Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print December 22, 2004.
Biol Reprod 2004, 10.1095/biolreprod.104.034801
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/4/960    most recent
biolreprod.104.034801v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.
Agricola
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.
BIOLOGY OF REPRODUCTION 72, 960–967 (2005)
DOI: 10.1095/biolreprod.104.034801
© 2005 by the Society for the Study of Reproduction, Inc.

Identification of Differentially Regulated Genes During Elongation and Early Implantation in the Ovine Trophoblast Using Complementary DNA Array Screening1

L. Cammas, P. Reinaud, O. Dubois, N. Bordas, G. Germain, and G. Charpigny2,

Biologie du Développement et de la Reproduction, INRA, Centre de Recherches de Jouy, 78352 Jouy en Josas Cedex, France


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Following hatching, pre-elongated conceptuses undergo elongation by intense proliferation, until implantation. We investigated the changes in gene expression associated with these physiological events using human cDNA arrays containing 2370 known genes. Comparison of pre-elongated, elongated, and implanting trophoblasts allowed the determination of 313 expressed genes, 63 of which were differentially regulated. These were classified into four functional families. Pre-elongated trophoblasts were characterized by preferential expression of genes involved in protein trafficking, whereas only latter developmental stages expressed cell signaling genes and receptors. Among the 63 developmentally regulated genes, four exhibited the highest levels of expression (TMSB10, CTNNA1, NMP1, and CX3CL1). Each of these also represents a functional family and display a specific expression pattern. One of them, CX3CL1 (CX3C chemokine, also known as fractalkine), is a chemokine that seems to have potential importance in trophoblast development, and which deserves further clarification of its role in implantation.

early development, embryo, gene regulation, implantation, trophoblast


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The trophoblast acts as an interface between the embryo and the uterus, and supports successful development of the embryo. In the sheep, elongation of the trophoblast occurs by Day 11 and gives rise to a filamentous structure, which is more than 10 cm long at Day 14. Elongation ends when the embryo is immobilized in the uterine lumen at Day 14, and implantation starts at Day 15 [1]. Structural and morphological modifications of the trophoblast are controlled by uncharacterized changes in the expression of its genetic program [2].

Successful pregnancy and conceptus development results from embryo-maternal cross-talk [1]. Elongation of the trophoblast is under control of maternal environment, as it occurs neither in vitro [3] nor in ewes deprived of endometrial glands [4]. During this period, the trophoblast secretes interferon-tau (IFN{tau}), which is the ruminant-specific maternal recognition of pregnancy factor. IFN{tau} mediates the modification of the maternal endocrinology that allows for corpus luteum maintenance, and thus continuation of conceptus development [5]. Another less studied function of the trophoblast is its ability to sustain the survival of the embryo before the placenta forms. During the time the conceptus develops in the uterus, the trophoblast displays a high capacity to absorb extracellular material [1, 6], and trophoblast elongation corresponds to a state of intense cellular multiplication. Growth factors and prostaglandins have been associated with proliferation [7–9]. Transforming growth factor-ß1 and -ß2 increase dramatically in the sheep conceptus during this moment [10], and bovine embryos express large amounts of insulin growth factor (IGF) II and the mRNAs for IGF receptors I and II after hatching [11]. Implanting ovine conceptuses at Day 14 produce prostaglandins F2{alpha}, E2, and prostacyclin [12]. They are produced by the cyclooxygenase (COX) enzymatic pathway. The COX-2 isoform displays a transient and regulated expression in the sheep trophoblast [12].

In ruminant species, implantation is limited to the uterine luminal epithelium which fuses with the trophoblast to form syncitia. Implantation corresponds to the end of the elongation state and an evolution toward a functional and structural differentiation of cells. A balance between secretion of matrix metalloproteases (MMPs) that can degrade components of the extracellular matrix, and tissue inhibitors of MMPs (TIMPs) is necessary for successful implantation. Ovine trophoblasts specifically express MMP-2 and MMP-9, whereas the endometrium expresses TIMPs [2]. By this time, IFN{tau} expression diminishes to become extinguished after implantation and new molecules, placental lactogens, and pregnancy-specific proteins, are released from the trophoblast to the maternal tissues [1, 5].

As suggested by the modification in gene expression for these candidates genes, the transcript content of the trophoblast is differentially regulated during elongation and implantation. New transcriptomic methods allow for simultaneous detection of thousands of transcripts from a tissue and could unravel the gene expression supporting conceptus early development. So far, large-scale gene expression analysis of the implantation period has been performed mainly on the uterine compartment in humans [13], mice [14], and cattle [15]. In their studies of the embryo, Tanaka et al. [16] and Kelly and Rizzino [17] focused on loss of pluripotentiality and differentiation of cell lineages in mice by studying whole embryos and cell cultures, whereas Aronow et al. [18] studied trophoblast differentiation in third-trimester human placentas.

One of the major concerns in the study of ruminants is the lack of commercially available cDNA arrays for gene expression profiling. However, bovine oocytes [19] and luteal tissues [20] have been studied using a human array by Clontech or a rat array by Amersham, respectively. These heterologous cDNA array analyses allowed the detection of differentially expressed genes. The purpose of the study was to compare the gene expression profile of ovine pre-elongated, elongated, and implanting trophoblast using human cDNA arrays, and we confirm here the interest of this heterologous gene screening in ruminants.


   MATERIAL AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Sample Collection and RNA Preparation

All procedures related to the care and use of animals were approved by the French Ministry of Agriculture according to French regulations (Instruction 19.04.1988) for animal experimentation.

Ewes of the Préalpes-du-Sud breed were used. Estrus was synchronized using intravaginal sponges containing 60 mg 6{alpha}-methyl-17{alpha}-acetoxyprogesterone (Intervet, Angers, France) for 14 days. On the day of sponge withdrawal, the ewes received one injection of 400 IU of PMSG (Intervet). Estrus was observed 48 hr later (D0), and the ewes were mated twice. On Days 12, 14, and 15 of pregnancy, the ewes were slaughtered. The uterus was removed and the embryos were flushed with PBS at 37°C. Conceptuses were carefully examined under binoculars and their age was confirmed by size determination. Pre-elongated, elongated, and implanting conceptuses are referred to as D12, D14, and D15, respectively. Embryonic masses were excised and the trophoblasts were immediately frozen in liquid nitrogen and stored at –80°C until further analysis. Total RNA was extracted by a phenol-based method derived from data presented by Chomczynski and Sacchi [21] and quantified by spectrophotometry. RNA integrity was verified by nondenaturing agarose electrophoresis.

Macroarray Hybridization

Three replicate experiments were performed for each developmental stage using pools of 3 to 23 conceptuses. Total RNA was treated with RNase-free DNase I (Promega France, Charbonnière les bains, France) and purified. Seven to 25 µg of D12, D14, and D15 RNA were subjected to poly A+ purification with streptavidin-coated magnetic beads and biotinylated oligo(dT). Radioactive cDNA probes (3 to 8 x 106 cpm) were produced (Atlas Pure Total RNA Labeling System; Clontech, Ozyme, Montigny, France) from RNA by reverse transcription (RT) in the presence of specific primers and {alpha}-33P-dATP (Amersham Bioscience, Orsay, France). Specific priming was preferred over oligo(dT) and random priming to limit the background and aspecific hybridization to the spots. This priming, however, restricted the analysis to only those genes that were highly conserved between humans and sheep. Clontech Atlas cDNA Human 1.2 (7850-1; Clontech) and 1.2.II (7852-1; Clontech) expression arrays were used. Array membranes were hybridized overnight with labeled probes at 68°C and then washed with 0.1x SSC and 0.5% SDS. The membranes were exposed for 14 days to a phosphor imaging screen. Arrays were visualized after scanning with a phosphorImager (FLA 3000; Fujifilm, Courbevoie, France) and the signals were quantified with Advanced Image Data Analyzer software (Raytest, Courbevoie, France).

Macroarray Data Analysis

The background-subtracted intensity was measured for all the spots (referred as gene intensity). The gene intensity was then compared with the local background. Data were expressed as percents of the sum of all gene intensity and arbitrarily multiplied by 10 000 (referred as normalized gene intensity). Genes were selected for the final analysis when at least 2/3 of the replicates exhibited a gene intensity higher than their corresponding local background. These genes are designed as expressed.

Expressed genes whose expression varied significantly between the three developmental stages (one-way analysis of variance [ANOVA], P < 0.05) were sorted and normalized (log-transformed, centered relative to the median and gene-to-gene normalized). These genes were termed differentially expressed. Genes and arrays were classified according to similarity in pattern using complete-linkage hierarchical clustering of an uncentered Pearson correlation similarity matrix (Cluster software) and visualized with TreeView software [22] (available at http://rana.lbl.gov/EisenSoftware.htm). Control spots for genomic or exogenous contamination raised negative signals in all hybridization experiments. Hybridization produced signals of variable intensities, ranging from limit of detection to limit of saturation.

Synthesis of Ovine cDNA for CX3CL1, NPM1, CTNNA1, TMSB10, and IGFBP1

Reverse transcription was performed on 1 µg of total RNA at 37°C with oligo(dT) primer and MMLV reverse transcriptase (Invitrogen, Cergy Pontoise, France). Reaction mixtures for polymerase chain reaction (PCR), including Taq polymerase (QBioGen, Illkirch, France) were prepared as suggested by the manufacturer. PCR details are shown in Table 1. The identity of all PCR products was confirmed by DNA sequencing (Genome Express, Montreuil, France) and sequence homology analysis using the Basic Local Alignment Search Tool [23]. These fragments were used to design real-time PCR primers, quantified templates for the real-time PCR standard curves, and to generate the radio-labeled probe for CX3CL1.


View this table:
[in this window]
[in a new window]
  		TABLE 1. PCR conditions and primers

Quantification of the Selected Transcripts

Four independent trophoblast samples were analyzed in duplicate for each developmental stage.

Real-time PCR was performed as follows. The reaction mixture included 5% of the RT products, SYBR green Master Mix (Applied Biosystem, Les Ulis, France) and 0.3 µM of gene-specific oligonucleotide primer, as suggested by the manufacturer. Primers were designed using Primer Express software (Applied Biosystem): 1) NPM1, forward GTGAGAACTTTCCCTACCGTGTCT, reverse GGCAATGGAACGTGGACAAC; 2) TMSB10, forward TGAGATTTTCCGCGAACCTG, reverse GGTCTCCAAGATGATGCGGT; 3) CTNNA1, forward CGCAAAGCTGTCATGGACC, reverse CATTTCCATTCTTCGCAGCC; and as stated in Table 1 for IGFBP1 and ACTB. Standard curves were generated in parallel using serial dilutions of the purified PCR product as a polymerase template. The reactions were run on an ABI Prism 7000HT (Applied Biosystem). The presence of a specific and unique PCR product was verified by an ABI Prism-generated melting curve profile. Relative quantification of initial amounts of target was extrapolated from the respective standard curve.

CX3CL1 is known for alternative splicing [24] and the use of several pairs of primers did not allow for amplification of a single fragment. Semiquantitative PCR and visualization on agarose gel allowed for densitometric quantification of the band of interest. To demonstrate the linearity of amplification and to allow for semiquantitative comparisons, 27, 30, and 33 cycles were performed. PCR products were electrophoresed on 2% agarose, transferred onto a Hybond N+ nylon filter (Amersham Biosciences) and hybridized overnight in Church medium with a specific {alpha}32P-dCTP labeled probe. After washing (0.1x SSC and 0.1% SDS), the filter was scanned with an FLA3000 (Fujifilm) phosphorImager. Signals were quantified using AIDA software (Raytest).

Normalization of Selected Transcript Expression

No significant difference of expression for ACTB (ß-actin) was detected (ANOVA, P < 0.05) between D12, D14, and D15 trophoblasts using either arrays, or semiquantitative or real-time PCR. For each sample investigated by PCR, the target gene expression values were therefore normalized to the corresponding value for ACTB.

In Situ Hybridization

The IGFBP1 PCR product was cloned into pCR4TOPO vector (TOPO TA Cloning Kit; Invitrogen) according to the manufacturer's instructions. The plasmid vector includes T3 and T7 RNA polymerase promoters. The construction was sequence-verified and the insertion direction was determined. The digoxigenin (DIG)-labeled uridine triphosphate cRNA probes were generated from PCR templates by in vitro transcription using T7 polymerase for antisense and T3 polymerase for sense according to the manufacturer's protocols (Promega, France).

The in situ hybridization procedure was performed as described elsewhere [25]. Ten-micrometer-thick frozen sections from tissues fixed with 4% paraformaldehyde were delipidized with chloroform and rehydrated. Pretreatment and hybridization of slides with antisense and sense probes (100 µl of 200 ng/ml) were performed via standard in situ hybridization procedures. Hybrids formed in situ were revealed using a DIG-RNA detection kit (Promega, France) with a sheep anti-DIG-alkaline phosphatase-conjugated antibody and the substrates NBT/BCIP. Three sections at least of each specimen were used. Photomicroscopy was performed using an Olympus-DP50 microscope, digital camera system and software (Olympus SA, Rungis, France).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Array Analysis

The array experiment was conducted independently on three samples of each developmental stage (i.e., pre-elongated, elongated, and implanting trophoblasts). No difference in normalized gene intensity distribution between the three developmental stages was observed. Reproducibility was examined for the replicate experiments. Figure 1 shows the intensity of each data point for one D14 experiment plotted against another D14 replicate. High-intensity signals were more reproducible than signals of weak intensity.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1. Intensities of the spots for two replicate experiments with type 1.2 array membranes. Each dot represents a gene, its coordinates being its expression value for each sample. (a and b). Line: 95% prediction interval. Left panel: all the genes are plotted (1185). Right panel: only the expressed genes (192) as defined in Materials and Methods

Expression Profiling

Of the 2370 genes on the arrays, 313 were expressed above background for at least one of the three developmental stages according to our gene selection scheme. An ANOVA test (P < 0.05) was performed to determine genes whose expression varied significantly during development. Sixty-three out of 313 (20%) were differentially expressed; the remaining (250 genes) exhibited the same level of expression at D12, D14, and D15. Therefore, only a small portion of genes specifically escort the elongation and implantation processes.

The 250 genes expressed but not differentially regulated in the trophoblast included characteristic trophoblastic- or placental-specific genes. Among the genes were those for prostaglandin D2 synthase (PGD2S), MMP11, TIMP1, fibroblast growth factor receptor (FGFR1), placental growth factors 1 and 2 (PlGF 1 and PlGF 2), and a few homeobox genes (CDX2, EMX1, PITX2, and SIX1).

Hierarchical Clustering of Differentially Expressed Genes

Clustering analysis was performed to classify the differentially expressed genes according to their pattern of expression. Only the 63 differentially expressed genes were used to avoid dilution effects. Hierarchical clustering based on arrays gave rise to Figure 2. Three main nodes were observed, each grouping the three replicate experiments at each developmental stage. This tree emphasized the reproducibility and validated the gene selection scheme. Hierarchical clustering based on genes gave rise to Figure 3. Three nodes were observed of gene groupings that were 1) highly expressed at D12 (29 genes), 2) highly expressed at D14 (22 genes), or 3) highly expressed at D15 (12 genes). Regulated genes were highly expressed only on one of the 3 days.



View larger version (7K):
[in this window]
[in a new window]
  		FIG. 2. Hierarchical clustering of the 63 differentially expressed genes as determined by ANOVA (P < 0.05) and applying the Cluster algorithm by Eisen et al. [22]. Background subtracted values were log-transformed, centered relative to the median, and gene-to-gene normalized. Clustering was applied on the developmental stage axis (deliberately ignoring the age of the trophoblasts). Notice the closest position of D12 and D15 stages relative to the D14 stage. a–c) The three replicates. D12, pre-elongated trophoblast; D14, elongated trophoblast; D15, implanting trophoblast



View larger version (78K):
[in this window]
[in a new window]
  		FIG. 3. Hierarchical clustering analysis of the 63 differentially expressed genes using the Cluster algorithm by Eisen et al. [22]. Background subtracted values were log-transformed, centered relative to the median, and gene-to-gene normalized. Genes are classified into four families that display a differential representation among the clusters

Families of Differentially Expressed Genes

Each gene was assigned in a functional class according to Online Mendelian Inheritance in Man (OMIM) data [26]. Four major classes were represented: 1) apoptosis, oncogene, and cell cycle genes; 2) protein trafficking genes; 3) cell signaling genes and receptors; and 4) extracellular matrix and cell adhesion genes. All the genes that could not be classified under one of these categories were grouped as other genes.

The best represented family among the differentially expressed genes (24%) grouped apoptosis, oncogene, and cell cycle genes. These genes were equally represented in the three nodes. The family that includes extracellular matrix and cell adhesion genes (8%) was similarly found in all three nodes. The family of cell signaling genes and receptors and the family of protein trafficking genes were equally represented (19% and 17%, respectively). Their distribution pattern among the three nodes was, however, different. Protein trafficking genes showed a high expression at D12 only, whereas cell signaling genes were highly expressed on D14 and D15.

Gene Expression Evaluation Using RT-PCR

To further validate the expression patterns detected by macroarray analysis, expression levels of five genes representing distinct nodes and gene families were assessed with PCR methods.

Four of these genes, TMSB10 (thymosin-ß10), NPM1 (nucleophosmin 1), CTNNA1 (catenin-{alpha}), and CX3CL1 (CX3C chemokine, also known as fractalkine) were chosen because each exhibited a typical expression pattern among developmental stages. IGFBP1 (insulin growth factor binding protein 1) was also included in the analysis because of its trophoblastic location, which was in conflict with previously published results [27]. All the genes tested were amplified from trophoblast (Fig. 4), thereby confirming the results of the arrays.



View larger version (8K):
[in this window]
[in a new window]
  		FIG. 4. Comparison of gene expression detected on the macroarray and using PCR methods. Ordinates are expressed as percentages of the maximal value to allow for comparison. TMSB10, CTNNA1, and NPM1 transcripts were assessed using real-time PCR and CX3CL1 was assessed using semiquantitative PCR. All PCR values are normalized to ß-actin

CTNNA1 was more expressed as development progressed from D12 to D15. This pattern was found to be significant using data from the arrays and a similar tendency, although not significant, was revealed using PCR (P > 0.05). TMSB10, NPM1, and CX3CL1 exhibited differential expression (P < 0.05) among conceptus development, the patterns of which were the same as those evidenced by the arrays. TMSB10 was up-regulated in D15 implanting trophoblasts, whereas it showed similar levels of expression on D12 and D14. On the other hand, a down-regulated pattern of expression was shown for NPM1, which was more expressed on D12 in pre-elongated conceptuses than it was on D14 and D15. Both PCR and array methods agreed, indicating a typical transient up-regulation pattern of expression, which peaked on D14 for CX3CL1.

PCR for IGFBP1 demonstrated significant differences between the three stages of development (P = 0.03). IGFBP1 was found to be less expressed on D15 compared with D14 using PCR and arrays. However, the pattern of expression obtained via PCR was slightly different between D12 and D14 from the pattern evidenced with the arrays. In situ hybridization of IGFBP1 (Fig. 5) was performed on D14 embryos and uteri. Negative control with sense probes raised no signal. IGFBP1 mRNAs were present in the trophoblastic cells. In the uterus, it was detected only in epithelial luminal cells.



View larger version (85K):
[in this window]
[in a new window]
  		FIG. 5. In situ hybridization of IGFBP1 on ovine elongated embryo (A and C) or pregnant endometrium (B and D). C and D) Negative control with sense probes. T, trophoblast; LE, luminal epithelium. Bar = 50 µm


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Pre-elongated, elongated, and implanting ovine trophoblasts were tested for gene expression using the Human Clontech Atlas array system. This array system is composed of two membranes, each containing 1185 different genes.

Technical issues were examined. Heterologous hybridization could have impaired the results by generating many weakly hybridized spots. However, the intensity distribution pattern of our data was comparable to that of other studies using homologous hybridization and much larger data sets [28, 29]. The synthesis of a specific transcript cDNA in the complex radio-labeled probe also depends on the local homology between the ovine mRNA and the human-specific primer. The hybridization between the ovine probe and the human target spot relies on the degree of homology between the two. Therefore, strict criteria for data analysis were applied to discard weak signals as described in Materials and Methods. From the 2370 genes, only 313 (13% of the total) were expressed above background for at least one of the three developmental stages studied. These 313 genes were thus retained for further analysis according to our data selection scheme. The number of genes analyzed was limited in scope by the specific priming method. This small number of expressed genes is further explained by the composition of the arrays as the Atlas Human Expression Array covers a broad range of biological processes, not necessarily related to reproductive physiology and development or embryology. Staging of the embryos and natural individual variability could have also obscured real differences in gene expression because of excessive variance between replicates. An ANOVA test (P < 0.05) eliminated poorly reproducible data, and finally, 63 genes could be considered as differentially expressed. When hierarchical clustering was applied and the age of the conceptuses was deliberately ignored, trophoblasts of the same developmental stage were grouped together. The genes specifically expressed at one stage exhibited reproducible intensity levels, hence leading to the conclusion that the age of each trophoblast was correctly uncovered.

The purpose of our study was to identify the major cell functions solicited in a developing embryo. It also allowed the detection of genes that had not been previously described as actors in embryo development. Our results provide an overall view of the important molecular events contributing to elongation and implantation of the trophoblast, and a global transcriptomic signature can be described. Groups of 29, 22, and 12 up-regulated genes were characteristic of pre-elongated, elongated, and implanting trophoblasts, respectively. Regulated genes were detected at only one of the three developmental stages. A small number of genes was induced transiently and sequentially during trophoblast elongation and apposition to the uterus. In the human uterus it was demonstrated that during the window of implantation, a large proportion of genes are repressed, while only a small number of genes are induced compared with that of the late proliferative phase [13]. The same pattern was observed in bovine pregnant caruncular areas compared with the endometrium of the estrus cycle [15]. Appropriate communication and reciprocal regulations between the embryo and maternal compartments are the basis for successful implantation. This dialogue has to be first mediated by soluble factors produced and secreted in a bidirectional fashion. Only when direct contact is established can specific cell-to-cell interactions occur [1, 8, 30]. Cluster analysis revealed common patterns of regulation. The clusters were enriched and depleted of specific functional classes, indicating that temporal expression patterns correlate with functions. The two gene families 1) apoptosis, oncogene, and cell cycle genes; and 2) extracellular matrix and cell adhesion genes (e.g., DAG1, dystroglycan) were highly expressed at the three developmental stages studied. This is consistent with the elongation and proliferation properties of the trophoblast for the first family, and with the evolutionary interfacing role of the extracellular matrix occurring between the embryo and the maternal compartment for the second family. The importance of these genes has been recognized in the mouse. Knocking out dag1 leads to disruption of the embryo-derived basement membrane structure and postimplantation lethality [31].

We also detected protein trafficking genes in pre-elongated trophoblasts when the embryo has no direct contact with the uterus. Numerous endocytic vesicles and lysosomes have previously been described at this stage in ovine trophoblasts [1, 32, 33]. It has been evidenced that bovine spherical conceptuses display an increased protein synthesis activity compared with that of elongated trophoblasts [34]. The trophoblast is a polarized, highly secretive transporting epithelium, and these characteristics are usually established and dynamically maintained by intracellular trafficking. However, despite these morphological observations, no molecular data had yet reported the involvement of so many protein trafficking genes in the developing trophoblast. In elongated and implanting trophoblasts, when the trophoblast begins to appose and adhere to the luminal epithelium, protein trafficking genes were no longer detected, but cell signaling genes and receptors including BMP4 (bone morphogenetic protein 4) and EPHA1 (ephrin receptor A1), became expressed. BMP4 is a differentiating factor for the visceral endoderm and is expressed in preimplanted and implanting mouse blastocysts [35]. EPHA1 was previously determined in human blastocysts and is believed to be involved in cell migration and adhesion before the invasive phase of implantation [36]. The shift in the expression of genes belonging to the protein trafficking genes and the cell signaling genes and receptors families thus distinguished two major steps that correlate with the physiological state of the embryo and its situation in the uterus. The three genes DAG1, BMP4, and EPHA1 have already been identified in other species as highly relevant to embryo development, in that they display a timing of expression consistent with our results [31, 35, 36]. As such, they might deserve further investigations as potentially shared regulators of implantation among mammals.

Among the 63 transcripts specifically up-regulated at one of the three stages of trophoblastic development, some of them deserve special interest. In the pregnant ewe, IGFBP1 expression was reported to be restricted to the luminal uterine epithelium, excluding fetal regions [27]. No clear data were available regarding the presence of IGFBP1 in the ovine conceptus, but it could not be evidenced in early elongated cow embryos [37]. Even though the expression profile provided by PCR did not strictly parallel that from arrays, our results clearly demonstrated that IGFBP1 transcript was present in the elongated trophoblast of ovine conceptus as it was in the uterine luminal epithelium. It has been previously reported [27] that IGFBP1 transcripts originated from endometrium and progressively declined during elongation and implantation in the sheep. It has been hypothesized that at this time, IFGBP1 may regulate the rapid expansion and the implantation of the blastocyst by controlling the IGFII availability in the uterine lumen [27, 38]. Our results indicated a parallel decrease in the IGFBP1 gene expression in the growing trophoblast. Because both the conceptus and the luminal endometrium are the sites of IGFBP1 and IGFII production [39], a complex mechanism is likely to control the IGFII-dependant biological function at the uterine-trophoblast interface.

We focused on four genes—TMSB10, CTNNA1, NPM1, and CX3CL1—because their expression had never been reported in the reproductive system of ruminants. The relevance of these genes was emphasized because they exhibited expression levels related to morphological changes occurring during the peri-implantation period. Our results showed an increase of TMSB10 gene expression in both elongated and implanting ovine conceptuses. Recently, TSMB10 was identified among genes involved in porcine conceptus elongation [40]. It could suggest that TMSB10 is one of the genes required for the elongation program that is unique to livestock. TMSB10, like other ß-thymosins, is an actin-sequestering molecule [41]. ß-Thymosins were reported to be regulated in numerous cells and tissues under normal and pathological conditions such as inflammation, angiogenesis, apoptosis, and carcinogenesis [42]. Overexpression of TMSB10 results in a stronger ability of cells to spread and adhere [43]. We can hypothesize that TMSB10 takes part in cellular remodeling during the implantation period, and that TMSB10 is also involved in trophoblast adhesion. As for TMSB10, our results demonstrated that increasing expression of CTNNA1 was correlated with elongation and implantation in the ewe. CTNNA1 was identified in preimplantation-stage mice embryos [44], where it was required for the formation of the trophectoderm at the blastocyst stage [45]. CTNNA1 is a connective molecule that allows the E-cadherin/beta-catenin complex to anchor to the actin cytoskeleton. An increase in cell number and changes in trophoblastic cell polarity to fuse with the luminal endometrium necessarily require active cytoskeletal regulation. Our work supports the notion that these regulations can be mediated via TMSB10 and CTNNA1.

NPM1 is a chaperone molecule that influences the regulation of cell proliferation. Stimulation of cell growth is accompanied by an increase in NPM1 protein level [46]. In the sheep trophoblast, the gene expression of NPM1 is high when cellular multiplication leads toward an elongated conceptus; then, its expression is decreased when elongation is completed. NPM1 protein is regulated by estradiol and may be involved in the induction of estradiol-stimulated growth [47]. The progressive decrease of NPM1 expression in the ovine trophoblast was inversely correlated to IFN{tau} synthesis [5]. Because IFN{tau} inhibits estradiol activity [48], it could explain the decrease in NPM1 expression, which is observed on Day 14 of gestation. CX3CL1 displayed an original expression profile compared with the profiles of TMSB10, CTNNA1, and NPM1. While the latter three show a general increase or decrease of expression as development proceeds, CX3CL1 was specifically up-regulated at the elongated stage, and its expression decreased at the implanting stage. CX3CL1 was only recently discovered and is an unusual member of the chemokine family. These small proteins stimulate leukocyte migration and mediate inflammation. In contrast to soluble chemokines, CX3CL1 contains a transmembrane domain, which anchors it to the cell, and an intracellular domain of unknown function [49]. A soluble form of CX3CL1 is generated by proteolytic cleavage of the extracellular module. This structure suggests that CX3CL1 is involved both in cell adhesion and signal transduction. CX3CL1 mediates robust cell adhesion via binding to a CX3C receptor and may provide an alternative to integrin-mediated cell adhesion [49]. It was detected in epithelial cells of the amnion and in the trophoblast from human late pregnancies [50]. Specific up-regulation of CX3CL1 at the time when the first contacts between trophoblast and uterus are established in the ewe is in accordance with both activities of CX3CL1. Further investigations will be needed to clarify the role of this unusual chemokine in the context of implantation.

In summary, our results demonstrate the interest in using human arrays to study ovine transcript expression as long as homologous bovine arrays are not routinely available. Gene expression varies during trophoblast elongation and apposition to the uterus, but only a few important genes seem to be induced transiently and sequentially. The physiological state of the embryo is directly correlated with specific expression of functional classes of genes. Protein trafficking genes are expressed early, when the embryo is free from tissue connection with the uterus, whereas cell signaling genes are expressed a few days later at the beginning of implantation.


   ACKNOWLEDGMENTS
 
The authors thank the staff of Brouessy and Jouy en Josas farmhouses and slaughterhouse for their help with the ewes.


   FOOTNOTES
 
1 L.C. was supported by a fellowship from Ministère Français de l'Education Nationale, de l'Enseignement et de la Recherche. Back

2 Correspondence: Gilles Charpigny, INRA, Domaine de Vilvert, Biologie du Développement et de la Reproduction, Centre de Recherches de Jouy, 78352 Jouy en Josas Cedex, France. FAX: 33 1 34 65 23 64; gilles.charpigny{at}jouy.inra.fr Back

Received: 3 August 2004.

First decision: 3 September 2004.

Accepted: 14 December 2004.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Guillomot M. Cellular interactions during implantation in domestic ruminants. J Reprod Fertil Suppl 1995 49:39-51[Medline]
  2. Salamonsen LA, Nagase H, Woolley DE. Matrix metalloproteinases and their tissue inhibitors at the ovine trophoblast-uterine interface. J Reprod Fertil Suppl 1995 49:29-37[Medline]
  3. Heyman Y, Camous S, Fevre J, Meziou W, Martal J. Maintenance of the corpus luteum after uterine transfer of trophoblastic vesicles to cyclic cows and ewes. J Reprod Fertil 1984 70:533-540
  4. Gray CA, Burghardt RC, Johnson GA, Bazer FW, Spencer RE. Evidence that absence of endometrial gland secretions in uterine gland knockout ewes compromises conceptus survival and elongation. Reproduction 2002 124:289-300[Abstract]
  5. Roberts RM, Anthony RV. In: Findlay JK (ed.), Molecular Biology of the Female Reproductive System. San Diego: Academic Press; 1994:395–440
  6. Goff AK. Embryonic signals and survivals. Reprod Domest Anim 2002 37:133-139[CrossRef][Medline]
  7. Munson L, Wilhite A, Boltz VF, Wilkinson JE. Transforming growth factor-ß in bovine placentas. Biol Reprod 1996 55:748-755[Abstract]
  8. Kaye PL. Preimplantation growth factor physiology. Rev Reprod 1997 2:121-127[Abstract]
  9. Cao Y, Prescott SM. Many actions of cyclooxygenase-2 in cellular dynamics and in cancer. J Cell Physiol 2002 190:279-286[CrossRef][Medline]
  10. Doré JJE Jr, Wilkinson JE, Godkin JD. Early gestational expression of transforming growth factor-ß isoforms by the ovine placenta. Biol Reprod 1995 53:143-152[Abstract]
  11. Yaseen MA, Wrenzycki C, Herrmann D, Carnwath JW, Niemann H. Changes in the relative abundance of mRNA transcripts for insulin-like growth factor (IGF-I and IGF-II) ligands and their receptors (IGF-IR/IGF-IIR) in preimplantation bovine embryos derived from different in vitro systems. Reproduction 2001 122:601-610[Abstract]
  12. Charpigny G, Reinaud P, Tamby JP, Créminon C, Guillomot M. Cyclooxygenase-2 unlike cyclooxygenase-1 is highly expressed in ovine embryos during the implantation period. Biol Reprod 1997 57:1032-1040[Abstract]
  13. Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC. Global gene profiling in human endometrium during the window of implantation. Endocrinology 2002 143:2119-2138[Abstract/Free Full Text]
  14. Reese J, Das SK, Paria BC, Lim H, Song H, Matsumoto H, Knudtson KL, DuBois RN, Dey SK. Global gene expression analysis to identify molecular markers of uterine receptivity and embryo implantation. J Biol Chem 2001 276:44137-44145[Abstract/Free Full Text]
  15. Ishiwata H, Katsuma S, Kizaki K, Patel OV, Nakano H, Takahashi T, Imai K, Hirasawa A, Shiojima S, Ikawa J, Suzuki Y, Tsujimoto G, Izaike Y, Todoroki J, Hashizume K. Characterization of gene expression profiles in early bovine pregnancy using a custom cDNA microarray. Mol Reprod Dev 2003 65:9-18[CrossRef][Medline]
  16. Tanaka TS, Kunath T, Kimber WL, Jaradat SA, Stagg CA, Usuda M, Yokota T, Niwa H, Rossant J, Ko MSH. Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. Genome Res 2002 12:1921-1928[Abstract/Free Full Text]
  17. Kelly DL, Rizzino A. DNA microarray analyses of genes regulated during the differentiation of embryonic stem cells. Mol Reprod Dev 2000 56:113-123[CrossRef][Medline]
  18. Aronow BJ, Richardson BD, Handwerger S. Microarray analysis of trophoblast differentiation: gene expression reprogramming in key gene function categories. Physiol Genomics 2001 6:105-116[Abstract/Free Full Text]
  19. Dalbiès-Tran R, Mermillod P. Use of heterologous complementary DNA array screening to analyze bovine oocyte transcriptome and its evolution during in vitro maturation. Biol Reprod 2003 68:252-261[Abstract/Free Full Text]
  20. Jones KL, King SS, Iqbal MJ. Endophyte-infected tall fescue diet alters gene expression in heifer luteal tissue as revealed by interspecies microarray analysis. Mol Reprod Dev 2004 67:154-161[CrossRef][Medline]
  21. Chomczynski P, Sacchi N. Single-step method for RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987 162:156-159[Medline]
  22. Eisen MB, Spellman PT, Brown PO, Bostein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 1998 95:14863-14868[Abstract/Free Full Text]
  23. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997 25:3389-3402[Abstract/Free Full Text]
  24. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, Schall TJ. A new class of membrane-bound chemokine with a CX3C motif. Nature 1997 385:640-644[CrossRef][Medline]
  25. Yang H, Wanner IB, Roper SD, Chaudhari N. An optimized method for in situ hybridization with signal amplification that allows the detection of rare mRNAs. J Histochem Cytochem 1999 47:431-445[Abstract/Free Full Text]
  26. Online Mendelian Inheritance in Man. Bethesda, MD: National Center for Biotechnology Information and Johns Hopkins University. Available at: http://www.ncbi.nlm.gov/entrez/query.fcgi?db;eqOMIM(lastaccessedDecember2004)
  27. Osgerby JC, Gadd TS, Wathes DC. Expression of insulin-like growth factor binding protein-1 (IGFBP-1) mRNA in the ovine uterus throughout the oestrus cycle and early pregnancy. J Endocrinol 1999 162:279-287[Abstract]
  28. Charpigny G, Leroy MJ, Breuiller-Fouché M, Tanfin Z, Mhaouty-Kodja S, Robin P, Leiber D, Cohen-Tannoudji J, Cabrol D, Barberis C, Germain G. A functional genomic study to identify differential gene expression in the preterm and term human myometrium. Biol Reprod 2003 68:2289-2296[Abstract/Free Full Text]
  29. Piétu G, Alibert O, Guichard V, Lamy B, Bois F, Leroy E, Mariage-Samson R, Houlgatte R, Soularue P, Auffray C. Novel gene transcripts preferentially expressed in human muscles revealed by quantitative hybridization of a high density cDNA array. Genome Res 1996 6:492-503[Abstract/Free Full Text]
  30. Dominguez F, Pellicer A, Simon C. Paracrine dialogue in implantation. Mol Cell Endocrinol 2002 186:175-181[CrossRef][Medline]
  31. Williamson RA, Henry MD, Daniels KJ, Hrstka RF, Lee JC, Sunada Y, Ibraghimov-Beskrovnaya O, Campbell KP. Dystroglycan is essential for early embryonic development: disruption of Reichert's membrane in Dag1-null mice. Hum Mol Genet 1997 6:831-841[Abstract/Free Full Text]
  32. Carnegie JA, McCully ME, Robertson HA. The early development of the sheep trophoblast and the involvement of cell death. Am J Anat 1985 174:471-488[CrossRef][Medline]
  33. Wintenberger-Torrès S, Fléchon JE. Ultrastructural evolution of the trophoblast cells of the pre-implantation sheep blastocyst from day 8 to day 18. 1974;118:143–153
  34. Morris DG, Diskin MG, Sreenan JM. Protein synthesis and phosphorylation by elongating 13-15-day-old cattle blastocysts. Reprod Fertil Dev 2000 12:39-44[CrossRef][Medline]
  35. Coucouvanis E, Martin GR. BMP signaling plays a role in visceral endoderm differentiation and cavitation in the early mouse embryo. Development 1999 126:535-546[Abstract]
  36. Fujiwara H, Yoshioka S, Tatsumi K, Kosaka K, Satoh Y, Nishioka Y, Egawa M, Higuchi T, Fuji S. Human endometrial epithelial cells express ephrin A1: possible interaction between human blastocysts and endometrium via Eph-ephrin system. J Clin Endocrinol Metab 2002 87:5801-5807[Abstract/Free Full Text]
  37. Keller ML, Roberts AJ, Seidel GE Jr. Characterization of insulin-like growth factor-binding proteins in the uterus and conceptus during early conceptus elongation in cattle. Biol Reprod 1998 59:632-642[Abstract/Free Full Text]
  38. Ko Y, Lee CY, Ott TL, Davis MA, Simmen RC, Bazer FW, Simmen FA. Insulin-like growth factors in sheep uterine fluids: concentrations and relationship to ovine trophoblast protein-1 production during early pregnancy. Biol Reprod 1991 45:135-142[Abstract]
  39. Reynolds TS, Stevenson KR, Wathes DC. Pregnancy-specific alterations in the expression of insulin-like growth factor system during early placental development in the ewe. Endocrinology 1997 138:886-897[Abstract/Free Full Text]
  40. Smith TPL, Fahrenkrug SC, Rohrer GA, Simmen FA, Rexroad CE III, Keele JW. Mapping of expressed sequence tags from a porcine early embryonic cDNA library. Anim Genet 2001 32:66-72[CrossRef][Medline]
  41. Huff T, Muller CS, Otto AM, Netzker R, Hannappel E. ß-Thymosins, small acidic peptides with multiple functions. Int J Biochem Cell Biol 2001 33:205-220[CrossRef][Medline]
  42. Malinda KM, Goldstein AL, Kleinman HK. Thymosin beta 4 stimulates directional migration of human umbilical vein endothelial cells. FASEB J 1997 11:474-481[Abstract]
  43. Sun HQ, Kwiatkowska K, Yin HL. beta-Thymosins are not simple actin monomer buffering proteins. Insights from overexpression studies. J Biol Chem 1996 271:9223-9230[Abstract/Free Full Text]
  44. Oshugi M, Hwang SY, Butz S, Knowles BB, Solter D, Kemler R. Expression and cell membrane localization of catenins during mouse preimplantation development. Dev Dyn 1996 206:391-402[CrossRef][Medline]
  45. Torres M, Stoykova A, Huber O, Chowdhury K, Bonaldo P, Mansouri A, Butz S, Kemler R, Gruss P. An {alpha}-E-catenin gene trap mutation defines its function in preimplantation development. Proc Natl Acad Sci U S A 1997 94:901-906[Abstract/Free Full Text]
  46. Chan WY, Liu QR, Borjigin J, Busch H, Rennert OM, Tease LA, Chan PK. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth. Biochemistry 1989 28:1033-1039[CrossRef][Medline]
  47. Skaar TC, Prasad SC, Sharareh S, Lippman ME, Brünner N, Clarke R. Two-dimensional gel electrophoresis analyses identify nucleophosmin as an estrogen regulated protein associated with acquired estrogen-independence in human breast cancer cells. J Steroid Biochem Mol Biol 1999 67:391-402
  48. McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrine-mediated event. Physiol Rev 1999 79:264-304
  49. Haskell CA, Cleary MD, Charo IF. Molecular uncoupling of fractalkine-mediated cell adhesion and signal transduction. Rapid flow arrest of CX3CR1-expressing cells is independent of G-protein activation. J Biol Chem 1999 274:10053-10058[Abstract/Free Full Text]
  50. Shimoya K, Zhang Q, Tenma K, Ota Y, Hashimoto K, Shizusawa Y, Kimura T, Koyama M, Murata Y. Fractalkine (FRK) levels in amniotic fluid and its production during pregnancy. Mol Hum Reprod 2003 9:97-101[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Biol. Reprod.Home page
N. J Hannan and L. A Salamonsen
CX3CL1 and CCL14 Regulate Extracellular Matrix and Adhesion Molecules in the Trophoblast: Potential Roles in Human Embryo Implantation
Biol Reprod, July 1, 2008; 79(1): 58 - 65.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. A. Dunlap, M. Palmarini, M. Varela, R. C. Burghardt, K. Hayashi, J. L. Farmer, and T. E. Spencer
Endogenous retroviruses regulate periimplantation placental growth and differentiation
PNAS, September 26, 2006; 103(39): 14390 - 14395.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
72/4/960    most recent
biolreprod.104.034801v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.
Agricola
Right arrow Articles by Cammas, L.
Right arrow Articles by Charpigny, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS