Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print May 18, 2005.
Biol Reprod 2005, 10.1095/biolreprod.104.039180
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/4/598    most recent
biolreprod.104.039180v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.
Agricola
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.
BIOLOGY OF REPRODUCTION 73, 598–609 (2005)
DOI: 10.1095/biolreprod.104.039180
© 2005 by the Society for the Study of Reproduction, Inc.

Identification of a New Variant of PDE1A Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase Expressed in Mouse Sperm1

Valeria Vasta 3 , William K. Sonnenburg 3, 4, Chen Yan 5, Scott H. Soderling 6, Masami Shimizu-Albergine , and Joseph A. Beavo 2 

Department of Pharmacology, University of Washington, Seattle, Washington 98195


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
In mature sperm, cAMP plays an important role as a second messenger regulating functions that include capacitation, the acrosome reaction, motility, and, in some cases, chemosensing. We have cloned from mouse testis a novel calmodulin-stimulated cyclic nucleotide phosphodiesterase 1A isoform, Pde1a_v7 (mmPDE1A7), which arises from an alternative transcription start in the cyclic nucleotide phosphodiesterase 1A gene. The open reading frame is predicted to encode a polypeptide with a molecular mass of 52 kDa. Two further variants of this form, which contain two additional new exons, arise from alternative splicing. Analysis of testis cDNA by real-time polymerase chain reaction (PCR) indicates that the Pde1A_v7 transcript variant is the most abundant. The PDE1A_v7 protein uniquely lacks the first amino-terminal calmodulin-binding domain, but does possess an inhibitory domain and a second calmodulin-binding site shared with other variants. In vitro translation of the corresponding Pde1a_v7 cDNA produced a 52-kDa polypeptide having cyclic nucleotide hydrolytic activity, which was stimulated threefold by calcium-bound calmodulin. Immunoprecipitation of cyclic nucleotide phosphodiesterase 1 activity from detergent extracts of mouse sperm revealed a major protein of the size expected for PDE1A_v7, and the immunocytochemical staining for cyclic nucleotide phosphodiesterase 1A in mouse sperm showed intense immunoreactivity in the tail only. These observations, along with the PCR data, strongly suggest that this new variant PDE1A_v7 is the major form of cyclic nucleotide phosphodiesterase 1A expressed in mature sperm and is therefore likely to play an important role in cyclic nucleotide regulation of mature sperm function.

calcium, signal transduction, sperm capacitation, sperm maturation, sperm motility and transport


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
Cyclic AMP controls processes crucial to sperm function such as motility, capacitation, hyperactivation, and the acrosome reaction, all of which are required for sperm to reach and fuse with the oocyte [1]. Bicarbonate in seminal and female reproductive tract fluid is thought to be the major extracellular factor that activates sperm when they leave the epididymis. It acts by increasing the production of cAMP through stimulation of a specific adenylyl cyclase [2]. The importance of the cAMP pathway is underscored by the severe sperm-motility defect of mice deficient for this type of adenylyl cyclase [3]. The molecular mechanisms of cAMP action in sperm are not completely understood but are thought to involve phosphorylation of proteins through protein kinase A (PKA), resulting in membrane lipid remodeling and regulation of ion channels [1]. Sperm from knockout mice for the C{alpha}2 catalytic subunit of PKA that is expressed in postmeiotic germ cells do not increase flagellar beat frequency upon bicarbonate treatment, which highlights the regulatory role of PKA [4]. Treatment of sperm with inhibitors of cyclic nucleotide phosphodiesterases (PDEs), the enzymes that degrade cyclic nucleotides, produces marked stimulation of cAMP-dependent motility [5, 6]. For this reason, nonspecific PDE inhibitors, for example pentoxifylline and caffeine, have been used empirically for years for in vitro fertilization protocols to support sperm capacitation and increase rates of fertilization [5].

These observations lead to the hypothesis that one or more PDEs must be basally active and maintain sperm in a resting state in the epididymis, thereby avoiding premature activation. Conversely, physiological silencing of PDEs is likely to be a necessary step during sperm activation, thereby allowing cAMP to be increased by the bicarbonate-sensitive adenylyl cyclase. Moreover, at successive steps a PDE is likely to be required for a feedback regulatory loop in analogy with other cellular desensitization regulatory circuits controlled by cAMP. Despite the indirect evidence of a role for PDEs in modulating sperm activation, there is no comprehensive knowledge of the presence, activity, subcellular localization, and particularly of the function of individual PDEs in mature sperm.

PDEs constitute a diverse family of enzymes that catalyze the hydrolysis of cAMP and cGMP [7, 8]. Calmodulin (CaM)-dependent PDEs (PDE1s), PDE3s, and PDE4s have been described in male germ cells, each with distinct spatial, temporal, and possibly species-specific expression patterns [912]. However, gene deletions of Pde4d, Pde4b, or Pde3a did not produce defects in male mice fertility [1315]. In female mice, Pde3a proved to be essential for mouse oocyte maturation [15], whereas PDE4D ablation caused a decrease in ovulation rate [16].

Previous studies have shown that Pde1a and Pde1c genes are expressed in the germ cells in mouse testis, as confirmed by in situ hybridization and immunocytochemistry studies [10]. Three different genes form the Ca2+/ CaM-stimulated PDE1 family [8], each having distinct kinetic properties. For example, PDE1A and PDE1B have Michaelis constants (Kms) for cGMP of ~3 µM for cGMP, whereas the Km for cAMP is significantly higher. In contrast, PDE1C has a Km of 1 µM for both cAMP and cGMP. Alternative transcription start sites and splicing of the Pde1a, Pde1b and Pde1c genes can give rise to several structurally diverse isoforms. This has also been observed for other PDEs, but the physiological significance of this phenomenon is only beginning to be investigated. For instance, bovine PDE1A_v1 and PDE1A_v2 are different N-terminal variants of the same gene that display a different sensitivity to calcium-bound CaM, which might be important for differential regulation of activity in vivo [17]. The same is true for the PDE1C isozymes [18]. No functional attributes have been associated with the divergent C-termini of the various PDE1s.

In this manuscript we describe the cloning and characterization from mouse testis of a major new variant of the Pde1a subfamily, which we hereby designate Pde1a_v7 (mmPDE1A7 in the standardized PDE nomenclature; see [8]). This is very likely to be the major CaM-dependent PDE in mature sperm. Unlike previously identified PDE1A isoforms, the mouse testis PDE1A_v7 has only one CaM-binding domain and a divergent carboxy terminus. PDE1A_v7 is localized in the sperm tail, suggesting a role in regulation of sperm motility.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
Materials

Following is a list of items (and their manufacturers) purchased to perform the experiments and procedures described: Mouse Multiple Tissue Northern Blot (#7762-1) and mouse testis cDNA/lambda gt10 library (Clontech, Palo Alto, CA); Prime-it II random primer labeling kit, pBluescript SK (–) plasmid, and XL1-Blue cells (Stratagene, LaJolla, CA); Qiagen Lambda kit (Qiagen, Valencia, CA); ABI Prism Dye Terminator Cycle Sequencing Kit with AmpliTaq DNA polymerase FS (Perkin-Elmer, Foster City, CA); 5' RACE System for Rapid Amplification of cDNA ends, Benchmark Prestained Protein Ladder (Gibco BRL, Gaithersburg, MD); TA Cloning kit and pCDNA3.1/V5-His (Invitrogen, Carlsbad, CA); Access reverse transcription-polymerase chain reaction (RT-PCR) System, TNT T7 Quick Coupled Transcription/Translation System, and Erase-a-Base System (Promega, Madison, WI); [2, 8-3H]cAMP (28.4 Ci/ mmol), [8-3H]cGMP (9.8 Ci/mmol), L-[35S]-methionine, >1000 Ci/mmol, EN3HANCE Autoradiography Enhancer for Gel Fluorography, and Multimarkers protein standards (NEN Life Science Products, Boston, MA): glutathione-agarose affinity resin and pGEX3X plasmid (Pharmacia, Piscataway, NJ); Extracti-gel D, Sulfolink Kit, Carbolink Kit, horseradish peroxidase-conjugated anti-rabbit IgGs, and SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL); Protease Inhibitor Cocktail (catalog no. P-8340) and Nonidet P-40 (Sigma Chemical Co., St. Louis, MO); FITC-conjugated Affinipure Fab fragment Goat Anti-Rabbit IgG (H+L) (Jackson Immunoresearch, West Grove, PA); and Vectashield Fluorescence Mounting Medium (Vector Laboratories, Burlingame, CA).

Northern Blot Analysis

A commercial Northern blot of poly (A+)-selected RNAs from a number of different mouse tissues was probed with a cDNA corresponding to a mouse Pde1a cloned from brain (accession no. U56649) according to established protocols [19]. The Pde1a clone corresponding to the deposited sequence U56649 appears to have a 5' artifactual 61 nucleotide sequence, because this sequence is inverted in the contig comprising the gene (NT_039207). Nonetheless, it contains a downstream region, including the entire coding region, also confirmed by other mouse Pde1A deposited sequences such as AK043647. This region was chosen here for a probe and raising antibody. The Pde1A cDNA was labeled with 32P-dCTP using the Prime-it II kit according to the manufacturer's instructions. The Northern blot was incubated in hybridization buffer (composition: 5x saline-sodium citrate [0.15 M NaCl and 0.015 M sodium citrate; SSC], 5x Denhardt solution, 1% SDS) for 15 min at 65°C. The probe (106 cpm/ml buffer) in herring sperm DNA solution (0.1 mg/ml) was boiled for 10 min, then added to the hybridization solution, and the blot was incubated overnight at 65°C. The blot was then washed three times at room temperature for 15 min with 2x SSC, 0.1% SDS, followed by a 15 min wash with 0.2x SSC, 0.1% SDS at 65°C. The blot was then exposed to x-ray film at –70°C.

Cloning of cDNA From the Phage Lambda Library

The methods used to screen the mouse testis cDNA library were obtained from standard protocols [19]. Briefly, approximately 106 bacteriophages were plated onto 20 NZY plates (150 mm diameter), cultured, and screened as described previously [17]. The mouse Pde1A cDNA was 32P-labeled as described above and hybridized with the nitrocellulose transfers. After extensive washing and autoradiography, several plaques bearing putative Pde1A cDNAs were identified and purified. Lambda DNA was prepared from each putative Pde1A clone using Qiagen Lambda kits according to the instructions provided. The lambda DNA was digested with EcoRI restriction endonuclease, and the products were run on a 1% low-melting-point agarose gel. The digestion products were visualized using ethidium bromide staining, and the putative Pde1A cDNAs were excised from the gel. The EcoRI-digested cDNAs were subcloned into the pBluescript SK(–) plasmid.

5' RACE and PCR Amplification of cDNA

Total RNA was extracted from testes of C57Bl/6 mice, reconstituted in RNase-free water and used as the template for subsequent RT-PCR amplification procedures [19, 20]. 5' RACE was performed using the 5' RACE System for Rapid Amplification of cDNA Ends (Gibco BRL) according to the manufacturer's instructions, which are based on previously published protocols [21]. Two nested gene-specific antisense primers were synthesized for this procedure. The first primer (CTCATAATCATGAATGGCAG) that was used for reverse transcription corresponds to nucleotides 859–840 of mouse Pde1A U56649. The second primer (CAGTGCATGATACCTGTATG) that was used for subsequent PCR amplification corresponds to nucleotides 801–782 of the same sequence. The PCR amplification reaction was carried out at 94°C for 1 min, followed by 35 cycles at 94°C for 30 sec, 56°C for 45 sec, and 72°C for 90 sec, finally followed by 1 cycle at 72°C for 5 min.

RT-PCR amplification of the Pde1a_v7 cDNA was performed using primers based on the newly identified 5' and 3' sequences by cDNA cloning: the forward primer was CTCTGTGGATTTACTTGATC and the reverse primer was CACTCGCCGTGTCACCTCAG. A portion of the product was electrophoresed on a 1% agarose gel in Tris-acetate buffer (composed of 40 mM Tris-acetate and 1 mM EDTA) containing 0.5 µg/ml ethidium bromide. The remaining portion of the reaction was used for subcloning into the pCR2.1 plasmid using the TA Cloning Kit according to the manufacturer's instructions.

cDNA Sequencing

Sequencing of cDNA was performed using the ABI Prism Dye Terminator Cycle Sequencing Kit according to the manufacturer's protocol.

Real-Time PCR

Testis cDNA was prepared from RNA using Superscript II (Invitrogen) and oligo dT. Primers flanking various exon junctions were designed to detect the specific 5' and 3' regions of the different Pde1a transcript variants or the common region. Primers utilized are listed in Table 1. Real-time PCR performed with various dilutions of cDNA using Sybr Green master mix (ABI) gave similar results. The various pairs of primers also showed similar amplification efficiency on plasmids containing the relevant sequences.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Primers utilized for real-time PCR

In Vitro Transcription/Translation

In vitro transcription/translation was carried out using this construct and the TNT-T7 Quick Coupled Transcription/Translation System according to the manufacturer's protocol. To determine the size of the translated products, reactions were carried out in the presence of L-[35S]-methionine. After the reactions were completed, SDS-PAGE sample buffer was added, and samples were heated at 75°C for 15 min, loaded onto 12% SDS-polyacrylamide gels, and electrophoresed. The gels were denatured, impregnated with EN3HANCE Autoradiography Enhancer and subjected to fluorography. In experiments where PDE activity was assayed, unlabeled L-methionine was added to the reaction mixture instead of 35S-labeled L-methionine.

Preparation of Anti-PDE1A IgGs

An Xmn-I restriction endonuclease cleavage fragment (bases 1564– 1808) of the U56649 mouse Pde1a cDNA clone containing the C-terminal coding sequence (amino acid residues 520–565) was ligated into the pGEX3X plasmid Sma I site in-frame with the encoded GST polypeptide. The resulting fusion protein, designated M1ACT-GST, was produced in XL1-Blue cells, affinity-purified by glutathione affinity chromatography [19], and subsequently injected into rabbits to generate antisera using established protocols [22].

To affinity-purify IgGs, approximately 5 mg of M1ACT-GST fusion protein was coupled to SulfoLink Gel according to the manufacturer's instructions. IgGs were subsequently purified by passing antiserum over the column, washing the column with and eluting the bound IgGs with 100 mM glycine, pH 2.5 into tubes containing 1 M Tris-HCl, pH 8 to neutralize the acid. Fractions containing the peak of protein as monitored by the absorbance at 280 nm were pooled and dialyzed against 25 mM Tris-HCl, 0.8% NaCl, 0.02% KCl, pH 7.5. Bovine serum albumin (1%, final concentration) was added to stabilize the dialyzed IgGs before storage at–20°C.

Transfection of Pde1a_v7 in HEK293T cells

Pde1a_v7 cDNA was subcloned into the pCDNA3.1/V5-HIS-TOPO vector (Invitrogen) that was used for transfection of HEK293T cells. Transfection was carried out for 24 and 48 h with TransIT-293 transfection reagent (Mirus). Cell monolayers were extracted with hot Laemli's sample buffer and were loaded onto 12% SDS-polyacrylamide gels for electrophoresis.

Preparation of mouse sperm extracts and immunoprecipitation of PDE1

Monoclonal IgG ACAP (antibody for CaM activated phosphodiesterase), which is reactive with PDE1A and PDE1C (but not PDE1B) [23] isozymes, was purified from ascites fluid using protein A-agarose affinity chromatography as described previously [23] and coupled to Pierce Carbolink Agarose according to the manufacturer's instructions.

Caudal epididymal sperm was isolated from 4 or 5 C57Bl/6 mice (12– 16 wk old) according to established protocols (30). The sperm pellet was resuspended in 1 ml of lysis buffer (composition: 120 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1% Sigma protease inhibitor cocktail, and 0.5% Nonidet P-40 detergent) and sonicated 3 to 6 times on ice for 10 sec (5 W power) until few intact sperm were visible when inspected under a microscope. The sonicated sperm extracts were centrifuged at 13,000 x g for 15 min to remove larger organelles and membrane fragments. BSA was added to the lysate to a final concentration of 0.1%; to remove the detergent, this mixture was applied to a 0.5 ml extractigel-D column equilibrated with 4 column volumes of 20 mM Tris-HCl, pH 7.5, 1 mM EDTA, saving the eluate. The column was washed with 1 ml of 20 mM Tris-HCl, pH 7.5, 0.1% BSA, 1% protease inhibitor cocktail, the eluate was saved and pooled with that from the previous step. MgCl2 was added to the pooled eluate to a final concentration of 1 mM.

Sf9 cell expression Sf9 cells (one 100-mm plate) were infected with recombinant baculovirus encoding the mouse Pde1a U56649 as described previously [20] and homogenized in 2 ml of homogenization buffer (composition: 20 mM Tris-HCl, 1 mM EDTA, 1% protease inhibitor cocktail) using a Dounce homogenizer. The homogenate was centrifuged at 13,000 x g for 15 min and the supernatant was used for the experiments.

Immunoprecipitations Immunoprecipitation reactions were set up by adding 100 µl of a 50% slurry of either ACAP-agarose or control agarose (no IgG) to the tubes. The agarose was collected by centrifugation in a microfuge at 13,000 rpm for 1 min, and the supernatant was aspirated. The resin was resuspended in 0.5 ml of Tris-buffered saline (TBS; composition: 20 mM Tris-HCl, 0.8% NaCl, pH 7.5), 0.2 mM CaCl2. The agarose was then collected by centrifugation, the supernatant was aspirated, and the agarose pellet was resuspended in 1 ml of sample supplemented with CaCl2, CaM, and BSA to a final concentration of 0.2 mM, 240 nM, and 0.1%, respectively. Samples used in the immunoprecipitation experiment included mouse sperm lysate (950 µl per tube), mouse Pde1a (accession number ID U56649) expressed in Sf9 cells (approximately 2 µl of an extract of Sf9 cells infected with recombinant baculovirus), or TBS containing no enzyme. The mixture was incubated at 4°C for 1 h with agitation. The agarose was subsequently washed twice with 1 ml of TBS, 0.2 mM CaCl2, and resuspended in TBS, 0.2 mM CaCl2 to a total volume of 300 µl. Half of this suspension was diluted in TBS, 0.1% BSA to a total volume of 1 ml and used for PDE assays. The remaining agarose was collected by centrifugation and the supernatant was aspirated. The agarose was then resuspended in 50 µl of 2x SDS-PAGE sample buffer and heated at 37°C for 10 min. These samples were subsequently used for Western blotting experiments.

PDE Assays

PDE activity in the immunoprecipitate was determined by previously described methods [20]. Assays were performed in triplicate for 10 min at 30°C using 1 µM 3H-cGMP or 3H-cAMP in a total volume of 250 µl (buffer composition: 20 mM Tris-HCl, 20 mM imidazole, 3 mM MgCl2, 15 mM Mg acetate, 0.2 mg/ml bovine serum albumin, pH 7.5) supplemented with either 2 mM EGTA or 0.2 mM CaCl2 and 240 nM CaM. PDE activity is expressed as picomoles of cyclic nucleotide hydrolyzed per minute.

Western Blot Analysis

Samples were prepared by adding 1 volume of 2x sample buffer to the immunoprecipitate, loaded into wells of a 10% SDS-polyacrylamide gel and electrophoresed until the bromophenol blue dye migrated to the bottom of the gel. The proteins in the gel were transferred to nitrocellulose by electrophoresis using standard methodologies. Immunostaining of Western blots was performed as described previously [17]. In brief, blots were incubated for 1 h in a blocking buffer (composition: 20 mM Tris-HCl, pH 7.5, 0.8% NaCl, 0.1% Tween-20, and 5% nonfat dry milk), followed by an incubation with anti-M1ACT-GST serum (see above) diluted 1:500 in blocking buffer. After 1 h, the blots were washed for 10 min with Tris-buffered saline supplemented with Tween-20 (TBS-T; composition: 20 mM Tris-HCl, pH 7.5, 0.8% NaCl, 0.1% Tween-20) three times. The blots were then incubated with horseradish peroxidase-conjugated anti-rabbit IgGs diluted 1:5000 in a blocking buffer for 45 min. The blots were subsequently washed 5 times with TBS-T for 10 min per wash. Immunoreactivity was visualized using chemiluminescence reagents and autoradiography according to the manufacturer's recommendations.

Immunocytochemistry

Approximately 10,000 mouse sperm isolated as described above were pipetted onto Fisher Superfrost Plus glass slides and allowed to air-dry. Sf9 cells were seeded into chamber slides (10,000–50,000 cells/ml) and incubated at 25°C for 24 h. Sf9 cells were either left untreated or infected with mouse Pde1a (accession number ID U56649) recombinant baculovirus (m.o.i. = 10:1) and incubated at 25°C for 40 h. The slides were subsequently immersed in 100% methanol, followed by two incubations in Tris-buffered saline (TBS-ICC, composition: 25 mM Tris-HCl, 0.8% NaCl, 0.02% KCl, pH 7.5), each for 10 min at room temperature. The slides were incubated in a blocking buffer (composition: TBS-ICC, 5% normal goat serum) for 1 h at room temperature, followed by purified anti-M1ACT-GST IgGs diluted 1:1000 in blocking buffer overnight at 4°C. Some slides were incubated with anti-M1ACT-GST IgGs pretreated for 1 h at 4°C with a 100-fold molar excess of the PDE1A_v7 C-terminal peptide FKNNLVDIIQQNKERWKELAAQGCC (EZBiolab, Inc. Westfield, IN) or with the M1ACT-GST fusion protein antigen used to produce the antiserum. The slides were then washed for 10 min with TBS-ICC three times and incubated for 1 h with FITC-conjugated goat anti-rabbit IgGs diluted 1/200 in blocking buffer at room temperature. The slides were washed for 10 min with TBS-ICC three times, and then once for 10 min in TBS-ICC containing 1 ug/ml propidium iodide (Molecular Probes). The slides were then mounted using Vectashield fluorescence mounting medium and examined under a confocal microscope.

All experiments involving the use of animals were reviewed and approved by the Animal Care Committee of the University of Washington.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
To investigate the distribution of Pde1a gene expression, we probed a Northern blot of poly(A+)-selected RNA from a number of different mouse tissues with a 32P-labeled Pde1a cDNA initially cloned from brain (Fig. 1). The lane containing RNA isolated from testis showed very strong hybridization of the probe, with an apparently single mRNA species of about 1.7 kb. Because Pde1a mRNA in testis was smaller than Pde1a mRNA in brain (4.5 kb, Fig. 1), and the presumptive Pde1a_v1 (or possibly other isoforms) in kidney (4.5 kb and 2.5 kb, Fig. 1), it seemed likely that the testis Pde1a might be a new variant within this gene subfamily.



View larger version (55K):
[in this window]
[in a new window]
 
FIG. 1. Expression of Pde1a mRNAs in various mouse tissues. A Northern blot of poly(A+)-selected RNAs from mouse tissues was probed with a 32P-labeled mouse brain Pde1a cDNA and subjected to autoradiography as described in Materials and Methods. The position of the RNA standards are denoted by lines along the left side of the blot and the size of each standard is indicated in kilobases. The tissue from which the RNA was extracted is indicated along the top of the blot and are as follows: H, heart; B, brain; S, spleen; L, lung; Li, liver; Sk, skeletal muscle; K, kidney; and T, testis

To test this hypothesis, we screened a mouse testis cDNA library with the 32P-labeled Pde1a probe and isolated four different cDNAs that contained novel sequences. None of the clones contained the entire open reading frame. However, two clones possessed a large open reading frame and an in-frame stop codon 5' to a putative start methionine, and two other clones possessed termination codons and identical 3' untranslated sequences. Therefore, the mature Pde1a transcript in mouse testis could be expected to be composed of these 5' and 3' sequences.

To verify this, we employed RT-PCR amplification and performed 5' RACE to confirm that the mature Pde1a mRNA species most represented in mouse testis contained the observed 5' sequence. Of four 5' RACE clones chosen at random, three of the cDNAs were identical and closely corresponded to the identified library clones. Clones isolated from the mouse testis library yielded cDNAs that contained polyadenylation signal sequences as well as poly(A+) 3' ends, strongly suggesting that the entire 3' end of the new Pde1a mRNA transcript was cloned. A sense oligo corresponding to the 5' end of these clones and an antisense oligo corresponding to the 3' untranslated sequence of the clones were used to amplify a cDNA containing the entire open reading frame. The unique 5' and 3' sequences of the cDNA corresponding to the mature mouse testis Pde1a_v7 mRNA and the relative protein sequence are shown in Figure 2 (accession no. AF159298 deposited sequence). We designated it as Pde1a_v7 (called PDE1A7 in GenBank) to keep numbering in order of variants identified up to that date ([24]; see Discussion). Various deposited sequences cloned from mouse testis confirm the new 5' and 3' sequence. Finally, the size of the composite cDNA of Pde1a_v7 (1635 bp) is nearly equal to the size of the mRNA as determined by Northern blot analysis. The cDNA includes a large open reading frame encoding a polypeptide of 456 amino acid residues. The methionine codon (bases 45–47) and flanking nucleotides display the minimum requirements for a translational initiation site as defined by Kozak [25] and are preceded by an in-frame stop codon (bases 18–20). Therefore, the sequence reported here likely contains the entire open reading frame. Alignment of the Pde1a_v7 sequence to the mouse genome (genomic contig NT_039207, chromosome 2) reveals that the first exon lies nearly 220 kb downstream from the first exon of AK043647, a Pde1a cloned from brain that appears to be the murine equivalent of bovine and human PDE1A_v2 (Fig. 3). Therefore Pde1a_v7 is likely transcribed from a different promoter, within what is an intronic region for other Pde1a forms. The identified 3' sequence represents a new alternative exon located in the gene upstream to the 3' exon of other Pde1a forms (Fig. 3). Moreover, two additional variants, resulting from alternative splicing, have been identified. One, which we call Pde1a_v8 (PDE1A8 in GenBank), contains a new exon, downstream from the first exon of Pde1a_v7, introducing a stop codon (Fig. 2) (accession no. AY845863 deposited sequence). This might represent an mRNA targeted for non-sense-mediated decay, a widespread result of alternative splicing whose function is still unclear [26]. The other form Pde1a_v9 contains a new exon before the last exon of Pde1a_v7. It predicts a protein with eight extra amino acids at the carboxy terminal before the two last cysteines (Fig. 2) (accession #AY845864 deposited sequence).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 2. Nucleotide and predicted amino acid sequence of mouse testis PDE1A_v7, PDE1A_v8 and PDE1A_v9 specific regions. The predicted amino acid sequence is displayed below the corresponding codons. Arrows within the Pde1a_v7 sequence indicate the positions where the alternative exons (sequence underlined) of Pde1a_v8 and Pde1a_v9 are inserted



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3. Transcript variants of mouse Pde1a (accession number on the left). Exons are numbered relatively to their position in the gene (contig NT_039207). Alternative exons of testis-expressed forms are represented as hatched bars. AF023529 is a partial CDS sequence cloned from heart and encodes what appears to be the murine equivalent of Pde1a_v1. AK043647 was cloned from brain and encodes what appears to be the murine equivalent of Pde1a_v2

To verify the relative abundance of these Pde1a transcripts in mouse testis, real-time PCR was performed using primers specific for the various potential combinations of exons for all the known Pde1a isoforms, including the new forms identified here and the Pde1a common area (Table 1, Fig. 4). Among the combination of primers tested, the strongest signal was obtained with primers spanning exons 4/6, which were designed to detect the 5' region of Pde1a_v7 and Pde1a_v8. Of the combinations tested for the various Pde1a 3' regions, the strongest signal was obtained with primers spanning exons 16/18, which were designed to detect the 3' region of Pde1a_v7/Pde1a_v8 and Pde1a_ v9. As indicated by the very weak signals seen for exons 5/6 and 16/17, respectively exons for Pde1_v8 and Pde1a_ v9, these variants represent a minimal fraction of Pde1a in testis. Therefore, it can be inferred that the signal detected by primers probing exons 4/6 and 16/18 is due largely, if not entirely, to Pde1a_v7, confirming that this is the most abundant form present in mouse testis. The level of expression of other known forms of Pde1a, probed by targeting their unique 5' and 3' exon combinations, 1/3, 2/3, and 16/19, is also minimal.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Relative abundance of Pde1a transcripts in mouse testis by real-time PCR. Primers flanking various exon junctions were designed to detect the specific 5' and 3' regions of the different Pde1a transcript variants, or the region common to all variants. Primers and size of amplicon are listed in Table 1 and exons are numbered as in Fig. 3. The data reported are the means of four assays ± SEM relative to glyceraldehyde phosphate dehydrogenase expression

A comparison of the amino acid sequences of the predicted polypeptide encoded by the Pde1a_v7 cDNA with other Pde1a is shown in Figure 5. Unlike PDE1A_v1 and PDE1A_v2 [17], PDE1A_v7 lacks an amino-terminal CaM-binding domain. All these isozymes have an inhibitory domain which, in the absence of calcium-bound CaM, locks the enzyme into a relatively inactive state [17]. PDE1A_v7, as well as the other isozymes, also possesses a second CaM-binding domain located downstream to the inhibitory domain. Therefore, when calcium-bound CaM binds to this domain, the enzyme becomes activated. The activation of PDE1A_v7 by CaM is likely to be comparable to that of a structurally very similar deletion mutant of bovine PDE1A described in an earlier report [17]. Half-maximal activation of this mutant was achieved at ~4 nM CaM.



View larger version (74K):
[in this window]
[in a new window]
 
FIG. 5. Sequence comparison of PDE1A isozyme variants. The amino acid sequence of the mouse PDE1A_v7/9 N- and C-termini was aligned with other mouse, human, and bovine PDE1A sequences. Location of CaM-binding domains and of the inhibitory region is also indicated

To determine whether the Pde1a_v7 cDNA encoded a polypeptide having a molecular mass and catalytic activity consistent with that predicted by the large open reading frame, the cDNA was subjected to in vitro transcription/ translation. Attempts to express the PDE1A_v7 in HEK293T, COS and Sf9 cells were unsuccessful because of excessive proteolysis. Expression in HEK293T cells using the vector pcDNA3.1/V5-HIS-TOPO yielded proteolyzed PDE1A_v7 at both 24 and 48 h of transfection (data not shown). Conversely, in vitro translation produced a polypeptide with a relative mobility of approximately 52 kDa, consistent with the size predicted by the large open reading frame of the Pde1a_v7 cDNA (Fig. 6). The cGMP hydrolytic activity was stimulated threefold by calcium-bound CaM (Fig. 7). This result provides evidence that the Pde1a_v7 cDNA encodes a functional CaM-stimulated PDE.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 6. In vitro transcription/translation of the mouse Pde1a_v7 cDNA clone. The Pde1a_v7 cDNA that contains the entire coding sequence was subjected to in vitro transcription/translation in the presence of 35S-L-methionine. Aliquots were electrophoresed on a 12% SDS-polyacrylamide gel, fixed, soaked in fluorographic solution, dried, and exposed to x-ray film. Lines indicating the migration of NEN Multimarker protein standards are indicated on the right side of the autoradiogram. The molecular masses of these standards are given in kDa



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 7. PDE activity of the in vitro transcription/translation product. The mouse Pde1a_v7 cDNA was in vitro transcribed/translated as described in Materials and Methods and assayed for PDE activity using either 1 µM cAMP or 1 µM cGMP as the substrate. Solid columns and open columns indicate cyclic nucleotide hydrolytic activity in the presence of either 2 mM EGTA or 0.2 mM CaCl2 and 240 nM CaM respectively. PDE activity is expressed as picomoles of cyclic nucleotide hydrolyzed per minute per 50 µl of sample. All values are expressed as the mean of three assays, ± SEM

PDE1A was previously shown to be expressed in mature sperm using an antibody that would recognize all forms of PDE1A [10], and we wanted to verify if PDE1A_v7 was actually present in mature mouse sperm. Mouse sperm extracts were used for immunoprecipitation with ACAP antibody (a monoclonal antibody recognizing PDE1A and PDE1C but not PDE1B isoforms [23]) covalently coupled to agarose. CaM-stimulated cyclic nucleotide hydrolytic activity was detected in the immunoprecipitate (Fig. 8A). Activity in the immunoprecipitate was measured using either 1 µM cGMP or 1 µM cAMP, although the activity detected using cGMP was twofold greater (Fig. 8B). Despite the higher activity toward cGMP, it has been observed that PDE1A cAMP hydrolizing activity can be physiologycally relevant [27, 28]. The presence of cGMP and its relevant signaling components in mammalian sperm is controversial but deserves to be further investigated, as recent reports indicate [28, 29].



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 8. Immunoprecipitation of PDE1 activity from a detergent extract of mouse sperm using anti-PDE1A and anti-PDE1C monoclonal IgG, ACAP, covalently coupled to agarose. A) A mouse sperm extract obtained from 20 x 106 sperm was incubated with either ACAP-agarose or agarose (no IgG) for 1 hour at 4°C. The immunopellet was washed twice with TBS, 0.2 mM CaCl2, and assayed for PDE1 activity using 1 µM cGMP in the presence of either 2 mM EGTA (solid bars) or 0.2 mM CaCl2 and 240 nM CaM (open bars). B) A mouse sperm extract obtained from 20 x 106 sperm, recombinant mouse brain PDE1A, or recombinant mouse PDE1C_v4 were incubated with either ACAP-agarose or agarose (no IgG) for 1 hour at 4°C, washed twice with TBS, 0.2 mM CaCl2, and assayed for PDE1 activity in the presence of 0.2 mM CaCl2 and 240 nM CaM, using either 1 µM cGMP (solid bars) or 1 µM cAMP (open bars) as the substrate. No activity was detected in samples immunoprecipitated with agarose (data not shown). PDE activity is expressed as picomoles of substrate hydrolyzed per minute. Values are the mean of three assays ± SEM

A Western blot of immunoprecipitated mouse sperm PDE1 was stained with M1ACT-GST rabbit polyclonal antibody (PDE1A-GST affinity purified) and is shown in Figure 9. The antibodies reacted mostly with a polypeptide of approximately 50 kDa (lane 5), which is nearly equal to the molecular mass of PDE1A_v7 as predicted by the cloned cDNA. Slightly smaller immunoreactive bands (45 and 42 kDa) were also visible but less intense than the 50 kDa polypeptide; these are likely to be the result of partial proteolysis because the sperm acrosome is a rich source of protease activities [30]. A very faint band is also visible at ~58 kDa. This immunoreactivity may be caused by low expression of another PDE1A variant. As expected, the antibody reacted with both the control sample consisting of an extract prepared from Sf9 cells infected with a Pde1a cloned from mouse brain (accession U56649) (lane 3) and the control immunoprecipitate consisting of the same sample adsorbed to ACAP-agarose (lane 7). No immunostaining was detected in samples immunoprecipitated with agarose alone (no IgG) (lane 6–8) or in ACAP-agarose immunoprecipitates incubated with no sample (lane 1).



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 9. Western blot analysis of immunoprecipitated mouse sperm PDE1A. Samples were electrophoresed on a 10% SDS-polyacrylamide gel. The proteins were then transferred to nitrocellulose and this blot was stained with anti-PDE1A IgGs as described in Methods. The relative mobility of the standards is indicated on the left side of the blot in kilodaltons (kDa). Lane 1: ACAP-agarose (no sample); lane 2: agarose (no sample); lane 3: Sf9 cell extract containing recombinant mouse PDE1A (no immunoprecipitating reagent); lane 4: Benchmark Prestained Protein Ladder; lane 5: ACAP-agarose immunoprecipitate from mouse sperm extract; lane 6: agarose immunoprecipitate from mouse sperm extract; lane 7: ACAP-agarose immunoprecipitate from Sf9 cell extract containing recombinant mouse PDE1A; lane 8: agarose immunoprecipitate from Sf9 cell extract containing recombinant mouse PDE1A

To determine the subcellular localization of PDE1A_v7, we stained mouse sperm with affinity-purified anti-M1ACT-GST IgGs. PDE1A immunoreactivity was detected only in the sperm tail being more abundant in the principal piece (Fig. 10, panel A). Preincubation of the antibody with the C-terminal peptide of PDE1A_v7 blocked this immunoreactivity (Fig. 10, panel B). These results indicate that PDE1A_v7 is concentrated in the tail of mature mouse sperm.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 10. Immunocytochemical localization of PDE1A_v7 in mouse sperm. Mouse sperm were incubated with affinity-purified anti-M1ACT-GST IgGs before (A and C) or after preincubation for 1 hour with a 100-fold molar excess of PDE1A_v7 C-terminal peptide (B) or with the M1ACT-GST fusion protein antigen used to produce the antiserum (D). Green fluorescence indicates PDE1A immunoreactivity. Red fluorescence indicates propidium iodide staining of nuclei. Magnification x200

To further demonstrate that the antibody reacts specifically with PDE1A in situ, control experiments using Sf9 cells uninfected or infected with a mouse brain PDE1A recombinant baculovirus were performed (Fig. 11). Sf9 cells expressing PDE1A protein incubated with affinity purified anti-M1ACT-GST IgGs alone displayed intense immunoreactivity (Fig. 11A). Preincubation of the IgGs with a 100-fold molar excess of GST protein did not affect staining (Fig. 11B). In contrast, preincubation of the IgGs with the M1ACT-GST fusion protein completely blocked staining (Fig. 11C). Moreover, the anti-M1ACT-GST IgGs did not stain uninfected Sf9 cells (Fig. 11E).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 11. Immunocytochemical staining of Sf9 cells uninfected or infected with recombinant baculovirus encoding mouse PDE1A with affinity purified anti-M1ACT-GST IgGs. Sf9 cells were cultured, infected, fixed and stained as described in METHODS. Uninfected Sf9 cells (E and F) and Sf9 cells infected with mouse brain PDE1A recombinant baculovirus (A–D) were stained with anti-M1ACT-GST affinity purified IgGs (A and E) alone, preincubated with 100-fold molar excess of GST protein (B), or preincubated with 100-fold molar excess of M1ACT-GST fusion protein antigen used to produce the IgGs (C). D and F show nuclear staining with propidium iodide and correspond to the fields shown in C and E, respectively. Magnification x 210


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
We have identified a new PDE1A isoform present in mature mouse sperm, which we designate PDE1A_v7. This form arises from the use of a novel promoter and a different 3' exon as is often observed for gene products expressed in germ cells [31]. The first exon of this new Pde1a lies in the gene approximately 220 kb downstream of the first exon transcribed in other forms of Pde1a. In germ cells, alternative promoters are often used, reflecting the testis-specific transcription mechanisms that promote male germ-cell differentiation [31]. The resulting difference in sequence of the 5,' and often also the 3' regions of the mRNAs has been correlated to the specific translational regulation that occurs in germ cells [32]. In addition, differences in aminoacid sequence might confer specific regulatory properties and/or localization to the germ-cell specific variants. It came to our attention that a Pde1a variant expressed in human testis, designated PDE1A10 in the literature [33], appears to be the equivalent of Pde1a_v7, because the alignment to the gene shows that it also is transcribed from a downstream intronic promoter in the syntenic region. The amino acid sequence of human PDE1A10 is divergent at the N-terminal and C-terminal from the mouse form (Fig. 5), indicating that the criterion generally used to identify PDEs orthologues of transcript variants is not always valid. It is likely that the protein expression, localization, and function of PDE1A10 in human sperm might be similar to PDE1A_v7 in mice.

Real-time PCR confirmed that Pde1a_v7 is the most abundant form of Pde1a in mouse testis. The results of a recent microarray analysis of mouse germ cells at different stages of maturation also indicate that Pde1a_v7 is a relevant form [34]. Between three probe sets targeting the alternative 3' sequence of Pde1a, only the signal from the one specific for Pde1a_v7 3' (167653_f_at) increases in postmeiotic spermatids (accessible through NCBI via the Gene Expression Omnibus repository GEO; http://www.ncbi.nih.gov/geo/; GEO accession number GSE926). The data are also in a searchable form via the Mammalian Reproductive Genetics database (http://mrg.genetics.washington.edu). Moreover, the cell-specific stage of expression confirms what was previously reported by this laboratory using in situ profiling of Pde1a in mouse testis [10].

Nine different forms of human PDE1A polypeptides arising from the combination of three different N- and C-termini have been described [33]. The variation in transcripts is even higher considering that forms having the same open reading frame can have different 5' and 3' untranslated regions [24] that are potentially relevant for the translational control of expression or posttranscriptional control of mRNA stability. The fact that the same protein can be made from different transcripts has contributed to some confusion existing in the Pde1a transcript variant nomenclature [24, 33]. We named this new form Pde1a_v7 because it did not correspond to any of the previously described six human Pde1a transcripts [24] when we initially cloned and deposited it. The structure of PDE1A_v7 protein differs from other PDE1A isoforms in two respects. First, PDE1A_v7 has a short (3 amino acid) amino terminus divergent from PDE1A_v1 55 amino acids (accession no. AF023529) and the mouse equivalent of PDE1A_v2 (accession no. AK043647) 71 amino acids (Fig. 5). Therefore, instead of possessing an inhibitory domain flanked by two CaM-binding sites as in PDE1A_v1 [17], PDE1A_v7 possesses only the inhibitory domain and the downstream CaM-binding site. Second, PDE1A_v7 possesses a truncated carboxy-terminal region that is 23 amino acids shorter than other PDE1A variants, and it also has two divergent amino acids. There is also a divergence in amino acid sequence with the human form expressed in testis, which contains a unique 38 amino acid N-terminal sequence.

Functionally, the PDE1A_v7 isozyme is likely to be similar, if not identical, to bovine PDE1A_v2, because the concentration of calcium-bound CaM required to activate a deletion mutant of PDE1A that closely resembles the structure of PDE1A_v7 is similar to the wild-type PDE1A_v2 [17]. We did not directly test the sensitivity of PDE1A_v7 to CaM because the required amount of in vitro transcription/ translation reagents was prohibitive. PDE1A_v7 was proteolyzed when expressed in HEK293, COS, or in Sf9 cells, and proteolysis is known to activate PDE1A [35]. However, we did find that the in vitro translated product was activated by CaM (Fig. 7). It is possible that the observed sensitivity to proteolytic degradation might reflect a regulatory role if the proteolysis yields a constitutively active non-CaM-dependent PDE1A_v7 in vivo. This possibility will be tested in future studies. Because the divergent C-terminus is downstream from the catalytic domain [36], it is expected to have little, if any, effect on the specificity or catalytic efficiency of cyclic nucleotide hydrolysis.

Based on a survey of mRNAs from a number of mouse tissues by Northern analysis, and in situ and immunocytochemical experiments on mouse testis, PDE1A is highly expressed in germ cells, and the protein first appears in the tail during spermiogenesis [10]. In contrast, the expression of the PDE1C isoform is found in the cell body of developing germ cells [10]. In mature mouse sperm, PDE1A immunoreactivity was also detected in the tail ([10] and Fig. 10). A similar localization has been reported for a PDE1A in human sperm [11]. Other investigators have identified CaM-dependent PDE activity in mature sperm based on kinetic analysis of crude extracts and partially purified preparations [9, 11, 37, 38]. It has been proposed that in human sperm a PDE1 exists as a stable complex with CaM, possibly reflecting an activation event in ejaculated sperm [11]. Perhaps an active calcium/CaM-dependent PDE is required to maintain basal levels of cAMP, because a significant increase in cAMP has been detected in rat sperm incubated in a medium containing bicarbonate for 3 h in the absence of calcium [39].

Using the immunoprecipitating antibody "ACAP,", which recognizes PDE1A and PDE1C but not PDE1B [23] isozymes, we confirmed that the activity immunoprecipitated from mouse sperm had the electrophoretic mobility expected for PDE1A_v7. This observation, when combined with the real-time PCR results and the mRNA expression data, leads us to conclude that PDE1A_v7 is most likely the major PDE1A in mature sperm. It is possible that a small amount of another PDE1A isozyme is also expressed, because a faint immunoreactive band with a molecular weight of about 59 kDa was also detected. PDE1A_v7 appears to be associated with a particulate fraction in mouse sperm because detergents are required to extract the PDE activity. However, the nature of this association is not currently known. Posttranslational modifications such as myristoylation and/or palmitoylation are unlikely because the amino acid sequence of PDE1A_v7 does not contain the required consensus sequences within the divergent amino acid residues.

Cyclic AMP is known to play a role in sperm motility [1, 3, 4, 6] and possibly chemotaxis [40]. Moreover, agents that are known to inhibit PDEs and are thereby likely to increase intracellular cyclic nucleotides have been shown to increase sperm motility [5, 6]. PDE1A appears to be uniquely suited to serve a regulatory role in cAMP turnover in sperm, considering that it can be activated by CaM after depolarization-evoked calcium rises [6]. Such an activation would explain the reported transient increase in cAMP concentration upon bicarbonate activation, and might represent a mechanism of signal desensitization [41]. In addition, PDE1A might play a role in the molecular control of flagellar beat that is thought to involve an interplay of cAMP and calcium and CaM mediated events [42]. Interdependence of Ca2+ and cAMP oscillation patterns is being recognized as a new paradigm for signal transduction [43]. Although it has been reported that calcium can oscillate in sperm [4446], it is not currently known whether cAMP levels oscillate with beat frequency. If cAMP does oscillate, then a Ca2+/CaM- regulated PDE in the tail is likely to be a major regulator of the process. Another potential role for PDE1A might be to keep cAMP, and therefore motility, low while sperm are stored in the epididymis. Unfortunately, the limited bioavailabilty of cell-permeable PDE1A inhibitors and the lack of animals having disruptions in the PDE1A gene has not allowed a clear appraisal of the specific role(s) of PDE1A in motility. For instance, in experiments using vinpocetine, a PDE1A partially-selective inhibitor, a decrease in the percentage of progressively motile bovine sperm was associated with a negative effect on cell viability, likely because of the high concentration used [47]. Although a role for cGMP in mammalian sperm has not been clearly established, because PDE1A is a dual cyclic nucleotide substrate enzyme that actually prefers cGMP as substrate, it might also have a role in regulation of cGMP signaling.

Here we have provided evidence that a new transcript variant of Pde1A is expressed in mouse sperm and may play an important role in regulating signal transduction to control sperm motility and chemosensing.


    NOTE ADDED IN PROOF
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
While this paper was in production, Bender et al. detected a potentially relevant difference in CaM affinity for the two N-terminal variants of human PDE1B [48].


    ACKNOWLEDGMENTS
 
We thank Dr. Donner F. Babcock and Sunil Laxman for reviewing the manuscript and for helpful discussions. We also thank Dr. James E. Shima and Dr. Michael D. Griswold for providing the microarray data on PDEs expression in testis.


    FOOTNOTES
 
1 Supported by NIH grants DK 21723 and U54 HD 42454. Back

2 Correspondence: Joseph A. Beavo, University of Washington, Department of Pharmacology, Box 357280, 1959 NE Pacific St., Seattle, WA 98195. FAX: 206 685 3822; beavo{at}u.washington.edu Back

3 These authors contributed equally to this work Back

4 Current address: Lexicon Genetics Inc. 8800 Technology Forest Place, The Woodlands, TX 77381-1160 Back

5 Current address: University of Rochester Medical Center, Cardiology Unit, Box 679, 601 Elmwood Ave., Rochester, NY 14642 Back

6 Current address: Vollum Institute, Oregon Health Sciences University, 3181 Sam Jackson Park Road, Portland, Oregon 97239-3098 Back

Received: 16 December 2004.

First decision: 20 January 2005.

Accepted: 13 May 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 

  1. Harrison RA. Cyclic AMP signalling during mammalian sperm capacitation–still largely terra incognita. Reprod Domest Anim 2003 38:102-110[CrossRef][Medline]
  2. Chen Y, Cann MJ, Litvin TN, Iourgenko V, Sinclair ML, Levin LR, Buck J. Soluble adenylyl cyclase as an evolutionarily conserved bicarbonate sensor. Science 2000 289:625-628[Abstract/Free Full Text]
  3. Esposito G, Jaiswal BS, Xie F, Krajnc-Franken MA, Robben TJ, Strik AM, Kuil C, Philipsen RL, van Duin M, Conti M, Gossen JA. Mice deficient for soluble adenylyl cyclase are infertile because of a severe sperm-motility defect. Proc Natl Acad Sci U S A 2004 101:2993-2998[Abstract/Free Full Text]
  4. Nolan MA, Babcock DF, Wennemuth G, Brown W, Burton KA, McKnight GS. Sperm-specific protein kinase A catalytic subunit Calpha2 orchestrates cAMP signaling for male fertility. Proc Natl Acad Sci U S A 2004 101:13483-13488[Abstract/Free Full Text]
  5. Henkel RR, Schill WB. Sperm preparation for ART. Reprod Biol Endocrinol 2003 1:108[CrossRef][Medline]
  6. Wennemuth G, Carlson AE, Harper AJ, Babcock DF. Bicarbonate actions on flagellar and Ca2+-channel responses: initial events in sperm activation. Development 2003 130:1317-1326[Abstract/Free Full Text]
  7. Soderling SH, Beavo JA. Regulation of cAMP and cGMP signaling: new phosphodiesterases and new functions. Curr Opin Cell Biol 2000 12:174-179[CrossRef][Medline]
  8. Beavo JA. Cyclic nucleotide phosphodiesterases: functional implications of multiple isoforms. Physiol Rev 1995 75:725-748[Abstract/Free Full Text]
  9. Geremia R, Rossi P, Mocini D, Pezzotti R, Conti M. Characterization of a calmodulin-dependent high-affinity cyclic AMP and cyclic GMP phosphodiesterase from male mouse germ cells. Biochem J 1984 217:693-700[Medline]
  10. Yan C, Zhao AZ, Sonnenburg WK, Beavo JA. Stage and cell-specific expression of calmodulin-dependent phosphodiesterases in mouse testis. Biol Reprod 2001 64:1746-1754[Abstract/Free Full Text]
  11. Lefievre L, de Lamirande E, Gagnon C. Presence of cyclic nucleotide phosphodiesterases PDE1A, existing as a stable complex with calmodulin, and PDE3A in human spermatozoa. Biol Reprod 2002 67:423-430[Abstract/Free Full Text]
  12. Naro F, Zhang R, Conti M. Developmental regulation of unique adenosine 3',5'-monophosphate-specific phosphodiesterase variants during rat spermatogenesis. Endocrinology 1996 137:2464-2472[Abstract]
  13. Jin SL, Richard FJ, Kuo WP, D'Ercole AJ, Conti M. Impaired growth and fertility of cAMP-specific phosphodiesterase PDE4D-deficient mice. Proc Natl Acad Sci U S A 1999 96:11998-12003[Abstract/Free Full Text]
  14. Jin SL, Conti M. Induction of the cyclic nucleotide phosphodiesterase PDE4B is essential for LPS-activated TNF-alpha responses. Proc Natl Acad Sci U S A 2002 99:7628-7633[Abstract/Free Full Text]
  15. Masciarelli S, Horner K, Liu C, Park SH, Hinckley M, Hockman S, Nedachi T, Jin C, Conti M, Manganiello V. Cyclic nucleotide phosphodiesterase 3A-deficient mice as a model of female infertility. J Clin Invest 2004 114:196-205[CrossRef][Medline]
  16. Park JY, Richard F, Chun SY, Park JH, Law E, Horner K, Jin SL, Conti M. Phosphodiesterase regulation is critical for the differentiation and pattern of gene expression in granulosa cells of the ovarian follicle. Mol Endocrinol 2003 17:1117-1130[Abstract/Free Full Text]
  17. Sonnenburg WK, Seger D, Kwak KS, Huang J, Charbonneau H, Beavo JA. Identification of inhibitory and calmodulin-binding domains of the PDE1A1 and PDE1A2 calmodulin-stimulated cyclic nucleotide phosphodiesterases. J Biol Chem 1995 270:30989-31000[Abstract/Free Full Text]
  18. Yan C, Zhao AZ, Bentley JK, Beavo JA. The calmodulin-dependent phosphodiesterase gene PDE1C encodes several functionally different splice variants in a tissue-specific manner. J Biol Chem 1996 271:25699-25706[Abstract/Free Full Text]
  19. Ausubel FM. Current Protocols in Molecular Biology. New York: Greene Pub. Assoc. and Wiley-Interscience; 1987
  20. Sonnenburg WK, Rybalkin SD, Bornfeldt KE, Kwak KS, Rybalkina IG, Beavo JA. Identification, quantitation, and cellular localization of PDE1 calmodulin-stimulated cyclic nucleotide phosphodiesterases. Methods 1998 14:3-19[CrossRef][Medline]
  21. Frohman MA, Dush MK, Martin GR. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A 1988 85:8998-9002[Abstract/Free Full Text]
  22. Harlow E, Lane D. Antibodies: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1988
  23. Hansen RS, Charbonneau H, Beavo JA. Purification of calmodulin-stimulated cyclic nucleotide phosphodiesterase by monoclonal antibody affinity chromatography. Methods Enzymol 1988 159:543-557[Medline]
  24. Snyder PB, Florio VA, Ferguson K, Loughney K. Isolation, expression and analysis of splice variants of a human Ca2+/calmodulin-stimulated phosphodiesterase (PDE1A). Cell Signal 1999 11:535-544[CrossRef][Medline]
  25. Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 1991 266:19867-19870[Free Full Text]
  26. Lewis BP, Green RE, Brenner SE. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc Natl Acad Sci U S A 2003 100:189-192[Abstract/Free Full Text]
  27. Goraya TA, Masada N, Ciruela A, Cooper DM. Sustained entry of Ca2+ is required to activate Ca2+-calmodulin-dependent phosphodiesterase 1A. J Biol Chem 2004 279:40494-40504[Abstract/Free Full Text]
  28. Willipinski-Stapelfeldt B, Lubberstedt J, Stelter S, Vogt K, Mukhopadhyay AK, Muller D. Comparative analysis between cyclic GMP and cyclic AMP signalling in human sperm. Mol Hum Reprod 2004 10:543-552[Abstract/Free Full Text]
  29. Revelli A, Costamagna C, Moffa F, Aldieri E, Ochetti S, Bosia A, Massobrio M, Lindblom B, Ghigo D. Signaling pathway of nitric oxide-induced acrosome reaction in human spermatozoa. Biol Reprod 2001 64:1708-1712[Abstract/Free Full Text]
  30. Topfer-Petersen E, Cechova D, Henschen A, Steinberger M, Friess AE, Zucker A. Cell biology of acrosomal proteins. Andrologia 1990; 22 Suppl 1: 110–121
  31. Eddy EM. Male germ cell gene expression. Recent Prog Horm Res 2002 57:103-128[Abstract/Free Full Text]
  32. Kleene KC. Patterns, mechanisms, and functions of translation regulation in mammalian spermatogenic cells. Cytogenet Genome Res 2003 103:217-224[CrossRef][Medline]
  33. Michibata H, Yanaka N, Kanoh Y, Okumura K, Omori K. Human Ca2+/calmodulin-dependent phosphodiesterase PDE1A: novel splice variants, their specific expression, genomic organization, and chromosomal localization. Biochim Biophys Acta 2001 1517:278-287[Medline]
  34. Shima JE, McLean DJ, McCarrey JR, Griswold MD. The murine testicular transcriptome: characterizing gene expression in the testis during the progression of spermatogenesis. Biol Reprod 2004 71:319-330[Abstract/Free Full Text]
  35. Kakkar R, Raju RV, Sharma RK. In vitro generation of an active calmodulin-independent phosphodiesterase from brain calmodulin-dependent phosphodiesterase (PDE1A2) by m-calpain. Arch Biochem Biophys 1998 358:320-328[CrossRef][Medline]
  36. Xu RX, Hassell AM, Vanderwall D, Lambert MH, Holmes WD, Luther MA, Rocque WJ, Milburn MV, Zhao Y, Ke H, Nolte RT. Atomic structure of PDE4: insights into phosphodiesterase mechanism and specificity. Science 2000 288:1822-1825[Abstract/Free Full Text]
  37. Wasco WM, Kincaid RL, Orr GA. Identification and characterization of calmodulin-binding proteins in mammalian sperm flagella. J Biol Chem 1989 264:5104-5111[Abstract/Free Full Text]
  38. Chaudhry PS, Casillas ER. Calmodulin-stimulated cyclic nucleotide phosphodiesterases in plasma membranes of bovine epididymal spermatozoa. Arch Biochem Biophys 1988 262:439-444[CrossRef][Medline]
  39. Baker MA, Lewis B, Hetherington L, Aitken RJ. Development of the signalling pathways associated with sperm capacitation during epididymal maturation. Mol Reprod Dev 2003 64:446-457[CrossRef][Medline]
  40. Spehr M, Schwane K, Riffell JA, Barbour J, Zimmer RK, Neuhaus EM, Hatt H. Particulate adenylate cyclase plays a key role in human sperm olfactory receptor-mediated chemotaxis. J Biol Chem 2004 279:40194-40203[Abstract/Free Full Text]
  41. Wade MA, Jones RC, Murdoch RN, Aitken RJ. Motility activation and second messenger signalling in spermatozoa from rat cauda epididymidis. Reproduction 2003 125:175-183[Abstract]
  42. Yang P, Yang C, Sale WS. Flagellar radial spoke protein 2 is a calmodulin binding protein required for motility in Chlamydomonas reinhardtii. Eukaryot Cell 2004 3:72-81[Abstract/Free Full Text]
  43. Zaccolo M, Pozzan T. CAMP and Ca2+ interplay: a matter of oscillation patterns. Trends Neurosci 2003 26:53-55[CrossRef][Medline]
  44. Suarez SS, Varosi SM, Dai X. Intracellular calcium increases with hyperactivation in intact, moving hamster sperm and oscillates with the flagellar beat cycle. Proc Natl Acad Sci U S A 1993 90:4660-4664[Abstract/Free Full Text]
  45. Harper CV, Barratt CL, Publicover SJ. Stimulation of human spermatozoa with progesterone gradients to simulate approach to the oocyte. Induction of [Ca(2+)](i) oscillations and cyclical transitions in flagellar beating. J Biol Chem 2004 279:46315-46325[Abstract/Free Full Text]
  46. Kirkman-Brown JC, Barratt CL, Publicover SJ. Slow calcium oscillations in human spermatozoa. Biochem J 2004 378:827-832[CrossRef][Medline]
  47. Fournier V, Leclerc P, Cormier N, Bailey JL. Implication of calmodulin-dependent phosphodiesterase type 1 during bovine sperm capacitation. J Androl 2003 24:104-112[Abstract/Free Full Text]
  48. Bender AT, Ostenson CL, Wang EH, Beavo JA. Selective up-regulation of PDE1B2 upon monocyte-to-macrophage differentiation. Proc Natl Acad Sci U S A; 10:497-502



This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
A. T. Bender and J. A. Beavo
Cyclic Nucleotide Phosphodiesterases: Molecular Regulation to Clinical Use
Pharmacol. Rev., September 1, 2006; 58(3): 488 - 520.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/4/598    most recent
biolreprod.104.039180v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.
Agricola
Right arrow Articles by Vasta, V.
Right arrow Articles by Beavo, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS