Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print April 13, 2005.
Biol Reprod 2005, 10.1095/biolreprod.104.038026
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/2/324    most recent
biolreprod.104.038026v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.
Agricola
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.
BIOLOGY OF REPRODUCTION 73, 324–333 (2005)
DOI: 10.1095/biolreprod.104.038026
© 2005 by the Society for the Study of Reproduction, Inc.

Identification of Downregulated Messenger RNAs in Bovine Granulosa Cells of Dominant Follicles Following Stimulation with Human Chorionic Gonadotropin1

Kalidou Ndiaye , Tania Fayad , David W. Silversides , Jean Sirois , and Jacques G. Lussier 2 

Centre de recherche en reproduction animale, Faculté de médecine vétérinaire, Université de Montréal, St-Hyacinthe, Québec, Canada J2S 7C6


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Molecular determinants and mechanisms involved in ovarian follicular growth, ovulation, and luteinization are not well understood. The objective of this study was to identify genes expressed in bovine granulosa cells (GC) of dominant follicles (DF) and downregulated after hCG-induced ovulation, using the suppression subtractive hybridization (SSH). GC were collected from DF at Day 5 of the estrous cycle and from ovulatory follicles (OF) obtained 23 h following injection of hCG. A subtracted cDNA library (DF-OF) was generated and screened using unsubtracted (DF, OF) and subtracted (DF-OF, OF-DF) cDNAs as complex 32P-probes. A total of 32 nonredundant cDNAs were identified: 23 cDNAs matched with sequences of known biological function and 9 cDNAs with complete or partial sequences of undefined biological function. Detection of genes known to be downregulated during the periovulatory period in the bovine species, such as CPD, CYP11A1, CYP19A1, FSHR, LRP8/ ApoER2, and SERPINE2, validated the physiological model and analytical techniques used. For a subset of genes, such as ARFGAP3, CYP11A1, CYP19A1, FSHR, FST, GJA1, IDH3, INHBA, LHCGR, LHCGR lacking exon 10, PRC1, PRG1, RPA2, SCD, and TRIB2, gene expression profiles were compared by virtual Northern blot or reverse transcriptase-polymerase chain reaction from follicles obtained at different developmental stages. Results confirmed a downregulation of the respective mRNAs in GC of OF compared with that of DF. We conclude that we have identified novel genes that are downregulated by hCG in bovine GC of DF during the periovulatory period, which may contribute to follicular growth, ovulation, and/or luteinization.

dominance, follicle, gene expression, gene regulation, granulosa cells, ovary, ovulation


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In cattle, formation of the follicular antrum begins when the follicle measures 0.2 mm in diameter, and follicles 0.2– 2 mm in size constitute a large pool of healthy growing follicles [1, 2]. As these follicles continue developing, the majority degenerate through atresia [3]. At around 3–4 mm in diameter, most follicles are lost by atresia if circulating FSH concentration is not sufficient to promote and sustain follicular growth beyond this stage [2, 4]. Twice or thrice during the bovine estrous cycle, an estimated number of 7– 11 follicles at the 3- to 4-mm stage are recruited into a wave pattern to pursue their development. This cyclic recruitment is preceded by an increase in circulating FSH concentrations [5, 6]. A selection phase follows, where a single follicle continues its development to become the dominant follicle (DF), whereas subordinates degenerate by atresia. Circulating FSH concentration remains low during the functional dominance phase. The DF encountered at different times of the estrous cycle is capable of ovulation as demonstrated by injection of human chorionic gonadotropin (hCG) [7]. Although it is known that the preovulatory luteinizing hormone (LH) surge induces changes in different compartments of the DF that trigger ovulation and promote final maturation of the oocyte, the mechanisms ensuring the transition from a DF into an ovulatory follicle (OF) are not fully understood [8, 9].

In the past, research has been focused on genes that were induced in the OF by the LH/hCG surge [8, 9]. Identification of genes that are expressed in the DF and undergo downregulation by LH/hCG may also contribute to understanding their involvement in follicular growth and oocyte quality as well as ovulation and luteinization. The working hypothesis of this study was that the transition from a DF into an OF results from transcriptional downregulation of a subset of genes in granulosa cells (GC). Gene expression was studied in GC because they represent an important compartment of the ovarian follicle involved in hormone synthesis and maturation of the oocyte [8]. The specific objective was to identify candidate genes downregulated in bovine preovulatory follicles after the LH/hCG surge. Gene expression analysis was achieved by use of suppression subtractive hybridization (SSH) [10], permitting enrichment of differentially expressed genes in DF, followed by the establishment of a GC subtracted cDNA library (DF-OF). The cDNA clones isolated from the subtracted library were validated for their differential expression pattern by cDNA macroarrays and characterized by sequencing. Genes that were found to be differentially expressed were further validated by virtual Northern blot or reverse transcriptase-polymerase chain reaction (RT-PCR) performed on independent follicles obtained at different developmental stages.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Experimental Animal Model and Sample Preparations

Normal cycling crossbred heifers were synchronized with one injection of PGF2{alpha} (25 mg, i.m.; Lutalyse, Upjohn, Kalamazoo, MI) given in the presence of a corpus luteum (CL). Behavioral estrus was monitored at 12-h intervals, from 48–96 h following the PGF2{alpha} injection. From the time of PGF2{alpha} injection until ovariectomy, ovarian follicular development was monitored by daily transrectal ultrasonography performed with a real-time linear scanning ultrasound diagnostic system (LS-300; Tokyo Keiki Co., Ltd., Tokyo, Japan) equipped with a 7.5-MHz transducer probe [2]. At each examination, the diameter of the CL and individual follicles ≥4 mm were measured at their largest cross-sectional area using internal calipers. Following estrus synchronization by PGF2{alpha}, heifers were randomly assigned to one of two treatment groups: 1) the dominant follicle group (DF; n = 4) or 2) the ovulatory hCG-induced follicle group (OF; n = 4). In the DF group, the ovary bearing the DF on the morning of Day 5 of the estrous cycle (Day 0 = day of estrus) was obtained by ovariectomy (via colpotomy). The DF was defined as >8 mm by ultrasonographic measurement and growing while subordinate follicles were either static or regressing [11]. The mean diameter of DF measured at the surface of the ovary was 10.4 ± 0.3 mm. The OF were obtained following an injection of 25 mg of PGF2{alpha} (Lutalyse) on Day 7 to induce luteolysis, thereby maintaining the development of the DF of the first follicular wave into a preovulatory follicle [7]. An ovulatory dose of hCG (3000 IU, i.v.; APL, Ayerst Lab, Montréal, QC) was injected 36 h after the induction of luteolysis, and the ovary bearing the hCG-induced OF was collected by ovariectomy at 23 h after hCG injection. The mean diameter of OF was 12.9 ± 0.3 mm. Follicular fluid and GC with oocytes were collected separately from individual DF or OF as described previously [11]. Additionally, GC/ oocytes and follicular fluid were collected from 2- to 4-mm follicles that were obtained from slaughterhouse ovaries representing a total of three pools of 20 small follicles (SF). These experiments were approved by the Animal Ethics Committee of the Faculty of Veterinary Medicine of the Université de Montréal. Concentrations of progesterone (P4), estradiol-17ß (E2), and their ratio (P4:E2) were analyzed by radioimmunoassay of follicular fluid as previously described [11]. The E2:P4 ratios were calculated for each sample: 1) 0.008, 0.06, and 0.01 for the three SF pools; 2) 17.3, 19.7, 14.3, and 63.4 for individual DF at Day 5 (n = 4); and 3) 0.44, 0.87, 0.64, and 0.27 (n = 4) for individual OF. CL at Day 5 of the estrous cycle were obtained by ovariectomy from cows following ultrasound monitoring of follicular development and estrus synchronization as described above. The CL were dissected from the ovarian stroma, frozen in liquid nitrogen, and then stored at –80°C until RNA extraction. Total RNA was isolated from GC/oocytes or CL as previously described [11]. The concentration of total RNA was quantified by measurement of optical density at 260 nm, and quality was evaluated by visualizing the 28S and 18S ribosomal bands following electrophoretic separation on a formaldehyde denaturing 1% agarose gel with ethidium bromide [11].

Suppression Subtractive Hybridization

To compare gene expression in GC collected from DF versus OF, the SSH was performed essentially as previously described [12]. Identical amounts of total RNA (2 µg) from four DF or four OF were pooled within treatment groups to decrease interanimal variation. To generate sufficient amounts of double-stranded cDNA for an SSH experiment, both DF and OF cDNAs were amplified separately using the SMART PCR cDNA synthesis kit (User manual PT3041-1; BD Biosciences Clontech, Mississauga, ON) [10, 12]. One microgram of total RNA from each pooled group was reverse transcribed with an oligo-dT30 primer (CDS: 5'-AAGCAGTGGTAACAACGCAGAGTACT(30)(A/C/G/T) (A/G/C)-3') and PowerScript (BD Biosciences Clontech) to generate the first strand cDNA. Second cDNA strands were produced with the SMART II 5'-anchored oligo and PCR-amplified for 15 cycles using Advantage 2 DNA polymerase (BD Biosciences Clontech). PCR-generated DF and OF cDNAs were digested with RsaI to generate blunt-ended cDNA fragments (from 0.2 to 2 kilobases [kb]). The DF cDNAs were subtracted against OF cDNAs (forward reaction: DF-OF) using PCR-Select cDNA subtraction technology (User manual: PT1117-1; BD Biosciences Clontech) [10, 12], and in a parallel experiment, the OF cDNAs were subtracted against the DF cDNAs (reverse reaction: OF-DF). The efficiency of subtraction was analyzed by comparing the abundance of cDNAs before and after subtraction by PCR using bovine gene-specific primers for a gene known to be downregulated by hCG, such as cytochrome P450, family 19, subfamily 1 (CYP19A1; sense: GTCCGAAGTTGTGCCTATTGCCAGC; antisense: CCTCCAGCCTGTCCAGATGCTTGG; GenBank: NM_174305), and a gene known to be induced by hCG, such as prostaglandin-endoperoxide synthase 2 (PTGS2; sense: GCATTCTTTGCCCAGCACTTCACCC; antisense: CTATCAGGATTAGCCTGCTTGTCTGG; GenBank: AF031698). PCR amplification was performed using Advantage 2 DNA polymerase (BD Biosciences Clontech), and 5-µl aliquots were removed following determined numbers of PCR cycles. The amplified products were resolved on a 2% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, 0.5 µg/ml ethidium bromide). The difference in the number of cycles needed to generate an equal amount of the corresponding PCR product in subtracted and unsubtracted samples served to indicate the subtraction efficiency.

Cloning of Subtracted cDNAs and Differential Hybridization Screening

The subtracted cDNAs were cloned into the pT-Adv plasmid (BD Biosciences Clontech) to construct the DF-OF subtracted library and used to transform competent TOP10F' Escherichia coli as previously described [13]. The subtracted DF-OF cDNA library (940 individual colonies) was used to establish macroarrays for differential screening following previously described methodologies [12]. The insert of each cDNA clone was amplified in 96-well plates by PCR (28 cycles) using the PCR-nested primers 1 and 2R and AmpliTaq DNA polymerase (Roche Molecular Systems Inc, Laval, QC). To establish the cDNA macroarrays, an aliquot of each amplification product was denatured in 0.3 M NaOH with 5% bromophenol blue, and 10 µl were vacuum transferred with a 96-well dot-blot apparatus onto nylon membranes (Hybond-N+, Amersham Pharmacia Biotech), which were then exposed to 150 mJ ultraviolet light (UV) to perform DNA cross-linking (Gs Gene Linker; Bio-Rad, Mississauga, ON). Control cDNAs (CYP19A1, PTGS2) were transferred onto the macroarrays. For each 96-well plate, four identical cDNA macroarray replicate membranes were generated. The DF-OF, OF-DF, DF; and OF cDNA pools were used to generate complex hybridization probes for differential screening of macroarrays of the DF-OF cDNA library. Probes were obtained by performing the secondary nested PCR and were then purified (QIAquick PCR Purification Kit; Qiagen Inc., Mississauga, ON). To prevent nonspecific interaction of the probes to cDNAs on macroarrays during hybridization, the adaptors were removed by three successive digestions with AfaI, SmaI, and EagI [10, 12]; the cDNA pools were again purified (QIAquick; PCR Purification Kit, Qiagen Inc.) and 100 ng were labeled with [{alpha}32P]-dCTP by random priming (Megaprime DNA Labeling System; Amersham Pharmacia Biotech). The radioactive probes were purified (QIAquick Nucleotide Removal kit; Qiagen Inc.) and quantified using a beta counter. The hybridization and washing conditions of macroarrays were performed as previously described [12]. Equal amounts of each heat-denatured cDNA probe (DF-OF, OF-DF, DF, or OF) were used to hybridize each replicate of the DF-OF macroarray membrane. Following washing, membranes were exposed to a phosphor screen for 4 h and the images were digitized (Storm 840; Amersham Pharmacia Biotech). The differentially hybridizing cDNA clones were characterized by DNA sequencing and their differential expression profiles were further validated by virtual Northern or RT-PCR analysis from independent follicles obtained at different developmental stages.

DNA Sequencing and Sequence Analysis

The cDNA clones identified as differentially expressed by the DF-OF subtracted probe were amplified by PCR for 15 cycles with the corresponding PCR-nested 1 and PCR-nested 2 oligos from the PCR product generated initially for the macroarrays. The PCR product was purified (Qiagen Inc.) and verified by agarose gel analysis for the presence of a single cDNA band before proceeding with sequencing. Sequencing reactions were performed on cDNA clones via the dideoxy sequencing method (Big Dye Terminator 3.0; ABI Prism, Applied BioSystem, PE, Branchburg, NJ) using the oligos PCR-Nested 1, and sequencing reactions were analyzed on an ABI Prism 310 sequencer (Applied Biosystems). Nucleic acid sequences were analyzed by BLAST (Basic Local Alignment Search Tool) against GenBank data banks (NR and EST). A cDNA sequence was considered homologous to a GenBank sequence when at least 100 base pairs (bp) matched with an E probability value of less than e–10.

Gene Expression Analysis

The cDNA clones corresponding to known genes that were identified as differentially expressed in the SSH differential screening experiment were used to compare their differential expression pattern in GC collected from follicles at different developmental stages and CL, using virtual Northern analysis or semiquantitative RT-PCR. To perform virtual Northern blots, total RNA (1 µg) from GC (SF, DF, OF) or CL (D5) were reverse transcribed using SMART PCR cDNA synthesis technology (BD Biosciences Clontech, Mississauga, ON) as previously described [12]. The cDNA products for each follicle or CL along with molecular weight standards (1 kb ladder, {phi}x 174-RF/Hae III and {lambda}/Hind III; Amersham Pharmacia Biotech) were separated on agarose gel, then transferred onto a nylon membrane [12]. Gene-specific probes derived from SSH cDNA fragments were generated by PCR (20 cycles) using the primers PCR-Nested 1 and PCR-Nested 2R. Glyceraldehyde-3-phosphate dehydrogenase (GAPD) probe was used as a constitutively expressed gene using the following oligos (sense: TGTTCCAGTATGATTCCACCCACG; antisense: CTGTTGAAGTCGCAGGAGACAACC) [12]. Purified cDNA probes were labeled with [{alpha}32P]-dCTP as described above. Virtual Northern membranes were prehybridized, hybridized, and washed as described [12]. Membranes were exposed to phosphor screen and the images were digitized (Storm 840; Amersham Pharmacia Biotech).

A comparative RT-PCR was performed for genes that showed either a weak or no signal by virtual Northern analysis and for which full-length bovine cDNA sequences were available. Gene-specific primers were designed in the open reading frame of the cDNA sequence. SMART cDNAs were generated as described above, diluted 1/10, and 1 µl was used in a 25-µl PCR reaction using the Advantage 2 DNA polymerase. The number of PCR cycles were limited and optimized for each gene to be analyzed. Gene-specific PCR primers were as follows: cytochrome P450, family 11, subfamily A (CYP11A1; sense: GCCACATCGAGAACTTCCAGAAG; antisense: CTGGTGTGGAACATCTTGTAGACG; GenBank: NM_ 176644), follicle-stimulating hormone receptor (FSHR; sense: CGACTCTGTCACTGCTCTAACGG; antisense: CGTCAATTCCTTTGGCATAGGTGG; GenBank: L22319), follistatin (FST; sense: CTCTGCCAGTTCATGGAGGACC; antisense: GGCCAATCCAATAGATCTGCCC; GenBank: L21716), isocitrate dehydrogenase 3 (NAD+) alpha (IDH3A; sense: GCAAATGTCCGACCATGTGTCTC; antisense: GAACCGACTCGAAGATTGCAACTC; GenBank: U07980), luteinizing hormone/choriogonadotropin receptor (LHCGR; sense: CGACTATCACTCACCTATCTCCC; antisense: CAGGACTCTAAGGAAGTTGTAGCC; GenBank: U20504), stearoyl-coenzyme A desaturase (SCD; sense: CAAGAGGAGATCTCTAGCTCCTACAC; antisense: CTCCTCTGGAACATCACCAGCTTC; GenBank: NM_173959), and CYP191A and GAPD as described above. Twenty µl of the PCR reactions were separated on a 2% TAE-agarose gel with ethidium bromide, PCR products were visualized by UV, and the images digitized. The digitized signals for each gene obtained either by virtual Northern or semiquantitative RT-PCR were analyzed by densitometry using ImageQuant software (Amersham Pharmacia Biotech).

Statistical Analysis

Gene-specific signals were normalized with corresponding GAPD signals for each sample. Homogeneity of variance between follicular groups and CL was verified by O'Brien and Brown-Forsythe tests. Corrected values of gene-specific mRNA levels were compared between follicular or CL groups by one-way ANOVA. When ANOVA indicated significant differences (P < 0.05), the Tukey-Kramer test was used for multiple comparisons of individual means. Data were presented as least-square means ± SEM. Statistical analyses were performed using JMP software (SAS Institute, Inc., Carry, NC).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Identification of Differentially Expressed Genes Using SSH

A cDNA library containing transcripts expressed in DF and that are downregulated by hCG was constructed by subtracting OF cDNAs from DF cDNAs (DF-OF). Reverse subtraction was also performed as a control and consisted of DF cDNAs subtracted from OF cDNAs (OF-DF). Subtraction efficiency was evaluated by PCR analysis, which compared the abundance of two control cDNAs preceding and following subtraction. To monitor the enrichment of differentially expressed genes in the DF-OF subtracted sample, CYP19A1 cDNA was used as a positive control in the DF. Its PCR product was observed after 18 cycles in the DF unsubtracted sample but was undetectable in the OF sample (Fig. 1). In the DF-OF subtracted sample, the PCR-amplified CYP19A1 fragment was detected following 13 cycles, indicating that CYP19A1 cDNA was enriched after subtraction. PTGS2 mRNA was used as a positive control to monitor the enrichment of an hCG-induced gene in the OF-DF subtracted sample. In the OF sample, the PTGS2 PCR product was observed after 18 cycles but was undetectable in the DF sample (Fig. 1). In the OF-DF subtracted sample, the PCR-amplified PTGS2 fragment was detected after 13 cycles, indicating enrichment of differentially expressed genes in the subtracted OF-DF sample when compared with unsubtracted OF sample.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1. Analyses of the cDNA subtraction efficiency. PCR analysis was performed on the indicated samples using CYP19A1 or PTGS2 specific primers, as described under Materials and Methods. PCR product aliquots were collected at increasing numbers of PCR cycles as indicated. The CYP19A1 DNA fragment (520 bp) was detected following 13 PCR cycles in the DF-OF subtracted sample but not until 18 PCR cycles in the corresponding unsubtracted DF sample. The PTGS2 DNA fragment (418 bp) was detected following 13 PCR cycles in the OF-DF subtracted sample but not until 18 PCR cycles in the corresponding unsubtracted OF sample. CYP19A1 or PTGS2 were not detected in the OF or DF samples, respectively

Following verification of the subtraction efficiency, a subtracted cDNA library was constructed by ligating the DF-OF SSH cDNA products into a plasmid vector from which 940 bacterial colonies were randomly selected. Differential hybridization screening was performed by macroarray to compare and verify the differential expression pattern of the cDNA clones before characterizing them by sequencing. Subtracted (DF-OF, OF-DF) and unsubtracted (DF, OF) cDNA preparations were used as complex hybridization probes for differential screening of the 940 cDNA clones spotted on four identical sets of macroarrays. On each membrane, CYP19A1 and PTGS2 cDNAs were spotted as controls. Representative differential screening results are illustrated in Figure 2. The cDNA clones were classified as differentially expressed if they mainly hybridized with the DF-OF subtracted and DF unsubtracted probes but not with the reverse subtracted probe (OF-DF) and only faintly or not at all with the OF unsubtracted probe, as determined by comparing signal intensities between the four identical macroarrays. The differential hybridization screening procedure yielded 594 clones with a detectable hybridization signal, from which 222 (23.6%) were true positives. These cDNA clones were amplified by PCR and their products visualized on agarose gel to discern clones that presented a single PCR band for further sequencing (data not shown). Thus, 204 cDNA clones were sequenced and compared against GenBank databases. The cDNAs were classified as follow: 131 matched with sequences of known biological function for a total of 23 nonredundant cDNAs, 57 matched with complete or partial sequences of undefined biological function for a total of 9 different cDNAs (Table 1). Sixteen cDNA clones were rejected due to inadequate quality of the nucleotide sequences. It is noteworthy that low-density lipoprotein receptor-related protein 8 (LRP8; also known as apolipoprotein E receptor 2: ApoER2) [12], carboxypeptidase D (CPD) [12], CYP19A1 [14], CYP11A [15], inhibin/activin ß-A subunit (INHBA) [16], and serine protease inhibitor E2 (SERPINE2) [11, 12] were identified in the present study. Identification of these genes, known to be downregulated in bovine GC following the preovulatory LH/hCG surge, further validated the in vivo experimental model and the subtraction procedure used herein. Other genes, such as gap junction protein alpha 1 (GJA1; also known as connexin 43: CX43) [17], follicle-stimulating hormone receptor (FSHR) [18], and follistatin (FST) [19], are known to be expressed in GC, but to our knowledge, their levels of expression had not previously been shown to be downregulated in bovine GC by the preovulatory LH/hCG surge. Finally, we identified a further group of 14 cDNAs of known biological function and 9 other cDNAs and ESTs, never shown to be expressed in GC of any species.



View larger version (105K):
[in this window]
[in a new window]
  		FIG. 2. Representative differential screening results by macroarrays of the DF-OF subtracted cDNA library. PCR-amplified cDNA fragments obtained by SSH were dot blotted to generate four identical sets of membranes. The macroarrays were then hybridized with four different probes: subtracted DF-OF cDNAs (A), unsubtracted DF cDNAs (B), reverse subtracted OF-DF cDNAs (C), and unsubtracted OF cDNAs (D), as described under Materials and Methods. The two upper left-hand dots for each membrane served as internal hybridization controls: A1 = CYP19A1 (positive control for the forward reaction; DF-OF), and A2 = PTGS2 (positive control for the reverse reaction; OF-DF). The cDNA clones that were found to be differentially expressed in the DF-OF membrane following comparison of hybridization signals among the four membranes were further characterized by sequencing. In this example, differentially expressed cDNA clones (i.e., positive clones) corresponded to LRP8 (C9, G1, H3, H12), INHBA (C1, E1, F1, F11, H2, H9), RPA2 (C3), Homo sapiens cDNA FLJ11041(C2), TRIB2 (E10), and sequences with EST match in GenBank, like Bos taurus cDNA from GC and oocyte (C8: GenBank CF929638) and Bos taurus cDNA ovary (D6, G11, H5: GenBank CF929639)


View this table:
[in this window]
[in a new window]
  		TABLE 1. Identity of cDNA clones found to be differentially expressed by SSH in bovine granulosa cells of DF compared to OF

Analysis of mRNA Expression

Genes identified by macroarray analysis as downregulated by hCG were further validated by virtual Northern analysis using mRNA samples derived from GC collected from independent follicles at different developmental stages and CL at Day 5. For these analyses, mRNAs were reverse transcribed into cDNAs, separated on agarose gel, and used to generate membranes that were then hybridized to cloned SSH cDNA fragments as described in Table 1. Results for CYP19A1, INHBA, GJA1, ADP-ribosylation factor GTPase activating protein 3 (ARFGAP3), proteoglycan 1 (PRG1), replication protein A2 (RPA2), protein regulator of cytokinesis 1 (PRC1), and tribbles homolog 2 (TRIB2) mRNA expression are shown in Figure 3. The CYP19A1 and INHBA, known to be downregulated by LH/hCG, served as controls to validate the virtual Northern analyses. CYP19A1 mRNA was mainly expressed in the DF with a 7.5-fold higher expression level compared with SF. Treatment with hCG decreased CYP19A1 expression to background level in OF when compared with DF, and expression was undetectable in CL (Fig. 3A). The INHBA mRNA also increased, by 4-fold, from the SF to DF groups, whereas hCG downregulated its expression to background level in OF and in CL (Fig. 3A). Expression of GJA1 mRNA increased by 2.4-fold from the SF to DF groups. It was reduced by 16-fold in hCG-stimulated OF compared with DF and expression remained at a similar level in CL compared with OF (Fig. 3B). The expression level of ARFGAP3 mRNA was highest in DF compared with other samples and was reduced by 3-fold in OF (Fig. 3C). The PRG1 mRNA was expressed at highest level in SF, decreased in DF, and was significantly reduced, by 8-fold, in OF compared with DF, whereas the expression level remained low in CL (Fig. 3D). The RPA2 mRNA expression was 4-fold higher in DF compared with SF, and following treatment with hCG, expression was downregulated by at least 11-fold and reached background level in OF and CL. Transcripts of 5 kb and 2.1 kb were observed and their patterns of expression were identical between groups (Fig. 3E). The expression of PRC1 mRNA was highest in DF, showing an increase of 1.8-fold from SF to DF and a reduction of 4.9-fold from DF to OF (Fig. 3F). The TRIB2 mRNA was mainly detected in SF and DF; in hCG-stimulated OF, the expression level was downregulated by at least 24-fold and remained at background level in CL (Fig. 3F).



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 3. Analysis of mRNA expression by virtual Northern blot. Total RNA was extracted from bovine GC collected from 2 to 4 mm follicles (SF), dominant follicles (DF) at Day 5 of the estrous cycle, ovulatory follicles (OF) collected 23 h after injection of hCG, and corpora lutea (CL) from Day 5 of the estrous cycle, then used in mRNA expression analyses using the virtual Northern technique as described under Materials and Methods. GAPD was used as a control gene and showed no significant difference between groups. Gene-specific signals were normalized with corresponding GAPD signals (1.8 kb) for each sample, and relative values are reported as percent of expression detected in DF. A) Expression of CYP19A1 (5.2 kb) and INHBA (1.9 kb) mRNAs were higher in DF and were downregulated by hCG in OF (P < 0.0001); (B) expression of GJA1 mRNA (3.7 kb) was 16-fold lower in OF than in DF (P < 0.0001); (C) expression of ARFGAP3 mRNA (3.5 kb) was reduced 3-fold in OF compared with DF (P < 0.0001); (D) expression of PRG1 mRNA (1.4 kb) was reduced 8-fold in OF compared with DF (P < 0.0001); (E) transcripts of RPA2 mRNA detected at 5 and 2.1 kb were both downregulated by hCG in OF compared with DF (P < 0.0001); (F) transcript of PRC1 mRNA at 3.5 kb was reduced 4.9-fold in OF compared with DF (P < 0.0001); expression of TRIB2 mRNA at 3.6 kb was downregulated in OF compared with DF (P < 0.0001). Probability values for each one-way ANOVA analysis are specified above in parentheses. Different letters denote samples that differed significantly (P < 0.05) when Tukey-Kramer multiple comparison tests were performed. Data are presented as least-square means ± SEM, and the number of independent samples per group is indicated in parentheses

Expression of FSHR and FST mRNA were compared by RT-PCR because they presented weak signals by virtual Northern analysis (data not shown). Analysis of CYP19A1 was performed as a positive control for higher expression in the DF compared with the hGC-stimulated OF. Comparative RT-PCR analysis for CYP19A1 expression between groups mirrored results obtained by virtual Northern analysis (Fig. 3A), where hCG downregulated CYP19A1 mRNA in OF compare with DF (Fig. 4A). FSHR mRNA levels showed no significant difference in DF compared with SF but were reduced 6-fold following hCG treatment in OF and were undetectable in CL (Fig. 4A). Additionally, we compared the expression of the LHCGR mRNA because it has been shown to be downregulated by LH/hCG at the time of ovulation in the rat [20] and was not identified in the DF-OF subtracted cDNA library index (Table 1). We observed that the LHCGR mRNA was induced 16-fold in DF compared with SF, was downregulated 10-fold in hCG-stimulated OF, and thereafter expression increased in the developing CL. Oligonucleotides used in RT-PCR analyses for the LHCGR encompassed exons 2–11 and resulted in amplification of two cDNA fragments. These LHCGR transcripts showed a similar pattern of expression between groups (Fig. 4A) and were further characterized by cloning and sequencing. The higher molecular weight PCR product was identical to the characterized full-length bovine LHCGR (GenBank: U20504), whereas the lower molecular weight PCR product corresponded to an LHCGR transcript that lacked exon 10. The latter nucleotide sequence was deposited in GenBank (AY651759). FST mRNA expression showed no significant difference between DF and SF groups but was reduced 1.7-fold in hCG-treated OF and was undetectable in CL (Fig. 4A). Comparison of CYP11A1 mRNA levels showed a 2.7-fold increase from SF to DF, a reduction by 4.9-fold following hCG treatment in OF compared with DF, and then a 5.7-fold increase from OF to CL (Fig. 4B). Levels of IDH3A mRNA increased 2.3-fold from SF to DF and decreased 2.8-fold from DF to OF (Fig. 4B). Expression of SCD mRNA increased 3.4-fold from SF to DF and then decreased 5.6-fold in OF and remained at that level of expression in CL (Fig. 4B).



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 4. Analysis of mRNA expression by RT-PCR. Total RNA was extracted from bovine GC collected from 2- to 4-mm follicles (SF), dominant follicles (DF) at Day 5 of the estrous cycle, ovulatory follicles (OF) 23 h after injection of hCG (OF), and corpora lutea (CL) from Day 5 of the estrous cycle, then used in mRNA expression analyses using RT-PCR as described under Materials and Methods. GAPD was used as a control gene and showed no significant differences between groups. Gene-specific signals were normalized with corresponding GAPD signals for each sample. A) The analysis of CYP19A1 mRNA was performed as a positive control and was downregulated in OF compared with DF (P < 0.0001); expression of the FSHR was reduced 6-fold in OF compared with DF (P < 0.0001); LHCGR was induced 16-fold in DF compared with SF, downregulated 10-fold in OF (P < 0.0001); the higher molecular weight band corresponds to the full-length LHCGR mRNA (GenBank: U20504) and the lower molecular weight form to the LHCGR lacking exon 10 (Genbank: AY651759); FST mRNA was reduced by 1.7-fold in OF compared with DF (P < 0.006); (B) expression of CYP11A1 was 2.7 fold higher in DF than in SF, 4.9-fold lower in OF than in DF, and mRNA levels increased 5.7-fold in CL compared with OF (P < 0.0001); IDH3A mRNA was 2.3-fold higher in DF than in SF and was reduced 2.8-fold in OF compared with DF (P < 0.0004); SCD mRNA was 3.4-fold higher in DF than in SF, and its expression decreased 5.6-fold in OF and CL compared with DF (P < 0.0001). Probability values for each one-way ANOVA analysis are specified above in parentheses. Different letters denote samples that differed significantly (P < 0.05) when Tukey-Kramer multiple comparison tests were performed to compare group means for a specific gene. Data are presented as least-square means ± SEM, and the number of independent samples per group is indicated in parentheses


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The preovulatory LH surge induces several changes in different compartments of the ovarian follicle as it triggers ovulation, maturation of the cumulus oocyte complex, and luteinization. Molecular mechanisms abrogating the development of the DF and ensuring its transition into an OF are not completely understood. To elucidate the molecular basis involved in the transition of a DF into an OF, we performed an SSH screen designed to identify genes that are downregulated in GC of DF during hCG-induced ovulation. Comparisons of CYP19A1 and PTGS2 mRNA levels as control genes in the DF and OF groups validated the physiological model as well as the SSH and differential screening procedures. The CYP11A1 enzyme controls the first and limiting step of steroid biosynthesis, converting cholesterol to pregnenolone, and is under hormonal control through the cAMP signaling pathway [21]. A decrease of CYP11A1 mRNA in GC was observed following hCG treatment, which confirms previous results reported following the preovulatory LH surge in cattle [15]. IDH3A is part of a heterotetrameric enzyme complex believed to be a key regulatory point in the tricarboxylic acid cycle. It serves as a source for nonmitochondrial NADPH required in multiple metabolic pathways such as cholesterol and fatty acid synthesis [22] as well as defense against oxidative damage [23]. In the immature rat ovary, in which follicular development was promoted by gonadotropin treatment, expression of IDH3A was increased at the mRNA and protein levels [22], correlating with the highest expression of IDH3A mRNA detected in GC of bovine DF. Higher levels of IDH3A expression may correlate with the high metabolic requirements and defense against oxidative stress typical of an actively growing DF. We have recently reported that the expression of LRP8/ApoER2, CPD, and SERPINE2 mRNAs are upregulated in GC of DF but downregulated by hCG in OF and have discussed their potential actions associated with follicular development [11, 12].

Novel candidate genes associated with follicular growth and dominance, such as ARFGAP3, PRC1, PRG1, RPA2, SCD, and TRIB2, were identified in the DF-OF subtracted library. For instance, PRG1, also known as serglycin, is a member of the small proteoglycan family characterized by repeat sequences of serine and glycine amino acids on which the serine residues serve as attachment sites for glycosaminoglycans (GAG). The type and length of GAG attached to the protein core may differ between cell types [24, 25]. Many biological roles are attributed to proteoglycans in the control of growth and differentiation: cell attachment and migration, binding and regulation of growth factors, binding to proteolytic enzymes and protease inhibitors [24, 25]. It is known that proteoglycans are produced by GC, stimulated by FSH, and secreted in follicular fluid [26, 27]. Bovine follicular fluid collected from small antral follicles contains proteoglycan forms that differ from that of large antral follicles, although the identity of protein cores was not determined [28, 29]. In agreement with these observations, we showed that PRG1 mRNA is expressed at higher levels in SF compared with DF, and its expression is drastically diminished following hCG injection. Moreover, mRNA for chondroitin sulfate proteoglycan-2 (CSPG2), also known as versican, was expressed at higher levels in GC of DF compared with SF [12]. Thus, mRNA expression coding for two protein cores of proteoglycans in GC, PRG1, and CSPG2 was shown to vary in relation to follicular growth and ovulation. These results are in concordance with the variable nature of GAG purified from follicular fluid in relation to follicular development [28, 29].

TRIB2 was found to be expressed in GC of SF and DF but downregulated by hCG in OF. In humans, TRIB1, 2, and 3 represent novel atypical members of the serine/threonine protein kinase superfamily [30, 31] and are homologs of Drosophila tribbles [32–34]. In mammals, the three TRIB proteins share a central TRIB domain that lacks key residues required for kinase activity [30–32]. TRIBs were shown to bind and inhibit members of the mitogen-activated kinase kinase (MAPKK) family, the serine-threonine kinase AKT1 (also called protein kinase B), thereby controlling MAPKs signaling pathways [31, 35, 36]. TRIB mRNAs are rapidly induced by mitogens, have short half-lives, and were shown to be expressed differentially in the tissues analyzed [30, 31, 37]. TRIB2 mRNA expression in canine thyroid cells was upregulated by TSH [37]. In Drosophila, tribbles controls string/CDC25 phosphatase that is required for the progression of G2 cell cycle stage into mitosis. Thus, tribbles plays a key role in coordinating mitosis and morphogenesis. For instance, modification of tribbles expression in Drosophila alters fertility [32–34]. These studies suggested that Tribbles may act as a proliferation brake by controlling string/CDC25 phosphatase activity. Although the known biological function of TRIB2 is still limited, cumulatively, these observations suggest that TRIB would modulate MAPK signaling pathways in response to incoming extracellular signals that include hormones and growth factors. We hypothesize that TRIB2 could act as a modulator of GC proliferation in growing antral follicles.

Expression of bovine SCD mRNA was found at the highest level in GC of DF and downregulated by hCG in OF. SCD encodes for a membrane-bound enzyme representing an important metabolic control point in the cellular synthesis of monounsaturated fatty acids, mainly oleate and palmitoleate. These are the major monounsaturated fatty acids incorporated into membrane phospholipids, triglycerides, and cholesterol esters, and modification of their concentration has been implicated in a variety of diseases [38, 39]. Expression of SCD is hormonally modulated, being downregulated by leptin in liver and adipose tissues [40] or upregulated by FSH and cAMP in Sertoli cells [41]. The chief expression of SCD in GC of DF could be related to a higher demand of monounsaturated fatty acids required for the maintenance of membrane fluidity [42] or as substrate in signal-transduction mechanisms [38, 39] needed during the rapid phase of follicle growth associated with follicular dominance. ARFGAP3 mRNA expression was reduced in GC of hCG-stimulated OF compared with DF. ARFGAP3 is a recently characterized member of the ADP-ribosylation factor (ARF) family of small GTPases [43, 44] that cycles between a GDP-bound, inactive and a GTP-bound, active form [45, 46]. In general, ARFGAP proteins are involved in intracellular trafficking of proteins through vesicular transport and signal transduction events. However, ARFGAP3's biological function has not yet been defined. AFRGAP3 expression was analyzed by mRNA dot-blotting of human tissues, which revealed high expression in endocrine tissues, such as the testis. Expression of AFRGAP3 in total human ovarian extract has also been detected, but the physiological status of the ovary was not mentioned [44]. Based on the limited information available on the biological function of ARFGAP3, higher expression of ARFGAP3 in GC of DF could be interpreted as an increase in membrane trafficking and/or signaling activities in growing DF.

The replication protein A (RPA) is a heterotrimeric protein, consisting of 70 kDa (RPA1), 30 kDa (RPA2), and 14 kDa (RPA3) subunits, that is required for DNA replication, recombination, and repair [47]. RPA has also been implicated in the regulation of apoptosis and transcription [48]. RPA is phosphorylated in a cell cycle-dependent manner, beginning at the G1/S transition and extending until late mitosis, and in response to DNA damage. RPA binds single-stranded DNA and specifically interacts with multiple proteins involved in DNA metabolism. Transcripts of 2.1 and 5 kb were observed for bovine RPA2. The 2.1 kb transcript corresponds to the 1.7-kb human cDNA (GenBank: BC021257) while the 5 kb isoform may represent an unspliced higher molecular weight form. However, mRNA expression studies by Northern analysis have not been reported in other species at this time. PRC1 is a microtubule bundling protein that acts as a checkpoint in the formation of the central spindle bundle in anaphase, which contributes to the abscission event that creates two daughter cells [49]. PRC1 is phosphorylated by cyclin-dependent kinase (mainly CDC2/CCNB1), which, during mitosis, prevents interaction with other proteins, insuring that cell division is not initiated until chromosomes are separated [50]. The biological functions of RPA2 and PRC1 in cell division and survival are in concordance with a higher expression of theses genes in GC of an actively growing DF.

GJA1 is a member of the gap junction subunits named connexins. Among gap junction proteins identified in GC, GJA1 is important for normal follicular development because folliculogenesis in GJA1-deficient mice stops at the primary follicular stage [51, 52]. In the bovine species, follicular localization of GJA1 was restricted to GC at all follicular stages, was increased in the course of follicular growth, and decreased in atretic follicles [17, 53]. These observations corroborate the increase in GJA1 mRNA expression detected herein in DF compared with SF. Expression and phosphorylation of GJA1 is hormonally regulated by FSH [54–56]. However, the development of the DF is concomitant to a decrease in circulating FSH concentration in cattle [5, 6]. In the rat ovary, increases in GJA1 mRNA and protein were observed following E2 treatments [57]. Collectively, these results suggest that an increase in E2 production by the DF could stimulate an increase in GJA1 expression, which insures metabolic coupling between GC of a growing DF to prevent atresia. Conversely, the LH/ hCG surge would abrogate GC coupling contributing to ovulation and luteinization.

Spatiotemporal expression studies showed higher mRNA level for INHBA in estrogen active follicles [12, 58, 59] and increases in activin-A protein secreted in follicular fluid [60]. Activin promotes GC proliferation and steroidogenesis and potentiates FSH actions on GC by increasing FSHR expression [61, 62], which underscores a key role for activin-A in DF development. Inhibin and FST, also produced by GC, control at the extracellular level the stimulatory actions of activin on follicle growth and steroidogenesis [63, 64]. No difference in FST mRNA expression was found in DF compared with SF, which is consistent with no difference in FST protein concentration measured in follicular fluid [65]. FST is known to bind activin with high affinity, preventing activin action on GC [66]. Transgenic mice overexpressing [67] or deficient in FST [68] presented a decrease in follicular development. Collectively, these observations support a pivotal role for activin in GC proliferation and differentiation whereas FST would act as a modulator of activin action. At the time of ovulation, FST mRNA expression decreased in hCG-stimulated OF and was not detected in CL, which corroborates observations in the rat [69]. Persistence of FST expression in OF in the absence of INHBA mRNA expression would contribute to neutralizing extracellular activin at the time of ovulation.

Expression of the FSHR in GC of SF (2–4 mm) mediates the induction of follicular recruitment following the increase in circulating concentration of FSH [2, 4], which occurs two or three times during the bovine estrous cycle [5, 6]. A similar level of FSHR mRNA in the SF and DF is in accordance with the concept that the FSHR may contribute to but is not responsible for the establishment and/ or the maintenance of the DF when circulating FSH concentration declines [5, 6, 70]. Decreased FSHR mRNA in GC following the gonadotropin preovulatory surge concurs with the initiation of GC luteinization and its downregulation observed in cultured bovine GC when FSH concentration is increased [18]. LHCGR cDNA was not identified in the DF-OF subtracted library; the exact explanation is unknown but could be related to its low level of expression in GC, to the limited number of cDNA clones analyzed, to the detection limits of the differential screening procedure of the subtracted library, or to the presence of isoforms that modify hybridization kinetics during SSH. Full-length LHCGR expression in GC was thus compared by RT-PCR, allowing characterization of a truncated LHCGR isoform that lacks exon 10. The latter was identified in the bovine CL and referred to the LHCGR isoform F [71]. In vitro expression studies have shown that human LHCGR lacking exon 10 is able to bind LH but the production of cAMP is impaired when stimulated by LH [72]. Collectively, these findings suggest that the biological function of the LHCGR lacking exon 10 could modulate LH signaling in GC of DF and CL according to variations in circulating concentrations of LH due to its pulsatile nature. LHCGR mRNAs were not detected in GC of SF but were observed in DF. Thus, expression of LHCGR in GC of DF contributes to the development and maintenance of the DF, ensuring its survival via circulating LH when FSH is reduced [73, 74]. Analysis confirmed that LHCGR mRNA was reduced in hCG-stimulated OF, in agreement with observations in other species during the periovulatory period [8, 20]. Other cDNAs that correspond to uncharacterized cDNAs/BAC clones or EST sequences were also identified. The cloning of their full-length cDNA and spatiotemporal expression analysis in follicles are currently underway.


   ACKNOWLEDGMENTS
 
The authors thank Mrs. Manon Salvas for her technical assistance during nucleic acid sequencing and Dr. Christine Theoret (Université de Montréal) for constructive comments on the manuscript.


   FOOTNOTES
 
1 Supported by a Discovery Grant to J.G.L. from the Natural Sciences and Engineering Research Council of Canada (NSERC), a CORPAQ grant from the Ministère de l'agriculture, des pêcheries et de l'alimentation du Qué bec and a FQRNT grant from le Fonds Québécois de la Recherche sur la Nature et les Technologies. Back

2 Correspondence: Jacques G. Lussier, Faculté de médecine vétérinaire, Université de Montréal, P.O. Box 5000, St-Hyacinthe, Québec, Canada, J2S 7C6. FAX: 450 778 8103; jacques.lussier{at}umontreal.ca Back

Received: 11 November 2004.

First decision: 14 December 2004.

Accepted: 5 April 2005.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lussier JG, Matton P, Dufour JJ. Growth rates of follicles in the ovary of the cow. J Reprod Fertil 1987 81:301-307
  2. Lussier JG, Matton P, Guilbault LA, Grasso F, Mapletoft RJ, Carruthers TD. Ovarian follicular development and endocrine responses in follicular-fluid-treated and hemi-ovariectomized heifers. J Reprod Fertil 1994 102:95-105
  3. Markström E, Svensson EC, Shao R, Svanberg B, Billig H. Survival factors regulating ovarian apoptosis-dependence on follicle differentiation. Reproduction 2002 123:23-30[Abstract]
  4. Gong JG, Campbell BK, Bramley TA, Gutierrez CG, Peters AR, Webb R. Suppression in the secretion of follicle-stimulating hormone and luteinizing hormone, and ovarian follicle development in heifers continuously infused with a gonadotropin-releasing hormone agonist. Biol Reprod 1996 55:68-74[Abstract]
  5. Fortune JE, Rivera GM, Evans ACO, Turzillo AM. Differentiation of dominant versus subordinate follicles in cattle. Biol Reprod 2001 65:648-654[Abstract/Free Full Text]
  6. Ginther OJ, Beg MA, Bergfelt DR, Donadeu FX, Kot K. Follicle selection in monovular species. Biol Reprod 2001 65:638-647[Abstract/Free Full Text]
  7. Sirois J. Induction of prostaglandin endoperoxide synthase-2 by human chorionic gonadotropin in bovine preovulatory follicles in vivo. Endocrinology 1994 135:841-848[Abstract]
  8. Richards JS, Russell DL, Ochsner S, Espey LL. Ovulation: new dimensions and new regulators of the inflammatory-like response. Annu Rev Physiol 1994 64:69-92
  9. Hennebold JD. Characterization of the ovarian transcriptome through the use of differential analysis of gene expression methodologies. Hum Reprod Update 2004 10:227-239[Abstract/Free Full Text]
  10. Diatchenko L, Lukyanov S, Lau Y-FC, Siebert PD. Suppression substractive hybridization: a versatile method for identifying differentially expressed genes. Methods Enzymol 1999 303:349-379[CrossRef][Medline]
  11. Bédard J, Brûlé S, Price CA, Silversides DW, Lussier JG. Serine protease inhibitor-E2 (SERPINE2) is differentially expressed in granulosa cells of dominant follicle in cattle. Molec Reprod Dev 2003 64:152-165
  12. Fayad T, Lévesque V, Sirois J, Silversides DW, Lussier JG. Gene expression profiling of differentially expressed genes in granulosa cells of bovine dominant follicles using suppression subtractive hybridization. Biol Reprod 2004 70:523-533[Abstract/Free Full Text]
  13. Lévesque V, Fayad T, Ndiaye K, Nahé Diouf M, Lussier JG. Size-selection of cDNA libraries for the cloning of cDNAs after suppression subtractive hybridization. Biotechniques 2003 35:72-78[Medline]
  14. Komar CM, Berndtson AK, Evans ACO, Fortune JE. Decline in circulating estradiol during the periovulatory period is correlated with decreases in estradiol and androgen, and in messenger RNA for P450 aromatase and P450 17 {alpha}-hydroxylase, in bovine preovulatory follicles. Biol Reprod 2001 64:1797-1805[Abstract/Free Full Text]
  15. Voss AK, Fortune JE. Levels of messenger ribonucleic acid for cholesterol side-chain cleavage cytochrome P-450 and 3 beta-hydroxysteroid dehydrogenase in bovine preovulatory follicles decrease after the luteinizing hormone surge. Endocrinology 1993 132:888-894[Abstract/Free Full Text]
  16. Juengel JL, Imakawa K, Farin PW, Youngquist RS, Roberts RM, Smith MF, Garverick HA. Detection of mRNA for inhibin alpha- and beta A-subunits in bovine ovarian tissues and the effect of in vivo administration of GNRH. Domest Anim Endocrinol 1993 10:207-218[CrossRef][Medline]
  17. Nuttinck F, Peynot N, Humblot P, Massip A, Dessy F, Fléchon JE. Comparative immunohistochemical distribution of connexin 37 and connexin 43 throughout folliculogenesis in the bovine ovary. Mol Reprod Dev 2000 57:60-66[CrossRef][Medline]
  18. Houde A, Lambert A, Saumande J, Silversides DW, Lussier JG. Structure of the bovine follicle-stimulating hormone receptor complementary DNA and expression in bovine tissues. Mol Reprod Dev 1994 39:127-135[CrossRef][Medline]
  19. Houde A, Lussier JG, Ethier JF, Gagnon C, Silversides DW. Cloning and tissue expression of bovine follistatin cDNA. Mol Reprod Dev 1994 37:391-397[CrossRef][Medline]
  20. Segaloff DL, Wang HY, Richards JS. Hormonal regulation of luteinizing hormone/chorionic gonadotropin receptor mRNA in rat ovarian cells during follicular development and luteinization. Mol Endocrinol 1990 4:1856-1865[Abstract/Free Full Text]
  21. Niswender GD. Molecular control of luteal secretion of progesterone. Reproduction 2002 123:333-339[Abstract]
  22. Jennings GT, Sechi S, Stevenson PM, Tuckey RC, Parmelee D, McAlister-Henn L. Cytosolic NADP(+)-dependent isocitrate dehydrogenase. Isolation of rat cDNA and study of tissue-specific and developmental expression of mRNA. J Biol Chem 1994 269:23128-23134[Abstract/Free Full Text]
  23. Kim SY, Park JW. Cellular defense against singlet oxygen-induced oxidative damage by cytosolic NADP+-dependent isocitrate dehydrogenase. Free Radic Res 2003 37:309-316[CrossRef][Medline]
  24. Kolset SO, Prydz K, Pejler G. Intracellular proteoglycans. Biochem J 2004 379:217-227[CrossRef][Medline]
  25. Prydz K, Dalen KT. Synthesis and sorting of proteoglycans. J Cell Sci 2000 113:193-205[Abstract]
  26. Bellin ME, Lenz RW, Steadman LE, Ax RL. Proteoglycan production by bovine granulosa cells in vitro occurs in response to FSH. Mol Cell Endocrinol 1983 29:51-65[CrossRef][Medline]
  27. Salustri A, Camaioni A, Di Giacomo M, Fulop C, Hascall VC. Hyaluronan and proteoglycans in ovarian follicles. Hum Reprod Update 1999 5:293-301[Abstract/Free Full Text]
  28. Grimek HJ, Bellin ME, Ax RL. Characteristics of proteoglycans isolated from small and large bovine ovarian follicles. Biol Reprod 1984 30:397-409[Abstract]
  29. McArthur ME, Irving-Rodgers HF, Byers S, Rodgers RJ. Identification and immunolocalization of decorin, versican, perlecan, nidogen, and chondroitin sulfate proteoglycans in bovine small-antral ovarian follicles. Biol Reprod 2000 63:913-924[Abstract/Free Full Text]
  30. Wilkin F, Suarez-Huerta N, Robaye B, Peetermans J, Libert F, Dumont JE, Maenhaut C. Characterization of a phosphoprotein whose mRNA is regulated by the mitogenic pathways in dog thyroid cells. Eur J Biochem 1997 248:660-668[Medline]
  31. Kiss-Toth E, Bagstaff SM, Sung HY, Jozsa V, Dempsey C, Caunt JC, Oxley KM, Wyllie DH, Polgar T, Harte M, O'Neill LA, Qwarnstrom EE, Dower SK. Human tribbles: a protein family controlling mitogen activated protein kinase cascades. J Biol Chem 2004 279:42703-42708[Abstract/Free Full Text]
  32. Seher TC, Leptin M. Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr Biol 2000 10:623-629[CrossRef][Medline]
  33. Mata J, Curado S, Ephrussi A, Rorth P. Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 2000 101:511-522[CrossRef][Medline]
  34. Grosshans J, Wieschaus E. A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell 2000 101:523-531[CrossRef][Medline]
  35. Koo SH, Satoh H, Herzig S, Lee CH, Hedrick S, Kulkarni R, Evans RM, Olefsky J, Montminy M. PGC-1 promotes insulin resistance in liver through PPAR-alpha-dependent induction of TRB-3. Nat Med 2004 10:530-534[CrossRef][Medline]
  36. Du K, Herzig S, Kulkarni RN, Montminy M. TRB3: a tribbles homolog that inhibits Akt/PKB activation by insulin in liver. Science 2003 300:1574-1577[Abstract/Free Full Text]
  37. Wilkin F, Savonet V, Radulescu A, Petermans J, Dumont JE, Maenhaut C. Identification and characterization of novel genes modulated in the thyroid of dogs treated with methimazole and propylthiouracil. J Biol Chem 1996 271:28451-28457[Abstract/Free Full Text]
  38. Nakamura MT, Nara TY. Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annu Rev Nutr 2004 24:345-376[CrossRef][Medline]
  39. Dobrzyn A, Ntambi JM. The role of stearoyl-CoA desaturase in body weight regulation. Trends Cardiovasc Med 2004 14:77-81[CrossRef][Medline]
  40. Cohen P, Ntambi JM, Friedman JM. Stearoyl-CoA desaturase-1 and the metabolic syndrome. Curr Drug Targets Immune Endocr Metabol Disord 2003 3:271-280[CrossRef][Medline]
  41. Saether T, Tran TN, Rootwelt H, Christophersen BO, Haugen TB. Expression and regulation of delta5-desaturase, delta6-desaturase, stearoyl-coenzyme A (CoA) desaturase 1, and stearoyl-CoA desaturase 2 in rat testis. Biol Reprod 2003 69:117-124[Abstract/Free Full Text]
  42. Hao M, Mukherjee S, Sun Y, Maxfield FR. Effects of cholesterol depletion and increased lipid unsaturation on the properties of endocytic membranes. J Biol Chem 2004 279:14171-14178[Abstract/Free Full Text]
  43. Liu X, Zhang C, Xing G, Chen Q, He F. Functional characterization of novel human ARFGAP3. FEBS Lett 2001 490:79-83[CrossRef][Medline]
  44. Zhang C, Yu Y, Zhang S, Liu M, Xing G, Wei H, Bi J, Liu X, Zhou G, Dong C, Hu Z, Zhang Y, Luo L, Wu C, Zhao S, He F. Characterization, chromosomal assignment, and tissue expression of a novel human gene belonging to the ARF GAP family. Genomics 2000 63:400-408[CrossRef][Medline]
  45. Donaldson JG. Filling in the GAPs in the ADP-ribosylation factor story. Proc Natl Acad Sci U S A 2000 97:3792-3794[Free Full Text]
  46. Chavrier P, Goud B. The role of ARF and Rab GTPases in membrane transport. Curr Opin Cell Biol 1999 11:466-475[CrossRef][Medline]
  47. Wold MS. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annu Rev Biochem 1997 66:61-92[CrossRef][Medline]
  48. Iftode C, Daniely Y, Borowiec JA. Replication protein A (RPA): the eukaryotic SSB. Crit Rev Biochem Mol Biol 1999 34:141-180[CrossRef][Medline]
  49. Mollinari C, Kleman JP, Jiang W, Schoehn G, Hunter T, Margolis RL. PRC1 is a microtubule binding and bundling protein essential to maintain the mitotic spindle midzone. J Cell Biol 2002 157:1175-1186[Abstract/Free Full Text]
  50. Zhu C, Jiang W. Cell cycle-dependent translocation of PRC1 on the spindle by Kif4 is essential for midzone formation and cytokinesis. Proc Natl Acad Sci U S A 2005 102:343-348[Abstract/Free Full Text]
  51. Juneja SC, Barr KJ, Enders GC, Kidder GM. Defects in the germ line and gonads of mice lacking connexin 43. Biol Reprod 1999 60:1263-1270[Abstract/Free Full Text]
  52. Ackert CL, Gittens JE, O'Brien MJ, Eppig JJ, Kidder GM. Intercellular communication via connexin-43 gap junctions is required for ovarian folliculogenesis in the mouse. Dev Biol 2001 233:258-270[CrossRef][Medline]
  53. Johnson ML, Redmer DA, Reynolds LP, Grazul-Bilska AT. Expression of gap junctional proteins connexin 43, 32 and 26 throughout follicular development and atresia in cows. Endocrine 1999 10:43-51[CrossRef][Medline]
  54. Granot I, Dekel N. Developmental expression and regulation of the gap junction protein and transcription in rat ovaries. Mol Reprod Dev 1997 47:231-239[CrossRef][Medline]
  55. Sommersberg B, Bulling A, Salzer U, Frohlich U, Garfield RE, Amsterdam A, Mayerhofer A. Gap junction communication and connexin-43 gene expression in a rat granulosa cell line: regulation by follicle-stimulating hormone. Biol Reprod 2000 63:1661-1668[Abstract/Free Full Text]
  56. Johnson ML, Redmer DA, Reynolds LP, Bilski JJ, Grazul-Bilska AT. Gap junctional intercellular communication of bovine granulosa and thecal cells from antral follicles: effects of luteinizing hormone and follicle-stimulating hormone. Endocrine 2002 18:261-270[CrossRef][Medline]
  57. Wiesen JF, Midgley AR Jr. Expression of connexin 43 gap junction messenger ribonucleic acid and protein during follicular atresia. Biol Reprod 1994 50:336-348[Abstract]
  58. Sisco B, Hagemann LJ, Shelling AN, Pfeffer PL. Isolation of genes differentially expressed in dominant and subordinate bovine follicles. Endocrinology 2003 144:3904-3913[Abstract/Free Full Text]
  59. Ireland JL, Ireland JJ. Changes in expression of inhibin/activin alpha, beta A and beta B subunit messenger ribonucleic acids following increases in size and during different stages of differentiation or atresia of non-ovulatory follicles in cows. Biol Reprod 1994 50:492-501[Abstract]
  60. Ginther OJ, Beg MA, Bergfelt DR, Kot K. Activin A, estradiol, and free insulin-like growth factor 1 in follicular fluid preceding the experimental assumption of follicle dominance in cattle. Biol Reprod 2002 67:14-19[Abstract/Free Full Text]
  61. Hasegawa Y, Miyamoto K, Abe Y, Nakamura T, Sugino H, Eto Y, Shibai H, Igarashi M. Induction of follicle-stimulating hormone receptor by erythroid differentiation factor on rat granulosa cells. Biochem Biophys Res Commun 1988 156:668-674[CrossRef][Medline]
  62. Xiao S, Robertson DM, Findlay JK. Effects of activin and follicle-stimulating hormone (FSH)-suppressing protein/follistatin on FSH receptors and differentiation of cultured rat granulosa cells. Endocrinology 1992 131:1009-1016[Abstract/Free Full Text]
  63. Wrathall JH, Knight PG. Effects of inhibin-related peptides and estradiol on androstenedione and progesterone secretion by bovine theca cells in vitro. J Endocrinol 1995 145:491-500[Abstract/Free Full Text]
  64. Welt C, Sidis Y, Keutmann H, Schneyer A. Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp Biol Med 2002 227:724-752[Abstract/Free Full Text]
  65. Knight PG, Glister C. Local roles of TGF-ß superfamily members in the control of ovarian follicle development. Anim Reprod Sci 2003 78:165-183[CrossRef][Medline]
  66. Glister C, Kemp CF, Knight PG. Bone morphogenetic protein (BMP) ligands and receptors in bovine ovarian follicle cells: actions of BMP-4, -6 and -7 on granulosa cells and differential modulation of Smad-1 phosphorylation by follistatin. Reproduction 2004 127:239-254[Abstract/Free Full Text]
  67. Guo Q, Kumar TR, Woodruff T, Hadsell LA, DeMayo FJ, Matzuk MM. Overexpression of mouse follistatin causes reproductive defects in transgenic mice. Mol Endocrinol 1998 12:96-106[Abstract/Free Full Text]
  68. Jorgez CJ, Klysik M, Jamin SP, Behringer RR, Matzuk MM. Granulosa cell-specific inactivation of follistatin causes female fertility defects. Mol Endocrinol 2004 18:953-967[Abstract/Free Full Text]
  69. Ogawa K, Kurohmaru M, Sugino H, Hayashi Y. Changes in the immunoreactivity of follistatin within preovulatory follicles after the primary gonadotrophin surge in rats. J Reprod Fertil 1994 101:577-481
  70. Mihm M, Good TEM, Ireland JLH, Ireland JJ, Knight PG, Roche JF. Decline in serum follicle-stimulating hormone concentrations alters key intrafollicular growth factors involved in selection of the dominant follicle in heifers. Biol Reprod 1997 57:1328-1337[Abstract]
  71. Kawate N, Okuda K. Coordinated expression of splice variants for luteinizing hormone receptor messenger RNA during the development of bovine corpora lutea. Mol Reprod Dev 1998 51:66-75[CrossRef][Medline]
  72. Müller T, Gromoll J, Simoni M. Absence of exon 10 of the human luteinizing hormone (LH) receptor impairs LH, but not human chorionic gonadotropin action. J Clin Endocrinol Metab 2003 88:2242-2249[Abstract/Free Full Text]
  73. Bao B, Garverick HA, Smith GW, Smith MF, Salfen BE, Youngquist RS. Changes in messenger ribonucleic acid encoding luteinizing hormone receptor, cytochrome P450-side chain cleavage, and aromatase are associated with recruitment and selection of bovine ovarian follicles. Biol Reprod 1997 56:1158-1168[Abstract]
  74. Evans AC, Fortune JE. Selection of the dominant follicle in cattle occurs in the absence of differences in the expression of messenger ribonucleic acid for gonadotropin receptors. Endocrinology 1997 138:2963-2971[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 ReproductionHome page
X. Zheng, C. A Price, Y. Tremblay, J. G Lussier, and P. D Carriere
Role of transforming growth factor-{beta}1 in gene expression and activity of estradiol and progesterone-generating enzymes in FSH-stimulated bovine granulosa cells
Reproduction, October 1, 2008; 136(4): 447 - 457.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
M. Hamel, I. Dufort, C. Robert, C. Gravel, M.-C. Leveille, A. Leader, and M.-A. Sirard
Identification of differentially expressed markers in human follicular cells associated with competent oocytes
Hum. Reprod., May 1, 2008; 23(5): 1118 - 1127.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
A Bonnet, R Dalbies-Tran, and M A Sirard
Opportunities and challenges in applying genomics to the study of oogenesis and folliculogenesis in farm animals
Reproduction, February 1, 2008; 135(2): 119 - 128.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
H. L Henderson, D. J Hodson, S. J Gregory, J. Townsend, and D. J Tortonese
Gonadotropin-Releasing Hormone Stimulates Prolactin Release from Lactotrophs in Photoperiodic Species Through a Gonadotropin-Independent Mechanism
Biol Reprod, February 1, 2008; 78(2): 370 - 377.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
O.J Ginther, M.D Utt, M.A Beg, E.L Gastal, and M.O Gastal
Negative Effect of Estradiol on Luteinizing Hormone Throughout the Ovulatory Luteinizing Hormone Surge in Mares
Biol Reprod, September 1, 2007; 77(3): 543 - 550.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
T. Fayad, R. Lefebvre, J. Nimpf, D. W. Silversides, and J. G. Lussier
Low-Density Lipoprotein Receptor-Related Protein 8 (LRP8) Is Upregulated in Granulosa Cells of Bovine Dominant Follicle: Molecular Characterization and Spatio-Temporal Expression Studies
Biol Reprod, March 1, 2007; 76(3): 466 - 475.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
C. Agca, J. E Ries, S. J Kolath, J.-H. Kim, L. J Forrester, E. Antoniou, K. M Whitworth, N. Mathialagan, G. K Springer, R. S Prather, et al.
Luteinization of porcine preovulatory follicles leads to systematic changes in follicular gene expression
Reproduction, July 1, 2006; 132(1): 133 - 145.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
M. N. Diouf, K. Sayasith, R. Lefebvre, D. W. Silversides, J. Sirois, and J. G. Lussier
Expression of Phospholipase A2 Group IVA (PLA2G4A) Is Upregulated by Human Chorionic Gonadotropin in Bovine Granulosa Cells of Ovulatory Follicles
Biol Reprod, June 1, 2006; 74(6): 1096 - 1103.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
E L Gastal, M O Gastal, and O J Ginther
Relationships of changes in B-mode echotexture and colour-Doppler signals in the wall of the preovulatory follicle to changes in systemic oestradiol concentrations and the effects of human chorionic gonadotrophin in mares.
Reproduction, April 1, 2006; 131(4): 699 - 709.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M. Cao, J. Buratini Jr, J. G Lussier, P. D Carriere, and C. A Price
Expression of protease nexin-1 and plasminogen activators during follicular growth and the periovulatory period in cattle
Reproduction, January 1, 2006; 131(1): 125 - 137.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/2/324    most recent
biolreprod.104.038026v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.
Agricola
Right arrow Articles by Ndiaye, K.
Right arrow Articles by Lussier, J. G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS