|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology, University of Washington, Seattle, Washington 98195
| ABSTRACT |
|---|
|
|
|---|
calcium, signal transduction, sperm capacitation, sperm maturation, sperm motility and transport
| INTRODUCTION |
|---|
|
|
|---|
2 catalytic subunit of PKA that is expressed in postmeiotic germ cells do not increase flagellar beat frequency upon bicarbonate treatment, which highlights the regulatory role of PKA [4]. Treatment of sperm with inhibitors of cyclic nucleotide phosphodiesterases (PDEs), the enzymes that degrade cyclic nucleotides, produces marked stimulation of cAMP-dependent motility [5, 6]. For this reason, nonspecific PDE inhibitors, for example pentoxifylline and caffeine, have been used empirically for years for in vitro fertilization protocols to support sperm capacitation and increase rates of fertilization [5]. These observations lead to the hypothesis that one or more PDEs must be basally active and maintain sperm in a resting state in the epididymis, thereby avoiding premature activation. Conversely, physiological silencing of PDEs is likely to be a necessary step during sperm activation, thereby allowing cAMP to be increased by the bicarbonate-sensitive adenylyl cyclase. Moreover, at successive steps a PDE is likely to be required for a feedback regulatory loop in analogy with other cellular desensitization regulatory circuits controlled by cAMP. Despite the indirect evidence of a role for PDEs in modulating sperm activation, there is no comprehensive knowledge of the presence, activity, subcellular localization, and particularly of the function of individual PDEs in mature sperm.
PDEs constitute a diverse family of enzymes that catalyze the hydrolysis of cAMP and cGMP [7, 8]. Calmodulin (CaM)-dependent PDEs (PDE1s), PDE3s, and PDE4s have been described in male germ cells, each with distinct spatial, temporal, and possibly species-specific expression patterns [912]. However, gene deletions of Pde4d, Pde4b, or Pde3a did not produce defects in male mice fertility [13 15]. In female mice, Pde3a proved to be essential for mouse oocyte maturation [15], whereas PDE4D ablation caused a decrease in ovulation rate [16].
Previous studies have shown that Pde1a and Pde1c genes are expressed in the germ cells in mouse testis, as confirmed by in situ hybridization and immunocytochemistry studies [10]. Three different genes form the Ca2+/ CaM-stimulated PDE1 family [8], each having distinct kinetic properties. For example, PDE1A and PDE1B have Michaelis constants (Kms) for cGMP of
3 µM for cGMP, whereas the Km for cAMP is significantly higher. In contrast, PDE1C has a Km of 1 µM for both cAMP and cGMP. Alternative transcription start sites and splicing of the Pde1a, Pde1b and Pde1c genes can give rise to several structurally diverse isoforms. This has also been observed for other PDEs, but the physiological significance of this phenomenon is only beginning to be investigated. For instance, bovine PDE1A_v1 and PDE1A_v2 are different N-terminal variants of the same gene that display a different sensitivity to calcium-bound CaM, which might be important for differential regulation of activity in vivo [17]. The same is true for the PDE1C isozymes [18]. No functional attributes have been associated with the divergent C-termini of the various PDE1s.
In this manuscript we describe the cloning and characterization from mouse testis of a major new variant of the Pde1a subfamily, which we hereby designate Pde1a_v7 (mmPDE1A7 in the standardized PDE nomenclature; see [8]). This is very likely to be the major CaM-dependent PDE in mature sperm. Unlike previously identified PDE1A isoforms, the mouse testis PDE1A_v7 has only one CaM-binding domain and a divergent carboxy terminus. PDE1A_v7 is localized in the sperm tail, suggesting a role in regulation of sperm motility.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Following is a list of items (and their manufacturers) purchased to perform the experiments and procedures described: Mouse Multiple Tissue Northern Blot (#7762-1) and mouse testis cDNA/lambda gt10 library (Clontech, Palo Alto, CA); Prime-it II random primer labeling kit, pBluescript SK () plasmid, and XL1-Blue cells (Stratagene, LaJolla, CA); Qiagen Lambda kit (Qiagen, Valencia, CA); ABI Prism Dye Terminator Cycle Sequencing Kit with AmpliTaq DNA polymerase FS (Perkin-Elmer, Foster City, CA); 5' RACE System for Rapid Amplification of cDNA ends, Benchmark Prestained Protein Ladder (Gibco BRL, Gaithersburg, MD); TA Cloning kit and pCDNA3.1/V5-His (Invitrogen, Carlsbad, CA); Access reverse transcription-polymerase chain reaction (RT-PCR) System, TNT T7 Quick Coupled Transcription/Translation System, and Erase-a-Base System (Promega, Madison, WI); [2, 8-3H]cAMP (28.4 Ci/ mmol), [8-3H]cGMP (9.8 Ci/mmol), L-[35S]-methionine, >1000 Ci/mmol, EN3HANCE Autoradiography Enhancer for Gel Fluorography, and Multimarkers protein standards (NEN Life Science Products, Boston, MA): glutathione-agarose affinity resin and pGEX3X plasmid (Pharmacia, Piscataway, NJ); Extracti-gel D, Sulfolink Kit, Carbolink Kit, horseradish peroxidase-conjugated anti-rabbit IgGs, and SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL); Protease Inhibitor Cocktail (catalog no. P-8340) and Nonidet P-40 (Sigma Chemical Co., St. Louis, MO); FITC-conjugated Affinipure Fab fragment Goat Anti-Rabbit IgG (H+L) (Jackson Immunoresearch, West Grove, PA); and Vectashield Fluorescence Mounting Medium (Vector Laboratories, Burlingame, CA).
Northern Blot Analysis
A commercial Northern blot of poly (A+)-selected RNAs from a number of different mouse tissues was probed with a cDNA corresponding to a mouse Pde1a cloned from brain (accession no. U56649) according to established protocols [19]. The Pde1a clone corresponding to the deposited sequence U56649 appears to have a 5' artifactual 61 nucleotide sequence, because this sequence is inverted in the contig comprising the gene (NT_039207). Nonetheless, it contains a downstream region, including the entire coding region, also confirmed by other mouse Pde1A deposited sequences such as AK043647. This region was chosen here for a probe and raising antibody. The Pde1A cDNA was labeled with 32P-dCTP using the Prime-it II kit according to the manufacturer's instructions. The Northern blot was incubated in hybridization buffer (composition: 5x saline-sodium citrate [0.15 M NaCl and 0.015 M sodium citrate; SSC], 5x Denhardt solution, 1% SDS) for 15 min at 65°C. The probe (106 cpm/ml buffer) in herring sperm DNA solution (0.1 mg/ml) was boiled for 10 min, then added to the hybridization solution, and the blot was incubated overnight at 65°C. The blot was then washed three times at room temperature for 15 min with 2x SSC, 0.1% SDS, followed by a 15 min wash with 0.2x SSC, 0.1% SDS at 65°C. The blot was then exposed to x-ray film at 70°C.
Cloning of cDNA From the Phage Lambda Library
The methods used to screen the mouse testis cDNA library were obtained from standard protocols [19]. Briefly, approximately 106 bacteriophages were plated onto 20 NZY plates (150 mm diameter), cultured, and screened as described previously [17]. The mouse Pde1A cDNA was 32P-labeled as described above and hybridized with the nitrocellulose transfers. After extensive washing and autoradiography, several plaques bearing putative Pde1A cDNAs were identified and purified. Lambda DNA was prepared from each putative Pde1A clone using Qiagen Lambda kits according to the instructions provided. The lambda DNA was digested with EcoRI restriction endonuclease, and the products were run on a 1% low-melting-point agarose gel. The digestion products were visualized using ethidium bromide staining, and the putative Pde1A cDNAs were excised from the gel. The EcoRI-digested cDNAs were subcloned into the pBluescript SK() plasmid.
5' RACE and PCR Amplification of cDNA
Total RNA was extracted from testes of C57Bl/6 mice, reconstituted in RNase-free water and used as the template for subsequent RT-PCR amplification procedures [19, 20]. 5' RACE was performed using the 5' RACE System for Rapid Amplification of cDNA Ends (Gibco BRL) according to the manufacturer's instructions, which are based on previously published protocols [21]. Two nested gene-specific antisense primers were synthesized for this procedure. The first primer (CTCATAATCATGAATGGCAG) that was used for reverse transcription corresponds to nucleotides 859840 of mouse Pde1A U56649. The second primer (CAGTGCATGATACCTGTATG) that was used for subsequent PCR amplification corresponds to nucleotides 801782 of the same sequence. The PCR amplification reaction was carried out at 94°C for 1 min, followed by 35 cycles at 94°C for 30 sec, 56°C for 45 sec, and 72°C for 90 sec, finally followed by 1 cycle at 72°C for 5 min.
RT-PCR amplification of the Pde1a_v7 cDNA was performed using primers based on the newly identified 5' and 3' sequences by cDNA cloning: the forward primer was CTCTGTGGATTTACTTGATC and the reverse primer was CACTCGCCGTGTCACCTCAG. A portion of the product was electrophoresed on a 1% agarose gel in Tris-acetate buffer (composed of 40 mM Tris-acetate and 1 mM EDTA) containing 0.5 µg/ml ethidium bromide. The remaining portion of the reaction was used for subcloning into the pCR2.1 plasmid using the TA Cloning Kit according to the manufacturer's instructions.
cDNA Sequencing
Sequencing of cDNA was performed using the ABI Prism Dye Terminator Cycle Sequencing Kit according to the manufacturer's protocol.
Real-Time PCR
Testis cDNA was prepared from RNA using Superscript II (Invitrogen) and oligo dT. Primers flanking various exon junctions were designed to detect the specific 5' and 3' regions of the different Pde1a transcript variants or the common region. Primers utilized are listed in Table 1. Real-time PCR performed with various dilutions of cDNA using Sybr Green master mix (ABI) gave similar results. The various pairs of primers also showed similar amplification efficiency on plasmids containing the relevant sequences.
|
In Vitro Transcription/Translation
In vitro transcription/translation was carried out using this construct and the TNT-T7 Quick Coupled Transcription/Translation System according to the manufacturer's protocol. To determine the size of the translated products, reactions were carried out in the presence of L-[35S]-methionine. After the reactions were completed, SDS-PAGE sample buffer was added, and samples were heated at 75°C for 15 min, loaded onto 12% SDS-polyacrylamide gels, and electrophoresed. The gels were denatured, impregnated with EN3HANCE Autoradiography Enhancer and subjected to fluorography. In experiments where PDE activity was assayed, unlabeled L-methionine was added to the reaction mixture instead of 35S-labeled L-methionine.
Preparation of Anti-PDE1A IgGs
An Xmn-I restriction endonuclease cleavage fragment (bases 1564 1808) of the U56649 mouse Pde1a cDNA clone containing the C-terminal coding sequence (amino acid residues 520565) was ligated into the pGEX3X plasmid Sma I site in-frame with the encoded GST polypeptide. The resulting fusion protein, designated M1ACT-GST, was produced in XL1-Blue cells, affinity-purified by glutathione affinity chromatography [19], and subsequently injected into rabbits to generate antisera using established protocols [22].
To affinity-purify IgGs, approximately 5 mg of M1ACT-GST fusion protein was coupled to SulfoLink Gel according to the manufacturer's instructions. IgGs were subsequently purified by passing antiserum over the column, washing the column with and eluting the bound IgGs with 100 mM glycine, pH 2.5 into tubes containing 1 M Tris-HCl, pH 8 to neutralize the acid. Fractions containing the peak of protein as monitored by the absorbance at 280 nm were pooled and dialyzed against 25 mM Tris-HCl, 0.8% NaCl, 0.02% KCl, pH 7.5. Bovine serum albumin (1%, final concentration) was added to stabilize the dialyzed IgGs before storage at20°C.
Transfection of Pde1a_v7 in HEK293T cells
Pde1a_v7 cDNA was subcloned into the pCDNA3.1/V5-HIS-TOPO vector (Invitrogen) that was used for transfection of HEK293T cells. Transfection was carried out for 24 and 48 h with TransIT-293 transfection reagent (Mirus). Cell monolayers were extracted with hot Laemli's sample buffer and were loaded onto 12% SDS-polyacrylamide gels for electrophoresis.
Preparation of mouse sperm extracts and immunoprecipitation of PDE1
Monoclonal IgG ACAP (antibody for CaM activated phosphodiesterase), which is reactive with PDE1A and PDE1C (but not PDE1B) [23] isozymes, was purified from ascites fluid using protein A-agarose affinity chromatography as described previously [23] and coupled to Pierce Carbolink Agarose according to the manufacturer's instructions.
Caudal epididymal sperm was isolated from 4 or 5 C57Bl/6 mice (12 16 wk old) according to established protocols (30). The sperm pellet was resuspended in 1 ml of lysis buffer (composition: 120 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1% Sigma protease inhibitor cocktail, and 0.5% Nonidet P-40 detergent) and sonicated 3 to 6 times on ice for 10 sec (5 W power) until few intact sperm were visible when inspected under a microscope. The sonicated sperm extracts were centrifuged at 13,000 x g for 15 min to remove larger organelles and membrane fragments. BSA was added to the lysate to a final concentration of 0.1%; to remove the detergent, this mixture was applied to a 0.5 ml extractigel-D column equilibrated with 4 column volumes of 20 mM Tris-HCl, pH 7.5, 1 mM EDTA, saving the eluate. The column was washed with 1 ml of 20 mM Tris-HCl, pH 7.5, 0.1% BSA, 1% protease inhibitor cocktail, the eluate was saved and pooled with that from the previous step. MgCl2 was added to the pooled eluate to a final concentration of 1 mM.
Sf9 cell expression Sf9 cells (one 100-mm plate) were infected with recombinant baculovirus encoding the mouse Pde1a U56649 as described previously [20] and homogenized in 2 ml of homogenization buffer (composition: 20 mM Tris-HCl, 1 mM EDTA, 1% protease inhibitor cocktail) using a Dounce homogenizer. The homogenate was centrifuged at 13,000 x g for 15 min and the supernatant was used for the experiments.
Immunoprecipitations Immunoprecipitation reactions were set up by adding 100 µl of a 50% slurry of either ACAP-agarose or control agarose (no IgG) to the tubes. The agarose was collected by centrifugation in a microfuge at 13,000 rpm for 1 min, and the supernatant was aspirated. The resin was resuspended in 0.5 ml of Tris-buffered saline (TBS; composition: 20 mM Tris-HCl, 0.8% NaCl, pH 7.5), 0.2 mM CaCl2. The agarose was then collected by centrifugation, the supernatant was aspirated, and the agarose pellet was resuspended in 1 ml of sample supplemented with CaCl2, CaM, and BSA to a final concentration of 0.2 mM, 240 nM, and 0.1%, respectively. Samples used in the immunoprecipitation experiment included mouse sperm lysate (950 µl per tube), mouse Pde1a (accession number ID U56649) expressed in Sf9 cells (approximately 2 µl of an extract of Sf9 cells infected with recombinant baculovirus), or TBS containing no enzyme. The mixture was incubated at 4°C for 1 h with agitation. The agarose was subsequently washed twice with 1 ml of TBS, 0.2 mM CaCl2, and resuspended in TBS, 0.2 mM CaCl2 to a total volume of 300 µl. Half of this suspension was diluted in TBS, 0.1% BSA to a total volume of 1 ml and used for PDE assays. The remaining agarose was collected by centrifugation and the supernatant was aspirated. The agarose was then resuspended in 50 µl of 2x SDS-PAGE sample buffer and heated at 37°C for 10 min. These samples were subsequently used for Western blotting experiments.
PDE Assays
PDE activity in the immunoprecipitate was determined by previously described methods [20]. Assays were performed in triplicate for 10 min at 30°C using 1 µM 3H-cGMP or 3H-cAMP in a total volume of 250 µl (buffer composition: 20 mM Tris-HCl, 20 mM imidazole, 3 mM MgCl2, 15 mM Mg acetate, 0.2 mg/ml bovine serum albumin, pH 7.5) supplemented with either 2 mM EGTA or 0.2 mM CaCl2 and 240 nM CaM. PDE activity is expressed as picomoles of cyclic nucleotide hydrolyzed per minute.
Western Blot Analysis
Samples were prepared by adding 1 volume of 2x sample buffer to the immunoprecipitate, loaded into wells of a 10% SDS-polyacrylamide gel and electrophoresed until the bromophenol blue dye migrated to the bottom of the gel. The proteins in the gel were transferred to nitrocellulose by electrophoresis using standard methodologies. Immunostaining of Western blots was performed as described previously [17]. In brief, blots were incubated for 1 h in a blocking buffer (composition: 20 mM Tris-HCl, pH 7.5, 0.8% NaCl, 0.1% Tween-20, and 5% nonfat dry milk), followed by an incubation with anti-M1ACT-GST serum (see above) diluted 1:500 in blocking buffer. After 1 h, the blots were washed for 10 min with Tris-buffered saline supplemented with Tween-20 (TBS-T; composition: 20 mM Tris-HCl, pH 7.5, 0.8% NaCl, 0.1% Tween-20) three times. The blots were then incubated with horseradish peroxidase-conjugated anti-rabbit IgGs diluted 1:5000 in a blocking buffer for 45 min. The blots were subsequently washed 5 times with TBS-T for 10 min per wash. Immunoreactivity was visualized using chemiluminescence reagents and autoradiography according to the manufacturer's recommendations.
Immunocytochemistry
Approximately 10,000 mouse sperm isolated as described above were pipetted onto Fisher Superfrost Plus glass slides and allowed to air-dry. Sf9 cells were seeded into chamber slides (10,00050,000 cells/ml) and incubated at 25°C for 24 h. Sf9 cells were either left untreated or infected with mouse Pde1a (accession number ID U56649) recombinant baculovirus (m.o.i. = 10:1) and incubated at 25°C for 40 h. The slides were subsequently immersed in 100% methanol, followed by two incubations in Tris-buffered saline (TBS-ICC, composition: 25 mM Tris-HCl, 0.8% NaCl, 0.02% KCl, pH 7.5), each for 10 min at room temperature. The slides were incubated in a blocking buffer (composition: TBS-ICC, 5% normal goat serum) for 1 h at room temperature, followed by purified anti-M1ACT-GST IgGs diluted 1:1000 in blocking buffer overnight at 4°C. Some slides were incubated with anti-M1ACT-GST IgGs pretreated for 1 h at 4°C with a 100-fold molar excess of the PDE1A_v7 C-terminal peptide FKNNLVDIIQQNKERWKELAAQGCC (EZBiolab, Inc. Westfield, IN) or with the M1ACT-GST fusion protein antigen used to produce the antiserum. The slides were then washed for 10 min with TBS-ICC three times and incubated for 1 h with FITC-conjugated goat anti-rabbit IgGs diluted 1/200 in blocking buffer at room temperature. The slides were washed for 10 min with TBS-ICC three times, and then once for 10 min in TBS-ICC containing 1 ug/ml propidium iodide (Molecular Probes). The slides were then mounted using Vectashield fluorescence mounting medium and examined under a confocal microscope.
All experiments involving the use of animals were reviewed and approved by the Animal Care Committee of the University of Washington.
| RESULTS |
|---|
|
|
|---|
|
To test this hypothesis, we screened a mouse testis cDNA library with the 32P-labeled Pde1a probe and isolated four different cDNAs that contained novel sequences. None of the clones contained the entire open reading frame. However, two clones possessed a large open reading frame and an in-frame stop codon 5' to a putative start methionine, and two other clones possessed termination codons and identical 3' untranslated sequences. Therefore, the mature Pde1a transcript in mouse testis could be expected to be composed of these 5' and 3' sequences.
To verify this, we employed RT-PCR amplification and performed 5' RACE to confirm that the mature Pde1a mRNA species most represented in mouse testis contained the observed 5' sequence. Of four 5' RACE clones chosen at random, three of the cDNAs were identical and closely corresponded to the identified library clones. Clones isolated from the mouse testis library yielded cDNAs that contained polyadenylation signal sequences as well as poly(A+) 3' ends, strongly suggesting that the entire 3' end of the new Pde1a mRNA transcript was cloned. A sense oligo corresponding to the 5' end of these clones and an antisense oligo corresponding to the 3' untranslated sequence of the clones were used to amplify a cDNA containing the entire open reading frame. The unique 5' and 3' sequences of the cDNA corresponding to the mature mouse testis Pde1a_v7 mRNA and the relative protein sequence are shown in Figure 2 (accession no. AF159298 deposited sequence). We designated it as Pde1a_v7 (called PDE1A7 in GenBank) to keep numbering in order of variants identified up to that date ([24]; see Discussion). Various deposited sequences cloned from mouse testis confirm the new 5' and 3' sequence. Finally, the size of the composite cDNA of Pde1a_v7 (1635 bp) is nearly equal to the size of the mRNA as determined by Northern blot analysis. The cDNA includes a large open reading frame encoding a polypeptide of 456 amino acid residues. The methionine codon (bases 4547) and flanking nucleotides display the minimum requirements for a translational initiation site as defined by Kozak [25] and are preceded by an in-frame stop codon (bases 1820). Therefore, the sequence reported here likely contains the entire open reading frame. Alignment of the Pde1a_v7 sequence to the mouse genome (genomic contig NT_039207, chromosome 2) reveals that the first exon lies nearly 220 kb downstream from the first exon of AK043647, a Pde1a cloned from brain that appears to be the murine equivalent of bovine and human PDE1A_v2 (Fig. 3). Therefore Pde1a_v7 is likely transcribed from a different promoter, within what is an intronic region for other Pde1a forms. The identified 3' sequence represents a new alternative exon located in the gene upstream to the 3' exon of other Pde1a forms (Fig. 3). Moreover, two additional variants, resulting from alternative splicing, have been identified. One, which we call Pde1a_v8 (PDE1A8 in GenBank), contains a new exon, downstream from the first exon of Pde1a_v7, introducing a stop codon (Fig. 2) (accession no. AY845863 deposited sequence). This might represent an mRNA targeted for non-sense-mediated decay, a widespread result of alternative splicing whose function is still unclear [26]. The other form Pde1a_v9 contains a new exon before the last exon of Pde1a_v7. It predicts a protein with eight extra amino acids at the carboxy terminal before the two last cysteines (Fig. 2) (accession #AY845864 deposited sequence).
|
|
To verify the relative abundance of these Pde1a transcripts in mouse testis, real-time PCR was performed using primers specific for the various potential combinations of exons for all the known Pde1a isoforms, including the new forms identified here and the Pde1a common area (Table 1, Fig. 4). Among the combination of primers tested, the strongest signal was obtained with primers spanning exons 4/6, which were designed to detect the 5' region of Pde1a_v7 and Pde1a_v8. Of the combinations tested for the various Pde1a 3' regions, the strongest signal was obtained with primers spanning exons 16/18, which were designed to detect the 3' region of Pde1a_v7/Pde1a_v8 and Pde1a_ v9. As indicated by the very weak signals seen for exons 5/6 and 16/17, respectively exons for Pde1_v8 and Pde1a_ v9, these variants represent a minimal fraction of Pde1a in testis. Therefore, it can be inferred that the signal detected by primers probing exons 4/6 and 16/18 is due largely, if not entirely, to Pde1a_v7, confirming that this is the most abundant form present in mouse testis. The level of expression of other known forms of Pde1a, probed by targeting their unique 5' and 3' exon combinations, 1/3, 2/3, and 16/19, is also minimal.
|
A comparison of the amino acid sequences of the predicted polypeptide encoded by the Pde1a_v7 cDNA with other Pde1a is shown in Figure 5. Unlike PDE1A_v1 and PDE1A_v2 [17], PDE1A_v7 lacks an amino-terminal CaM-binding domain. All these isozymes have an inhibitory domain which, in the absence of calcium-bound CaM, locks the enzyme into a relatively inactive state [17]. PDE1A_v7, as well as the other isozymes, also possesses a second CaM-binding domain located downstream to the inhibitory domain. Therefore, when calcium-bound CaM binds to this domain, the enzyme becomes activated. The activation of PDE1A_v7 by CaM is likely to be comparable to that of a structurally very similar deletion mutant of bovine PDE1A described in an earlier report [17]. Half-maximal activation of this mutant was achieved at
4 nM CaM.
|
To determine whether the Pde1a_v7 cDNA encoded a polypeptide having a molecular mass and catalytic activity consistent with that predicted by the large open reading frame, the cDNA was subjected to in vitro transcription/ translation. Attempts to express the PDE1A_v7 in HEK293T, COS and Sf9 cells were unsuccessful because of excessive proteolysis. Expression in HEK293T cells using the vector pcDNA3.1/V5-HIS-TOPO yielded proteolyzed PDE1A_v7 at both 24 and 48 h of transfection (data not shown). Conversely, in vitro translation produced a polypeptide with a relative mobility of approximately 52 kDa, consistent with the size predicted by the large open reading frame of the Pde1a_v7 cDNA (Fig. 6). The cGMP hydrolytic activity was stimulated threefold by calcium-bound CaM (Fig. 7). This result provides evidence that the Pde1a_v7 cDNA encodes a functional CaM-stimulated PDE.
|
|
PDE1A was previously shown to be expressed in mature sperm using an antibody that would recognize all forms of PDE1A [10], and we wanted to verify if PDE1A_v7 was actually present in mature mouse sperm. Mouse sperm extracts were used for immunoprecipitation with ACAP antibody (a monoclonal antibody recognizing PDE1A and PDE1C but not PDE1B isoforms [23]) covalently coupled to agarose. CaM-stimulated cyclic nucleotide hydrolytic activity was detected in the immunoprecipitate (Fig. 8A). Activity in the immunoprecipitate was measured using either 1 µM cGMP or 1 µM cAMP, although the activity detected using cGMP was twofold greater (Fig. 8B). Despite the higher activity toward cGMP, it has been observed that PDE1A cAMP hydrolizing activity can be physiologycally relevant [27, 28]. The presence of cGMP and its relevant signaling components in mammalian sperm is controversial but deserves to be further investigated, as recent reports indicate [28, 29].
|
A Western blot of immunoprecipitated mouse sperm PDE1 was stained with M1ACT-GST rabbit polyclonal antibody (PDE1A-GST affinity purified) and is shown in Figure 9. The antibodies reacted mostly with a polypeptide of approximately 50 kDa (lane 5), which is nearly equal to the molecular mass of PDE1A_v7 as predicted by the cloned cDNA. Slightly smaller immunoreactive bands (45 and 42 kDa) were also visible but less intense than the 50 kDa polypeptide; these are likely to be the result of partial proteolysis because the sperm acrosome is a rich source of protease activities [30]. A very faint band is also visible at
58 kDa. This immunoreactivity may be caused by low expression of another PDE1A variant. As expected, the antibody reacted with both the control sample consisting of an extract prepared from Sf9 cells infected with a Pde1a cloned from mouse brain (accession U56649) (lane 3) and the control immunoprecipitate consisting of the same sample adsorbed to ACAP-agarose (lane 7). No immunostaining was detected in samples immunoprecipitated with agarose alone (no IgG) (lane 68) or in ACAP-agarose immunoprecipitates incubated with no sample (lane 1).
|
To determine the subcellular localization of PDE1A_v7, we stained mouse sperm with affinity-purified anti-M1ACT-GST IgGs. PDE1A immunoreactivity was detected only in the sperm tail being more abundant in the principal piece (Fig. 10, panel A). Preincubation of the antibody with the C-terminal peptide of PDE1A_v7 blocked this immunoreactivity (Fig. 10, panel B). These results indicate that PDE1A_v7 is concentrated in the tail of mature mouse sperm.
|
To further demonstrate that the antibody reacts specifically with PDE1A in situ, control experiments using Sf9 cells uninfected or infected with a mouse brain PDE1A recombinant baculovirus were performed (Fig. 11). Sf9 cells expressing PDE1A protein incubated with affinity purified anti-M1ACT-GST IgGs alone displayed intense immunoreactivity (Fig. 11A). Preincubation of the IgGs with a 100-fold molar excess of GST protein did not affect staining (Fig. 11B). In contrast, preincubation of the IgGs with the M1ACT-GST fusion protein completely blocked staining (Fig. 11C). Moreover, the anti-M1ACT-GST IgGs did not stain uninfected Sf9 cells (Fig. 11E).
|
| DISCUSSION |
|---|
|
|
|---|
Real-time PCR confirmed that Pde1a_v7 is the most abundant form of Pde1a in mouse testis. The results of a recent microarray analysis of mouse germ cells at different stages of maturation also indicate that Pde1a_v7 is a relevant form [34]. Between three probe sets targeting the alternative 3' sequence of Pde1a, only the signal from the one specific for Pde1a_v7 3' (167653_f_at) increases in postmeiotic spermatids (accessible through NCBI via the Gene Expression Omnibus repository GEO; http://www.ncbi.nih.gov/geo/; GEO accession number GSE926). The data are also in a searchable form via the Mammalian Reproductive Genetics database (http://mrg.genetics.washington.edu). Moreover, the cell-specific stage of expression confirms what was previously reported by this laboratory using in situ profiling of Pde1a in mouse testis [10].
Nine different forms of human PDE1A polypeptides arising from the combination of three different N- and C-termini have been described [33]. The variation in transcripts is even higher considering that forms having the same open reading frame can have different 5' and 3' untranslated regions [24] that are potentially relevant for the translational control of expression or posttranscriptional control of mRNA stability. The fact that the same protein can be made from different transcripts has contributed to some confusion existing in the Pde1a transcript variant nomenclature [24, 33]. We named this new form Pde1a_v7 because it did not correspond to any of the previously described six human Pde1a transcripts [24] when we initially cloned and deposited it. The structure of PDE1A_v7 protein differs from other PDE1A isoforms in two respects. First, PDE1A_v7 has a short (3 amino acid) amino terminus divergent from PDE1A_v1 55 amino acids (accession no. AF023529) and the mouse equivalent of PDE1A_v2 (accession no. AK043647) 71 amino acids (Fig. 5). Therefore, instead of possessing an inhibitory domain flanked by two CaM-binding sites as in PDE1A_v1 [17], PDE1A_v7 possesses only the inhibitory domain and the downstream CaM-binding site. Second, PDE1A_v7 possesses a truncated carboxy-terminal region that is 23 amino acids shorter than other PDE1A variants, and it also has two divergent amino acids. There is also a divergence in amino acid sequence with the human form expressed in testis, which contains a unique 38 amino acid N-terminal sequence.
Functionally, the PDE1A_v7 isozyme is likely to be similar, if not identical, to bovine PDE1A_v2, because the concentration of calcium-bound CaM required to activate a deletion mutant of PDE1A that closely resembles the structure of PDE1A_v7 is similar to the wild-type PDE1A_v2 [17]. We did not directly test the sensitivity of PDE1A_v7 to CaM because the required amount of in vitro transcription/ translation reagents was prohibitive. PDE1A_v7 was proteolyzed when expressed in HEK293, COS, or in Sf9 cells, and proteolysis is known to activate PDE1A [35]. However, we did find that the in vitro translated product was activated by CaM (Fig. 7). It is possible that the observed sensitivity to proteolytic degradation might reflect a regulatory role if the proteolysis yields a constitutively active non-CaM-dependent PDE1A_v7 in vivo. This possibility will be tested in future studies. Because the divergent C-terminus is downstream from the catalytic domain [36], it is expected to have little, if any, effect on the specificity or catalytic efficiency of cyclic nucleotide hydrolysis.
Based on a survey of mRNAs from a number of mouse tissues by Northern analysis, and in situ and immunocytochemical experiments on mouse testis, PDE1A is highly expressed in germ cells, and the protein first appears in the tail during spermiogenesis [10]. In contrast, the expression of the PDE1C isoform is found in the cell body of developing germ cells [10]. In mature mouse sperm, PDE1A immunoreactivity was also detected in the tail ([10] and Fig. 10). A similar localization has been reported for a PDE1A in human sperm [11]. Other investigators have identified CaM-dependent PDE activity in mature sperm based on kinetic analysis of crude extracts and partially purified preparations [9, 11, 37, 38]. It has been proposed that in human sperm a PDE1 exists as a stable complex with CaM, possibly reflecting an activation event in ejaculated sperm [11]. Perhaps an active calcium/CaM-dependent PDE is required to maintain basal levels of cAMP, because a significant increase in cAMP has been detected in rat sperm incubated in a medium containing bicarbonate for 3 h in the absence of calcium [39].
Using the immunoprecipitating antibody "ACAP,", which recognizes PDE1A and PDE1C but not PDE1B [23] isozymes, we confirmed that the activity immunoprecipitated from mouse sperm had the electrophoretic mobility expected for PDE1A_v7. This observation, when combined with the real-time PCR results and the mRNA expression data, leads us to conclude that PDE1A_v7 is most likely the major PDE1A in mature sperm. It is possible that a small amount of another PDE1A isozyme is also expressed, because a faint immunoreactive band with a molecular weight of about 59 kDa was also detected. PDE1A_v7 appears to be associated with a particulate fraction in mouse sperm because detergents are required to extract the PDE activity. However, the nature of this association is not currently known. Posttranslational modifications such as myristoylation and/or palmitoylation are unlikely because the amino acid sequence of PDE1A_v7 does not contain the required consensus sequences within the divergent amino acid residues.
Cyclic AMP is known to play a role in sperm motility [1, 3, 4, 6] and possibly chemotaxis [40]. Moreover, agents that are known to inhibit PDEs and are thereby likely to increase intracellular cyclic nucleotides have been shown to increase sperm motility [5, 6]. PDE1A appears to be uniquely suited to serve a regulatory role in cAMP turnover in sperm, considering that it can be activated by CaM after depolarization-evoked calcium rises [6]. Such an activation would explain the reported transient increase in cAMP concentration upon bicarbonate activation, and might represent a mechanism of signal desensitization [41]. In addition, PDE1A might play a role in the molecular control of flagellar beat that is thought to involve an interplay of cAMP and calcium and CaM mediated events [42]. Interdependence of Ca2+ and cAMP oscillation patterns is being recognized as a new paradigm for signal transduction [43]. Although it has been reported that calcium can oscillate in sperm [4446], it is not currently known whether cAMP levels oscillate with beat frequency. If cAMP does oscillate, then a Ca2+/CaM- regulated PDE in the tail is likely to be a major regulator of the process. Another potential role for PDE1A might be to keep cAMP, and therefore motility, low while sperm are stored in the epididymis. Unfortunately, the limited bioavailabilty of cell-permeable PDE1A inhibitors and the lack of animals having disruptions in the PDE1A gene has not allowed a clear appraisal of the specific role(s) of PDE1A in motility. For instance, in experiments using vinpocetine, a PDE1A partially-selective inhibitor, a decrease in the percentage of progressively motile bovine sperm was associated with a negative effect on cell viability, likely because of the high concentration used [47]. Although a role for cGMP in mammalian sperm has not been clearly established, because PDE1A is a dual cyclic nucleotide substrate enzyme that actually prefers cGMP as substrate, it might also have a role in regulation of cGMP signaling.
Here we have provided evidence that a new transcript variant of Pde1A is expressed in mouse sperm and may play an important role in regulating signal transduction to control sperm motility and chemosensing.
| NOTE ADDED IN PROOF |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 Correspondence: Joseph A. Beavo, University of Washington, Department of Pharmacology, Box 357280, 1959 NE Pacific St., Seattle, WA 98195. FAX: 206 685 3822; beavo{at}u.washington.edu ![]()
3 These authors contributed equally to this work ![]()
4 Current address: Lexicon Genetics Inc. 8800 Technology Forest Place, The Woodlands, TX 77381-1160 ![]()
5 Current address: University of Rochester Medical Center, Cardiology Unit, Box 679, 601 Elmwood Ave., Rochester, NY 14642 ![]()
6 Current address: Vollum Institute, Oregon Health Sciences University, 3181 Sam Jackson Park Road, Portland, Oregon 97239-3098 ![]()
Received: 16 December 2004.
First decision: 20 January 2005.
Accepted: 13 May 2005.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. T. Bender and J. A. Beavo Cyclic Nucleotide Phosphodiesterases: Molecular Regulation to Clinical Use Pharmacol. Rev., September 1, 2006; 58(3): 488 - 520. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |