylation, are shown in Table 2. Following 35 cycles of PCR reaction (using Ready-To-Go PCR beads; Amersham Biosciences Inc.), the fragments were run on a 1% agarose gel (2% gel for fragment –151bpATG), the bands were excised, and the DNA was cleaned from enzymatic reactions using the Qiaquick gel extraction kit from Qiagen (Mississauga, ON). The fragments were then double digested by SacI and BgllI, gel extracted (Qiaquick gel extraction kit) and ligated using Ready-To-Go T4 DNA ligase (Amersham Biosciences Inc.) to the dephosphorylated, linear (double digested by the same restriction enzymes) pGL3Basic luciferase reporter vector (Promega Corporation, Madison, WI). The two smallest fragments, –49bpATG and –25bpATG, were directly annealed in an annealing buffer (10 mM Tris-Cl, 1 mM EDTA, 50 mM NaCl) and ligated as described above. Next, One Shot INV{alpha} F' competent cells (Invitrogen-Life Technologies, Carlsbad, CA) were transformed with the ligated products, plated onto Luria-Bertani (LB)-ampicillin plates, and the clones were analyzed for the appropriate construct. The identity of the construct was further confirmed by sequencing. Maxipreps (Promega Wizard kit; Promega Corporation) were done for each construct according to the manufacturer's protocol. All enzymes, unless otherwise indicated, were purchased from Invitrogen-Life Technologies.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Primers used in sequential deletion analysis


View this table:
[in this window]
[in a new window]
 
TABLE 2. Oligonucleotides synthesized for sequential deletion analysis

RNA Extraction and Northern Blot Analysis

Adult male Sprague Dawley rats (3 mo old; Charles River Laboratories, Inc., St. Constant, QC) were killed by decapitation and their epididymides and hearts were collected and immediately frozen in liquid nitrogen. All tissues were stored at –80°C until used for RNA extraction. All animal studies were conducted in accordance with the principles and procedures outlined in A Guide to the Care and Use of Experimental Animals prepared by the Canadian Council on Animal Care (McGill protocol 206).

RNA was extracted and then DNAse treated using the RNeasy midi kit from Qiagen. RNA concentration was assessed by reading the optical density at 260 nm (DU7 spectrophotometer; Beckman, Montreal, QC). From each sample, 5 µg of RNA was run on a 1% agarose gel to assess the quality of the sample. A Northern blot was done to confirm the presence of 5{alpha}-reductase type 2 mRNA in the epididymis; RNA from heart was used as a negative control [27].

Cell Culture, Reverse-Transcription Polymerase Chain Reaction, and Transfection Experiments

PC3 cells (ATCC, Manassas, VA) were initially cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM glutamine, and 20 µM gentamycin sulfate. For transfection experiments, PC3 cells were grown in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, 2 mM glutamine, and 20 µM gentamycin sulfate. PC1 cells from the mouse proximal caput epididymidis (kindly provided by Dr. M.-C. Orgebin-Crist) were grown and transfected in Iscove Modified Dulbecco medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 4 mM glutamine, penicillin-streptomycin (25 000 units penicillin G sodium, 25 mg streptomycin sulfate), and 10 µM 5{alpha}-DHT. PC3 cells and PC1 cells were cultured at 37 and 33°C, respectively, with 5% CO2. All cell culture products were purchased from Invitrogen-Life Technologies.

One-step reverse transcription (RT) PCR (Qiagen) was done according to the manufacturer's protocol to confirm the presence or absence of 5{alpha}-reductase type 2 mRNA in the cell lines used. Control lanes showing the endogenous level of expression of the gene in the rat caput epididymidis and rat epididymis were also included. The primers were designed using the Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/); mouse 5{alpha}-reductase type 2 sense: 5'AACACAGCGAGAGTGTGTCG 3' and antisense: 5' AAAGCAAAGGCTGGAACAGA 3', human 5{alpha}-reductase type 2 sense: 5' CAGGAAGCCTGGAGAAATCA 3' and antisense: 5'AGTTGGGGATCAGGATAGGG 3', rat 5{alpha}-reductase type 2 sense: 5' GTTGCCTTCCTTTGTGGTGT 3' and antisense: 5' CAATAATCTCGCCCAGGAAA 3'. GAPDH primers (BD Biosciences, Mississauga, ON) were used for a control reaction. Twenty microliters of sample were loaded per well, except for GAPDH, where 10µl of sample were loaded.

Both cell lines were transiently cotransfected by the calcium phosphate method with the pGL3B construct, pSV (ß-galactosidase vector from Promega Corporation) and pUC18 [27]. Briefly, 1 x 105 cells were seeded onto 6-well plates and, after 48 h, were cotransfected with 5 µg of luciferase construct, 3 µg of pSV, and 2 µg of pUC18. The calcium-DNA precipitate was left in contact with the prostatic PC3 cells and proximal caput epididymidis PC1 cells for 6 and 16 h, respectively. The cells were then washed three times with PBS and fresh media was added. The cells were cultured for another 48 h, at which time they were harvested into 500 µl 1x reporter lysis buffer (Promega Corporation). Luciferase and ß-galactosidase activities were measured using the reporter assay system as directed by the manufacturer (Promega Corporation). Each sample was read twice using a luminometer (LUMIstar Galaxy; BMG Lab Technologies, Durham, NC) and the average was compared with the ß-galactosidase activity (absorbance read at 420 nm by DU spectrophotometer; Beckman). The value obtained was divided by that of the negative control. For all transfection assays, data are shown as the mean ± SEM of triplicate assays in three independent experiments. Kruskal-Wallis one-way analysis of variance on ranks was done followed by Dunnett post hoc test (P < 0.05 was considered significant) to identify those constructs having significant luciferase activity over background.

Primer Extension

A 20-mer HPLC purified primer (5' GGATCAGGGTCCCCATAGTG 3') was labeled at the 5' end with [{gamma}-32P] ATP (Amersham Biosciences Inc.) and T4 polynucleotide kinase according to Promega's primer extension system-AMV reverse transcriptase kit (Promega Corporation). The 32P-labeled primer was hybridized with 50 µg of rat total RNA from caput epididymidis, whole epididymis, and heart as follows: RNA was heated for 10 min at 85°C and then cooled on ice. The annealing reaction was left overnight at 45°C in a denaturing hybridization solution (40 mM PIPES at pH 6.4, 1 mM EDTA, 0.4 M NaCl, and 80% deionized formamide) to maximize annealing. The RNA/DNA template was ethanol precipitated and resuspended in water. Superscript II (Invitrogen-Life Technologies) was used to reverse transcribe the RNA and the product was run on a denaturing polyacrylamide gel. The gel was exposed overnight at –80°C to a PhosphorImager plate (Molecular Dynamics Inc., Sunnyvale, CA) and visualized with a PhosphorImager (Storm; Molecular Dynamics Inc.).

5' Rapid Amplification of cDNA Ends

The GeneRacer kit (Invitrogen-Life Technologies) was used for 5' rapid amplification of cDNA ends (RACE). Briefly, rat epididymal total RNA was treated with calf intestinal phosphatase to cleave the 5' phosphate from truncated mRNA and non-mRNA species. It was then treated with tobacco acid pyrophosphatase to remove the 5' cap structure from intact, full-length mRNA. The GeneRacer RNA oligo was ligated to the 5' end of the mRNA and the mRNA was reverse transcribed by Superscript II with an oligo dT primer (provided with the kit). Platinum Taq polymerase high fidelity was used for hot start, touchdown PCR, along with the 5.1 primer (5' GCACGAGGACACTGACATGGACTGA 3') and a gene-specific primer (5' GCTTCCTGAGCTGGGTGTAGTCA 3'). The product of this reaction was used for nested PCR with a forward nested primer (5' GGACACTGACATGGACTGAAGGAGTA 3', provided with the kit) and a reverse gene-specific primer (5' AGGCTTGAAGGAGTCCGTTCCCTA 3'). The PCR product was gel purified and cloned into the TOPO vector. TOP10 chemically competent Escherichia coli cells were transformed by the ligated product and 14 clones were picked from the LB-ampicillin plates for further analysis and sequenced.

Identification of Putative Transcription Factor-Binding Sites

The 2.2-kb 5' upstream region was analyzed by TRANSFAC 4.0 (http://transfac.gbf.de/cgi-bin/matSearch/matsearch.pl) using the MatInspector V2.2 program.

Nuclear Extraction and Electrophoretic Mobility Shift Assay

Nuclear extractions from 42-day-old rat caput epididymides and from the mouse proximal caput epididymal PC1 cell line were produced using the Nuclear Extract Kit from Active Motif (Carlsbad, CA) following the manufacturer's protocol. The protein concentration was determined by the Bradford method using the Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, CA).

Five oligonucleotide fragments spanning the region most proximal to the transcriptional start site were synthesized (Table 3). Oligo 1 corresponds to the +5 to +34 region of the 5{alpha}-reductase type 2 gene, oligo 2 to –37 to +10, oligo 3 to –68 to –32, oligo 4 to –120 to –69, and oligo 5 to –174 to –120. Three more fragments were produced with mutations in the SP1 binding sites of oligo 3 as seen in Table 3. Oligo 3 SP1(1) mutation has a mutation in the first SP1 binding site of the fragment, oligo 3 SP1(2) mutation has a mutation in its second site, and oligo 3 double SP1 mutation contains both mutations.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Oligonucleotides synthesized for use in EMSA

Electrophoretic mobility shift assay (EMSA) was done using Gel Shift Assay Systems (Promega Corporation). The sense oligonucleotides were end labeled with [{gamma}-32P] dATP (Amersham Biosciences Inc.) and T4 polynucleotide kinase. The percentage incorporation was determined and found to be >40%. The radioactive probes were annealed to an excess amount (3-fold molar excess) of their complementary oligonucleotides, thus ensuring that virtually all labeled oligonucleotides are annealed and unable to interfere with the binding reactions. The double-stranded probes were then purified by a spin column (Microspin G-25 columns; Amersham Biosciences Inc.). The reaction mixture comprised 20 µg of nuclear extracts and 1 µl gel shift binding 5x buffer (20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl [pH 7.5], 0.25 mg/ml poly(dI-dC)(poly(dI-dC)) in a 10-µl volume. The components were preincubated at room temperature for 30 min (either with antibody or specific unlabeled competitor) before addition of the radioactive probe (35 fmol). They were then incubated for another 30 min at room temperature. One microliter of the gel loading 10x buffer (250 mM Tris-HCl [pH 7.5], 0.2% bromophenol blue, 40% glycerol) was added and the DNA-protein complexes were resolved on a 4% polyacrylamide (40:1 acrylamide:bisacrylamide) gel in 0.5x Tris-borate-EDTA buffer. The complexes were visualized with a PhosphorImager (Storm, Molecular Dynamics, Inc.) after an overnight exposure to PhosphorImager plates (Molecular Dynamics, Inc.) at –80°C. Unless otherwise indicated, 143-fold molar excess of unlabeled competing oligonucleotides were added to the reaction prior to the addition of the radiolabeled probe. For supershift assays, the nuclear extracts were preincubated with 2 µg of either SP1 (PEP2, sc-59X), SP3 (D-20, sc-644X), USF-1 (C-20, sc-229X), USF-2 (C-20, sc-862X), estrogen receptor (ER){alpha} (MC-20, sc-542X), or ERß (Y-19, sc-6821X) antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). SP1 and SP3 were selected because they are ubiquitous members of the Sp1 family of transcription factors.

Tissue Preparation for Light Microscopy and Immunohistochemistry

Sprague-Dawley rats (350 g, n = 3) were anesthetized by an intraperitoneal injection of vetalar (Ketamine HCL 115.4 mg/ml; Vetrepharm, London, ON), anased (Xylazine HCL 20 mg/ml; Novopharm, Toronto, ON), and atravet (Acepromazine Maleate 10 mg/ml; Ayerst, Montreal, PQ) 20:10:1. Epididymides were fixed by retrograde perfusion with Bouin fixative via the abdominal aorta as previously described [28]. The fixed epididymides were left overnight in Bouin fixative and were then dehydrated and embedded in paraffin. Sections, 6 µm thick, were cut with a microtome and mounted on glass slides.

The sections were deparaffinized in xylene and hydrated in a series of graded ethanol solutions. Endogenous peroxide activity was abolished in a 70% ethanol, 1% hydrogen peroxide solution and free aldehyde groups were blocked with 300 nM glycine. The sections were incubated in 3% bovine serum albumin (BSA) and goat blocking serum (Vectastain Elite ABC kit; Vector Laboratories, Burlingame, CA) for 1 h and then with a primary antibody in the blocking solution overnight at 4°C. The antibodies, SP1 and SP3, were used in a 1:2000 dilution. The sections were washed three times with PBS and incubated for 30 min with a biotinylated goat anti-rabbit IgG secondary antibody (ABC kit). Following three more washes in PBS, they were incubated with the ABC reagent for 30 min and washed again in PBS three times. The staining was visualized by incubating them with 0.05% diaminobenzidine tetrahydrochloride (Bio Fx Laboratories, Owings-Mills, MD). The sections were washed three times in PBS and counterstained with 0.08% methylene blue. They were dehydrated in a series of graded ethanol solutions and cover slips were mounted onto the slides with Permount (Fisher Scientific, Pittsburgh, PA). Blocking peptide (SP1(PEP2)P, sc-59P and SP3(D20)P, sc-644P; Santa Cruz Biotechnology) was added at a 5-fold excess to the blocking solution during incubation with the primary antibody for the negative controls.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A Minimal Promoter in the –151-bp Region Upstream of the ATG Codon

Sequential deletion analysis was done on the 5{alpha}-reductase type 2 promoter using the luciferase pGL3B vector to identify the minimal promoter region of the gene as well as some cis elements that might regulate its activity. The empty pGL3B vector with no promoter or enhancer sequences was used as a negative control. Luciferase activity is only detected if a functional promoter is inserted in the proper orientation into this vector. Nine sequentially smaller fragments were generated from the cloned 5' upstream region of 5{alpha}-reductase type 2 and inserted into the vector in both the positive and negative orientation to test for promoter bidirectionality. The constructs were arbitrarily designated with respect to the ATG start codon (Fig. 1).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 1. Constructs used in the sequential deletion experiments. Nine sequentially smaller constructs were generated using PCR primers (or by synthesizing the sense and antisense strands for the two smallest fragments). These constructs are named relative to their positions from the ATG start codon. The longest construct, pGL3B–2.2-kb ATG, contains the entire cloned 5' upstream region and the empty pGL3B vector serves as a negative control. A functional promoter needs to be inserted in the proper orientation for luciferase expression. The fragments were directionally cloned into the multiple cloning site of the luciferase reporter plasmid pGL3Basic in the positive and negative orientations (as indicated by the two arrows)

The prostatic PC3 cell line and the mouse proximal caput epididymidis PC1 cell line were shown to express 5{alpha}-reductase type 2 mRNA by RT-PCR (Fig. 2). Both express it at lower levels than rat caput epididymidis and rat epididymis, but its presence indicates that PC1 and PC3 cells have the transcription factors required for 5{alpha}-reductase type 2 expression. The PC1 cell line also has the added advantage of being a pure culture of immortalized epithelial cells obtained specifically from the proximal caput epididymal segment [29], the region where 5{alpha}-reductase type 2 mRNA is the highest. Comparing the luciferase activity of the constructs in the two cell lines provides an indication as to whether the cis elements of the 5{alpha}-reductase type 2 gene are specific or common for the two tissues expressing it.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. 5{alpha}-reductase type 2 mRNA expression in the PC1 and PC3 cell lines. RT-PCR of 5{alpha}-reductase type 2 was done for both the prostatic PC3 cell line and the mouse proximal caput epididymal PC1 cell line. Control lanes show endogenous 5{alpha}-reductase type 2 mRNA levels in rat caput epididymidis and rat epididymis. GAPDH was used as a positive control for all RNA samples (only results from the PC1 cells are shown). A negative control was also done for each RNA sample, where the reverse transcription step was omitted, to make sure the RNA was free from genomic contamination

The constructs were cotransfected by the calcium phosphate method into both cell lines with the ß-galactosidase vector pSV, which served as an internal control for transfection efficiency and pUC18, used as a carrier vector. Both the prostatic and the epididymal cell lines displayed the same general trend (Fig. 3). When the fragments were inserted in the positive orientation (Fig. 3, A and B), we observed an increase in expression levels with decreasing fragment size until fragment –194bpATG, suggesting the presence of upstream repressor elements. The strongest repressors, regions decreasing the activity of the 5{alpha}-reductase type 2 promoter, were found between fragments –485bpATG and –194bpATG in both cell lines, where luciferase activity almost doubled between the two constructs. There was a decrease in expression levels between fragments –194bpATG and –151bpATG, indicating enhancer sequences in this region. These enhancer sequences or regions potentiating the activity of the 5{alpha}-reductase type 2 promoter were most pronounced in the PC1 cell line, where a 59% decrease in luciferase activity was observed. Luciferase activity was subsequently lost in the 2 smallest fragments, pGL3B–49bpATG and pGL3B–25bpATG, indicating that the minimal promoter is located in the 151-bp region upstream of the ATG start codon. When inserted in the negative orientation (Fig. 3, C and D), the luciferase activity of the fragments was minimal and only the smaller fragments had any luciferase activity over the background. These data suggest that the minimal promoter is preferentially unidirectional, in the positive orientation, and that a minimal promoter is found in the –151-bp region upstream of the ATG codon.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. Sequential deletion analysis. The luciferase constructs were cotransfected along with the ß-galactosidase pSV vector (to control for transfection efficiency) and pUC18 (used as a carrier vector) by the calcium phosphate method into the mouse proximal caput epididymal PC1 cell line (A and C) and the prostatic PC3 cell line (B and D) in both the positive (A and B) and negative (C and D) orientations. The luciferase activity of each construct was normalized by its ß-galactosidase activity; relative luciferase activity was calculated as a ratio of the normalized luciferase activity to that with pGL3Basic vector. Each construct was cotransfected in triplicate at three different times and is expressed as the mean ± SEM. Kruskal-Wallis one-way analysis of variance on ranks was done followed by Dunnett post hoc test to identify constructs with significant luciferase activity over background (P < 0.05 was considered significant)

Mapping of the Transcriptional Start Site

Primer extension and RACE were done to identify the transcriptional start site of the 5{alpha}-reductase type 2 gene. Primer extension was done using a primer complementary to a sequence located 73-bp downstream from the ATG start codon. Only one 100-bp band was detected in the total epididymis and caput epididymidis RNA extracts, but this band was absent in the heart RNA and no RNA lanes (Fig. 4). The results thus suggest that the band is specific and the gene has only one transcriptional start site. RACE was done to further confirm these findings. Of the 14 RACE clones sequenced, 4 did not sequence (clones 1, 3, 8, and 14) and the others were all within eight nucleotides away from each other (Fig. 5). The close proximity of the nucleotides to each other suggests the presence of only one transcriptional start site; this start site is located at approximately 100-bp from the primer used in the primer-extension experiments. Five clones (clones 6, 7, 11, 12, and 13) identified the most 5' nucleotide; it is henceforth this nucleotide that is designated position +1 or the transcriptional start site. The translational start site is located 34-bp downstream and is now referred to as position +34.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 4. Identification of the transcriptional start site by primer extension. Primer extension was done using a 20-bp primer complementary to the +54 to +74-bp region downstream of the ATG start codon. The primer was hybridized with 50 µg of rat total RNA from the epididymis (lane 2), the caput epididymidis (lane 3), and the heart, a tissue that does not express 5{alpha}-reductase type 2 (lane 5). A single 100-bp band is seen in lanes 2 and 3 and is absent in lane 5. Markers (lanes 1 and 7) and the control reaction provided with the kit (lane 6) are also shown



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 5. The rat 5{alpha}-reductase type 2 transcriptional start site. The results obtained from the primer extension and RACE experiments are put in the context of the 5{alpha}-reductase type 2 sequence. The region complementary to the HPLC-purified primer extension primer (PE HPLC primer 1) used is shown in bold and underlined. Of the 14 clones obtained by RACE and sent for sequencing, four clones did not sequence and the others were all within eight nucleotides of each other. The most 5' nucleotide identified is designated the transcriptional start site (+1), the ATG start codon is located at +34 and a noncanonical TATA box at –30 (their corresponding sequences are shown in bold and underlined)

SP1 Binding Elements in the Proximal Promoter

A search of TRANSFAC yielded a number of potential transcription factor binding sites regulating 5{alpha}-reductase type 2; we focused our search to the 485-bp proximal 5' upstream region of the gene (Fig. 6). This area corresponds to the region upstream of the translational start site identified in the sequential deletion analysis studies as having the strongest repressor and enhancer sequences. The transcription factor binding sites include five SP1 binding sites (two of which are consensus GC boxes), as well as a number of AP2, AP4, USF1, USF2, IK1, IK2, and NF1 potential binding sites. Motifs for an ER half site and a little further upstream for PEA3 and GATA, have also been identified. To more thoroughly investigate this region, oligonucleotides spanning the –174 to +34 region were synthesized and used to identify potential DNA-protein interactions in murine proximal caput epididymal cell line and in 42-day-old rat caput epididymides nuclear extracts. This age was selected because of the absence of spermatozoa in the lumen of the epididymis [30] and the high level of mRNA expression [26].



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6. Potential transcription factor binding sites in the 5' upstream region of 5{alpha}-reductase type 2. Although the entire cloned region was analyzed, we show the proximal 576-bp region upstream of the transcriptional start site. This region has the area we chose to focus on based on the strong repressor, enhancer, and minimal promoter regions identified by sequential deletion analysis. In bold are the potential transcription-factor binding sites, as identified by TRANSFAC; they include sites for SP1, AP2, AP4, estrogen receptor (half-site), NF1, GATA, PEA3, and USF. The rectangle indicates the region spanned by the different oligonucleotides synthesized

When using oligos 2 (–37 to +10) or 5 (–174 to –120), no bands were visible, thus no DNA-protein complex was formed when these fragments were incubated with nuclear extracts from either the PC1 cell line or 42-day-old rat caput epididymides (results not shown). When the cell line nuclear extracts were incubated with oligo 1 (+5 to +34), a specific band was consistently observed (Fig. 7A). This band decreased in intensity with increasing amounts of specific competitor (5-fold, 25-fold, and 125-fold the molar concentration of the labeled probe), but no supershift was observed in the presence of the ER{alpha} or ERß antibody. In contrast, when oligo 1 was incubated with rat caput epididymidis nuclear extracts, no band was observed even with increasing amounts of nuclear extracts (results not shown). Similarly, a specific band was observed with oligo 4 (–120 to –69) when it was incubated with PC1 cell line nuclear extracts (Fig. 7B) but not with rat nuclear extracts (results not shown). This band disappeared in the presence of the unlabeled competitor (143-fold the molar concentration of the labeled probe), but the transcription factor(s) interacting with this segment remains unknown. To further ascertain its specificity, increasing amounts of unlabeled competitor (5-fold, 25-fold, and 125-fold excess) were added to the nuclear extracts and a progressive decrease in intensity was observed with increasing amounts of specific competitor (results not shown). TRANSFAC was used to identify the potential transcription factor binding sites on oligo 4; of those identified, only antibodies against SP1, SP3, USF1, and USF2 were available and previously used in similar experiments; no supershift was observed with any of these antibodies.



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 7. EMSA on the proximal 5{alpha}-reductase type 2 upstream region using the PC1 cell line and rat caput epididymidis nuclear extracts. The diagram above each gel indicates the position of the oligonucleotide relative to the gene sequence, an arrow indicates specific bands and supershifts, and lanes 1, 8, 15, and 23 correspond to the negative control (no nuclear extracts). A) Oligo 1 (+5 to +34) was incubated with 20 µg of the PC1 nuclear extracts as seen in lane 2. Antibody against the estrogen receptor (ER) {alpha} and ß were added to the reaction as depicted in lanes 3 and 4, respectively. In lanes 5, 6, and 7, increasing amounts of unlabeled gel shift fragment 1 were added prior to adding the radiolabeled fragment. B) Oligo 4 (–120 to –69) was incubated with 20 µg of the PC1 nuclear extracts (lane 9). A 143-fold excess unlabeled fragment was added to the reaction prior to the addition of the radiolabeled fragment in lane 10. Antibodies against USF1, USF2, SP1, and SP3 transcription factors were added as seen in lanes 11, 12, 13, and 14, respectively. C and D) The gels obtained when oligo 3 (–68 to –32) was incubated with 20 µg of PC1 cell line (lane 16) and 20 µg of rat caput epididymidis nuclear extracts (lane 24), respectively. The addition of antibodies against SP1 and SP3 to the reaction is seen in lanes 17, 18, 25, and 26. Competition studies are shown in the remaining lanes, where a mutated unlabeled fragment was added to the reaction. The mutated fragments correspond to oligo 3 with its first SP1 site mutated (lanes 19 and 27), its second SP1 site mutated (lanes 20 and 28), and with both its SP1 sites mutated

A specific band was observed when oligo 3 (–68 to –32) was incubated with 20 µg of cell line (Fig. 7C) or rat caput epididymidis (Fig. 7D) nuclear extracts. This band was supershifted in both cases with a SP1 antibody and to a lesser extent with a SP3 antibody. This band disappeared in the presence of excess unlabeled specific competitor but remained in the presence of excess unlabeled double SP1 mutated competitor (also 143-fold the molar concentration of the labeled probe). Because two SP1 binding sites were present on this DNA segment, we proceeded to identify the one(s) binding to the SP1 transcription factor. Two oligonucleotides were designed, each with one of the SP1 binding sites mutated. The fragments were analyzed by TRANSFAC to make sure no additional binding sites were introduced. When oligo 3 SP1(1) mutated was used to compete in the reaction (143-fold the molar concentration of the labeled probe), a decrease in intensity was observed in the band for both the cell line and rat caput epididymidis nuclear extracts, suggesting a decrease in DNA-protein binding. When oligo 3 SP1(2) mutated was used as a competitor in both nuclear extracts (at similar molar excess), the band was barely visible, indicating almost no interaction taking place between oligo 3 and the nuclear proteins. Therefore, the competition studies reveal that SP1 (and to a lesser extent SP3) bind to the –68 to –32 region of the gene in the presence of both the cell line and the rat caput epididymidis nuclear extracts. Although they can bind to both sites, they appear to prefer the first one, located at position –58, to –55 because this SP1 binding site is a consensus GC box and both SP1 and SP3 have high affinities for it.

Localization of SP1 and SP3 in the Epididymis

SP1 and SP3 are ubiquitous transcription factors. Their localization and distribution along the epididymis is unknown; therefore, immunolocalization studies were undertaken to ascertain the specificity of 5{alpha}-reductase type 2 mRNA expression. Both SP1 and SP3 displayed some cell- and region-specificity. Figure 8, A and D, shows the lack of staining in the caput epididymidis in the presence of excess peptide for SP1 and SP3, respectively; similar results were obtained for the cauda epididymidis (data not shown). The immunolocalization of SP1 and SP3 are shown for the caput epididymidis (Fig. 8, B and E), where 5{alpha}-reductase type 2 mRNA is the most highly expressed, and the cauda segment (Fig. 8, C and F), where a different pattern is observed. Strong immunostaining for SP1 was found in the nucleus of the principal cells and a more moderate staining for basal cells and apical cells. Narrow cells of the initial segment and halo cells showed little or no staining while clear cells did not stain. In the proximal segments of the epididymis, SP1 was only localized to the nucleus in the principal cells (Fig. 8B) while, in the more distal segments, some perinuclear and cytoplasmic staining were also observed (Fig. 8C). The initial segment of the epididymis displayed the most intense overall staining, while the corpus epididymidis displayed the least.



View larger version (104K):
[in this window]
[in a new window]
 
FIG. 8. Immunolocalization of SP1 and SP3 in the caput and cauda epididymidis. Light micrographs of SP1 (AC) and SP3 (DF) in the caput (A, B, D, E) and cauda (C, F) epididymidis. A and D) The negative controls (5-fold excess blocking peptide was added during the primary antibody incubation). Nuclear immunostaining of principal cells is depicted by a thick arrow, the lack of staining of clear cells by an arrow head, and the checkerboard-like pattern of staining displayed by some principal cells with a thin arrow. E, Epithelium; L, lumen; IT, intertubular space; S, sperm; P, principal cells; n, principal cell nucleus. Bar = 1 µm

SP3 staining was less intense than that of SP1 in all cells and regions of the epididymal epithelium but was very intense in sperm heads in the lumen. Principal cell nucleus and basal cells were immunoreactive and, to a lesser extent, apical and halo cells. As for SP1, no staining was observed in clear cells (Fig. 8F). In the corpus and cauda epididymidis, the principal cells displayed nuclear, both nuclear and perinuclear, or very little staining in a checkerboard-like pattern (Fig. 8F), similarly observed for SP1, a characteristic of many proteins in this tissue [3133].


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and characterizing the proximal 2243-bp of the 5' upstream region of rat 5{alpha}-reductase type 2 have revealed that the minimal promoter is in the proximal –118-bp region and that there are regions with strong repressor (–452 to –161 bp) and enhancer (–161 to –118 bp) activity; the transcriptional start site (+1) is 33-bp downstream of the start codon. Furthermore, potential transcription factors (SP1 and SP3) regulating gene expression have been identified and immunolocalized to principal cells of the epididymis. These results are summarized in Figure 9. The promoter region of rat 5{alpha}-reductase type 2 is GC rich, with a noncanonical TATA box located 30-bp upstream of the transcriptional start site and a CAAT box on the antisense strand.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 9. Schematic of the 5' upstream region of 5{alpha}-reductase type 2. This scheme incorporates the results obtained from sequential deletion analysis, primer extension, RACE, and EMSA. The rectangle at the top corresponds to the cloned 5' upstream sequence of the gene with the size of the different luciferase constructs relative to the ATG start codon at the bottom (and italicized) and relative to the transcriptional start site at the top. The shaded boxes indicate regions identified by sequential deletion as having repressor, enhancer, and minimal promoter activities. The gene sequence is shown from position –118 to +97, where a CATAAA box, a CAAT box, and the ATG start site are in bold and underlined. A number of SP1 sites (including two consensus GC boxes) are also in bold and the two SP1 binding sites shown to bind SP1 (and SP3 to a smaller extent) are depicted with an oval shaded region

We used two cell lines for our sequential deletion studies, one a mouse proximal caput epididymal cell line and the other a human prostate adenocarcinoma cell line. The mouse proximal caput cell line has recently been developed and characterized [29]; it is one of only three stable epididymal cell lines described in the literature. The other two are immortalized cells from the human fetal epididymis [34] and the dog epididymis [35]. Because the different segments of the epididymis are anatomically distinct and play different roles in the maturation of sperm, we opted for a cell line that specifically originated from the region with the highest 5{alpha}-reductase type 2 mRNA and with close homology to rat. Mouse and rat 5{alpha}-reductase type 2 share 95% sequence homology [36]. Because sequence homology between rat and human is approximately 77% [5], we used PC3 cells to determine if our findings could be applied to humans and to another tissue expressing this protein. PC3 cells are often used to study molecular events mediating hormone-responsive gene expression in the epididymis [37]. Despite the low expression levels of 5{alpha}-reductase type 2 in the two cell lines, they constitute the best tools we have so far in investigating gene regulation in the epididymis. The 5{alpha}-reductase type 2 constructs followed the same general trend in both cell lines; the only notable differences between the two were in their expression levels and in the strength of the enhancer sequences. While the PC3 cell line was initiated from the bone metastasis of a grade IV adenocarcinoma [38], the proximal caput epididymal PC1 cell line was derived from primary cultures of epididymal cells from transgenic mice harboring a temperature-sensitive simian virus 40 large T-antigen [29]. Transcription factors in cancerous cell lines such as in PC3 cells may be upregulated, thus accounting for the higher relative expression levels of the constructs. The decrease in luciferase expression levels between constructs –194-bp ATG and –151-bp ATG was most pronounced in the epididymal PC1 cell line, suggesting that this cis-acting sequence may be specific for this tissue.

Primer extension and RACE identified one transcriptional start site, a guanine that is located 33-bp upstream of the gene's translational start site. The fact that more than one nucleotide was identified by RACE suggests the presence of a TATA-less or a noncanonical TATA box promoter, as the transcriptional start site for these tend to be less precise than that of a canonical TATA box promoter. Indeed, a noncanonical TATA box is located 30-bp upstream of the transcriptional start site. Using human prostate poly(A)+ RNA, Labrie et al. [23] previously reported the transcriptional start site of 5{alpha}-reductase type 2 to be at 71 nucleotides upstream of the ATG initiating codon. Another group studying the transcriptional regulation of the gene by progesterone in the mouse brain used primer extension to identify the transcriptional start site at 89-bp upstream of the ATG start codon [36]. Thus, three studies, using different tissues from different species, identified distinct start sites. This discrepancy is quite surprising considering the high sequence homology between the species. Additionally, we found that rat and mouse share 81% sequence homology and rat and human 60% sequence homology in the 2 kb of the 5' upstream region of their 5{alpha}-reductase type 2 gene when the sequence alignment software Clustal W (http://www.ebi.ac.uk/clustalw/) was used. Despite close sequence homology and the conservation of important transcriptional elements of genes across species, the transcriptional start site does not correspond. The CATAAA box we identified as the potential noncanonical TATA box in our experiments is found downstream of the transcriptional start site identified previously but is present in the rat, mouse, and human sequence. The TATA box identified by Matsui et al. [36], however, is absent in the rat sequence and no TATA box is found upstream of the human sequence. The 5{alpha}-reductase type 2 promoter may be a TATA-less promoter where the CATAAA box is nonfunctional. The numerous GC boxes found close to the ATG start codon would support this hypothesis because they can play important roles in transcription initiation [39]. The discrepancy may also be the result of different tissues using different transcriptional start sites for tighter transcriptional regulation or of the incapability of the noncanonical TATA box to initiate transcription from only one site. The small difference in the 5' base-pair number of the 5' untranslated region may be too small to be reflected in transcript size. Using complementary methods, such as RACE and primer extension, will have to be done in mouse and human epididymis to test this hypothesis.

When the +5 to +34 (oligo 1) and the –120 to –69 (oligo 4) region of the gene were studied for potential transcription factor interactions, a specific band was consistently observed with the murine cell line nuclear extracts but not the rat caput nuclear extracts. This discrepancy in binding between the two nuclear extracts may be due to i) an upregulation of transcription factors in the cell line, ii) the absence of those transcription factors in the rat, or iii) the consequence of a dilution effect. The cell line used consists of a pure population of principal cells, the epididymal cell type that expresses 5{alpha}-reductase type 2. In contrast, many cell types and connective tissue are present in the rat caput segment, so the same interactions may be occurring but we were unable to detect them with this method.

The –68 to –32 (oligo 3) region of the gene is the region we found most interesting because a specific band was consistently observed in the presence of both the murine cell line and the rat caput nuclear extracts. This band was supershifted with the SP1 antibody and to a lesser extent with the SP3 antibody. Competition studies using mutated fragments showed that SP1 is principally binding to the consensus GC box located at position –58 to –55.

Both SP1 and SP3 belong to the Sp subgroup of the Sp/ XKLF (specificity protein/Krüppel-like factor) family of transcription factors. This family shares a DNA-binding domain with three conserved Cys2His2 zinc fingers and is involved in growth-regulatory or developmental processes of a large number of tissues [40]. The Sp protein subgroup additionally shares similar N-terminal motifs [41]. SP1 and SP3 bind with similar affinities to the GC/GT boxes that are commonly found in many gene promoters, including those of housekeeping genes [41]. Despite being ubiquitously expressed, they displayed distinct patterns of expression between the different segments of the epididymis and were predominantly expressed in the nuclei of principal cells, the cell type expressing 5{alpha}-reductase type 2 [15]. This latter observation could be anticipated considering the roles of principal cells in this tissue [13]. The different staining intensities and the subcellular localization from one epididymal segment to another were not unexpected. While the caput epididymidis exhibits only nuclear localization for both transcription factors, the cauda segment displays perinuclear staining as well, suggesting differential regulation of SP1 and SP3 within this tissue. SP1 is one of the most potent transcriptional activators characterized to date, and it can stimulate transcription from both proximal promoters and distal enhancers [42]. SP1 can interact with other factors in the same multigene family as well as those from other families, including steroidogenic factor-1, p53, signal transducer and activator of transcription-1, GATA-1, activating protein-1, nuclear factor-11B, and estrogen receptor [4349]. These interactions along with the levels of SP1 could potentially explain the region-specific expression of genes regulated by SP1. For instance, SP1 and polyomavirus enhancer activator 3 (PEA3) are required for promoter activity of the TATA-less {gamma}-glutamyl transpeptidase (GGT) promoter IV gene in the rat epididymis. Both GGT and PEA3 are highly expressed in the initial segment of this tissue and they regulate transcription via possible interactions of SP1 and PEA3 with each other and/or with components of the general transcriptional complex [50]. We have observed intense SP1 immunostaining in the initial segment of the epididymis. In TATA-less promoters, the binding of SP1 to GC boxes is critical for transcription initiation and is often directed from multiple sites. Both SP1 and SP3, through their glutamine-rich regions within the amino termini, can interact with components of the general transcription factor TAFII130 to activate transcription [51]. SP3 has been shown to function as both a competitive repressor of SP1-induced transcription [52] and a strong activator of transcription under different conditions [41]. It is still not clearly understood why, but the SP1:SP3 ratio is thought to play an important role in the regulation of transcription. Increasing the SP1:SP3 ratio is generally correlated with the increased expression of response genes where those genes are activated by SP1 and repressed by SP3 (reviewed in [41]). In the caput epididymidis, SP1 immunostaining is more intense for SP1 than SP3, suggesting a high ratio. Thus, despite having identified ubiquitous transcription factors interacting with 5{alpha}-reductase type 2, the expression levels of SP1 and the SP1:SP3 ratio in the principal cells of the caput epididymidis could partly account for the regionalization displayed by this gene.

Identifying the transcription factors interacting with SP1 and/or binding to other sites found in the 5' upstream region of the gene would also help resolve the transcriptional mechanisms that govern the region- and cell-specific expression of 5{alpha}-reductase type 2 in the epididymis. It could help elucidate some of the molecular mechanisms governing other spatially restricted genes expressed in the epididymis, thus allowing for a better understanding of this tissue. These genes include GGT mRNA IV, PEA3, glutathione peroxidase 5, epididymal protease inhibitor, and cystatin-related epididymal-specific protein [50, 5356]. The regionalization displayed by those genes may be the result of segment-specific expression of epididymal transcription factors or of segment-specific interactions between ubiquitously expressed transcription factors.

In conclusion, these data represent the first characterization of the 5' upstream region of 5{alpha}-reductase type 2, and our findings form the basis from which future studies can be designed to study the transcriptional regulation of the gene.


    ACKNOWLEDGMENTS
 
We would like to thank Dr. Charles Kasper for providing us with the rat genomic library, Dr. David W. Russell for his generous gift of the partial 5{alpha}-reductase type 2 cDNA, Dr. Yannick Blanchard for screening the rat genomic DNA and providing us with a plasmid containing the 5' upstream region of 5{alpha}-reductase type 2, and Mahsa Hamzeh for perfusing the rats. The mouse proximal caput epididymal PC1 cell line was a generous gift from Dr. Marie-Claire Orgebin-Crist. We are grateful to Dr. Robert Viger for his invaluable advice.


    FOOTNOTES
 
1 Supported by a grant from CIHR. Back

2 Correspondence: Department of Obstetrics and Gynecology, McGill University, 3655 Promenade Sir William Osler, Montreal, PQ, Canada H3G 1Y6. FAX: 514 398 7120; bernard.robaire{at}mcgill.ca Back

Received: 29 June 2004.

First decision: 20 July 2004.

Accepted: 9 November 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wilson JD. Metabolism of testicular androgens. Handbook Physiol 1975 5:491-508
  2. Wilson JD. Sexual differentiation. Annu Rev Physiol 1978 40:279-306[CrossRef][Medline]
  3. Wilson JD. The pathogenesis of benign prostatic hyperplasia. Am J Med 1980 68:745-756[CrossRef][Medline]
  4. McConnell JD, Wilson JD, George FW, Geller J, Pappas F, Stoner E. Finasteride, an inhibitor of 5 alpha-reductase, suppresses prostatic dihydrotestosterone in men with benign prostatic hyperplasia. J Clin Endocrinol Metab 1992 74:505-508[Abstract]
  5. Russell DW, Wilson JD. Steroid 5 alpha-reductase: two genes/two enzymes. Annu Rev Biochem 1994 63:25-61[Medline]
  6. Bingham KD, Shaw DA. The metabolism of testosterone by human male scalp skin. J Endocrinol 1973 57:111-121[Medline]
  7. Thiboutot D, Harris G, Iles V, Cimis G, Gilliland K, Hagari S. Activity of the type 1 5 alpha-reductase exhibits regional differences in isolated sebaceous glands and whole skin. J Invest Dermatol 1995 105:209-214[CrossRef][Medline]
  8. Takayasu S, Wakimoto H, Itami S, Sano S. Activity of testosterone 5 alpha-reductase in various tissues of human skin. J Invest Dermatol 1980 74:187-191[CrossRef][Medline]
  9. Serafini P, Lobo RA. Increased 5 alpha-reductase activity in idiopathic hirsutism. Fertil Steril 1985 43:74-78[Medline]
  10. Wilson JD, Gloyna RE. The intranuclear metabolism of testosterone in the accessory organs of reproduction. Recent Prog Horm Res 1970 26:309-336
  11. Robaire B, Hermo L. Efferent ducts, epididymis, and vas deferens: structure, functions, and their regulation. In: Knobil E, Neill J, (eds.), The Physiology of Reproduction. New York: Ravel Press; 1988:999– 1080
  12. Reid B, Cleland K. The structure and function of the epididymis. 1. The histology of the rat epididymis. Austr J Zool 1957; 5:223–246
  13. Robaire B, Viger RS. Regulation of epididymal epithelial-cell functions. Biol Reprod 1995 52:226-236[Abstract]
  14. Berman DM, Russell DW. Cell-type-specific expression of rat steroid 5 alpha-reductase isozymes. Proc Natl Acad Sci U S A 1993 90:9359-9363[Abstract/Free Full Text]
  15. Silver RI, Wiley EL, Thigpen AE, Guileyardo JM, McConnell JD, Russell DW. Cell-type-specific expression of steroid 5-alpha-reductase 2. J Urol 1994 152:438-442[Medline]
  16. Andersson S, Bishop RW, Russell DW. Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation. J Biol Chem 1989 264:16249-16255[Abstract/Free Full Text]
  17. Andersson S, Berman DM, Jenkins EP, Russell DW. Deletion of steroid 5 alpha-reductase 2 gene in male pseudohermaphroditism. Nature 1991 354:159-161[CrossRef][Medline]
  18. Andersson S, Russell DW. Structural and biochemical properties of cloned and expressed human and rat steroid 5 alpha-reductases. Proc Natl Acad Sci U S A 1990 87:3640-3644[Abstract/Free Full Text]
  19. Normington K, Russell DW. Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions. J Biol Chem 1992 267:19548-19554[Abstract/Free Full Text]
  20. Jenkins EP, Andersson S, Imperato-McGinley J, Wilson JD, Russell DW. Genetic and pharmacological evidence for more than one human steroid 5 alpha-reductase. J Clin Invest 1992 89:293-300
  21. Thigpen AE, Davis DL, Milatovich A, Mendonca BB, Imperato-McGinley J, Griffin JE, Francke U, Wilson JD, Russell DW. Molecular genetics of steroid 5 alpha-reductase 2 deficiency. J Clin Invest 1992 90:799-809
  22. Jenkins EP, Hsieh CL, Milatovich A, Normington K, Berman DM, Francke U, Russell DW. Characterization and chromosomal mapping of a human steroid 5 alpha-reductase gene and pseudogene and mapping of the mouse homologue. Genomics 1991 11:1102-1112[CrossRef][Medline]
  23. Labrie F, Sugimoto Y, Luu-The V, Simard J, Lachance Y, Bachvarov D, Leblanc G, Durocher F, Paquet N. Structure of human type II 5 alpha-reductase gene. Endocrinology 1992 131:1571-1573[Abstract]
  24. Wigley WC, Prihoda JS, Mowszowicz I, Mendonca BB, New MI, Wilson JD, Russell DW. Natural mutagenesis study of the human steroid 5 alpha-reductase 2 isozyme. Biochemistry 1994 33:1265-1270[CrossRef][Medline]
  25. Thigpen AE, Silver RI, Guileyardo JM, Casey ML, McConnell JD, Russell DW. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. J Clin Invest 1993 92:903-910
  26. Viger RS, Robaire B. The mRNAs for the steroid 5 alpha-reductase isozymes, types 1 and 2, are differentially regulated in the rat epididymis. J Androl 1996 17:27-34[Abstract/Free Full Text]
  27. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. Current Protocols in Molecular Biology. New York: John Wiley and Sons; 1988
  28. Serre V, Robaire B. Distribution of immune cells in the epididymis of the aging Brown Norway rat is segment-specific and related to the luminal content. Biol Reprod 1999 61:705-714[Abstract/Free Full Text]
  29. Araki Y, Suzuki K, Matusik RJ, Obinata M, Orgebin-Crist MC. Immortalized epididymal cell lines from transgenic mice overexpressing temperature-sensitive simian virus 40 large T-antigen gene. J Androl 2002 23:854-869[Abstract/Free Full Text]
  30. Saksena SK, Lau IF, Chang MC. Age dependent changes in the sperm population and fertility in the male rat. Exp Aging Res 1979 5:373-381[Medline]
  31. Viger RS, Robaire B. Immunocytochemical localization of 4-ene steroid 5 alpha-reductase type 1 along the rat epididymis during postnatal development. Endocrinology 1994 134:2298-2306[Abstract]
  32. Papp S, Robaire B, Hermo L. Immunocytochemical localization of the Ya, Yc, Yb1, and Yb2 subunits of glutathione S-transferases in the testis and epididymis of adult rats. Microsc Res Tech 1995 30:1-23[CrossRef][Medline]
  33. Douglass J, Garrett SH, Garrett JE. Differential patterns of regulated gene expression in the adult rat epididymis. Ann N Y Acad Sci 1991 637:384-398[Abstract]
  34. Coleman L, Harris A. Immortalization of male genital duct epithelium: an assay system for the cystic fibrosis gene. J Cell Sci 1991 98:pt 185-89[Abstract/Free Full Text]
  35. Telgmann R, Brosens JJ, Kappler-Hanno K, Ivell R, Kirchhoff C. Epididymal epithelium immortalized by simian virus 40 large T antigen: a model to study epididymal gene expression. Mol Hum Reprod 2001 7:935-945[Abstract/Free Full Text]
  36. Matsui D, Sakari M, Sato T, Murayama A, Takada I, Kim M, Takeyama K, Kato S. Transcriptional regulation of the mouse steroid 5alpha-reductase type II gene by progesterone in brain. Nucleic Acids Res 2002 30:1387-1393[Abstract/Free Full Text]
  37. Lareyre JJ, Reid K, Nelson C, Kasper S, Rennie PS, Orgebin-Crist MC, Matusik RJ. Characterization of an androgen-specific response region within the 5' flanking region of the murine epididymal retinoic acid binding protein gene. Biol Reprod 2000 63:1881-1892[Abstract/Free Full Text]
  38. Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, Jones LW. Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Invest Urol 1979 17:16-23[Medline]
  39. Fry CJ, Farnham PJ. Context-dependent transcriptional regulation. J Biol Chem 1999 274:29583-29586[Free Full Text]
  40. Philipsen S, Suske G. A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res 1999 27:2991-3000[Abstract/Free Full Text]
  41. Bouwman P, Philipsen S. Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 2002 195:27-38[CrossRef][Medline]
  42. Courey AJ, Holtzman DA, Jackson SP, Tjian R. Synergistic activation by the glutamine-rich domains of human transcription factor Sp1. Cell 1989 59:827-836[CrossRef][Medline]
  43. Liu Z, Simpson ER. Steroidogenic factor 1 (SF-1) and SP1 are required for regulation of bovine CYP11A gene expression in bovine luteal cells and adrenal Y1 cells. Mol Endocrinol 1997 11:127-137[Abstract/Free Full Text]
  44. Koutsodontis G, Tentes I, Papakosta P, Moustakas A, Kardassis D. Sp1 plays a critical role in the transcriptional activation of the human cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by the p53 tumor suppressor protein. J Biol Chem 2001 276:29116-29125[Abstract/Free Full Text]
  45. Look DC, Pelletier MR, Tidwell RM, Roswit WT, Holtzman MJ. Stat1 depends on transcriptional synergy with Sp1. J Biol Chem 1995 270:30264-30267[Abstract/Free Full Text]
  46. Merika M, Orkin SH. Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Kruppel family proteins Sp1 and EKLF. Mol Cell Biol 1995 15:2437-2447[Abstract]
  47. Noti JD, Reinemann BC, Petrus MN. Sp1 binds two sites in the CD11c promoter in vivo specifically in myeloid cells and cooperates with AP1 to activate transcription. Mol Cell Biol 1996 16:2940-2950[Abstract]
  48. Perkins ND, Agranoff AB, Pascal E, Nabel GJ. An interaction between the DNA-binding domains of RelA(p65) and Sp1 mediates human immunodeficiency virus gene activation. Mol Cell Biol 1994 14:6570-6583[Abstract/Free Full Text]
  49. Porter W, Wang F, Wang W, Duan R, Safe S. Role of estrogen receptor/Sp1 complexes in estrogen-induced heat shock protein 27 gene expression. Mol Endocrinol 1996 10:1371-1378[Abstract]
  50. Lan ZJ, Lye RJ, Holic N, Labus JC, Hinton BT. Involvement of polyomavirus enhancer activator 3 in the regulation of expression of gamma-glutamyl transpeptidase messenger ribonucleic acid-IV in the rat epididymis. Biol Reprod 1999 60:664-673[Abstract/Free Full Text]
  51. Gill G, Pascal E, Tseng ZH, Tjian R. A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proc Natl Acad Sci U S A 1994 91:192-196[Abstract/Free Full Text]
  52. Hagen G, Muller S, Beato M, Suske G. Sp1-mediated transcriptional activation is repressed by Sp3. EMBO J 1994 13:3843-3851[Medline]
  53. Lan ZJ, Palladino MA, Rudolph DB, Labus JC, Hinton BT. Identification, expression, and regulation of the transcriptional factor polyomavirus enhancer activator 3, and its putative role in regulating the expression of gamma-glutamyl transpeptidase mRNA-IV in the rat epididymis. Biol Reprod 1997 57:186-193[Abstract]
  54. Vernet P, Faure J, Dufaure JP, Drevet JR. Tissue and developmental distribution, dependence upon testicular factors and attachment to spermatozoa of GPX5, a murine epididymis-specific glutathione peroxidase. Mol Reprod Dev 1997 47:87-98[CrossRef][Medline]
  55. Sivashanmugam P, Hall SH, Hamil KG, French FS, O'Rand MG, Richardson RT. Characterization of mouse Eppin and a gene cluster of similar protease inhibitors on mouse chromosome 2. Gene 2003 312:125-134[CrossRef][Medline]
  56. Cornwall GA, Orgebin-Crist MC, Hann SR. The CRES gene: a unique testis-regulated gene related to the cystatin family is highly restricted in its expression to the proximal region of the mouse epididymis. Mol Endocrinol 1992 6:1653-1664