| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Center for Reproductive Biology, School of Molecular Biosciences, Washington State University, Pullman, Washington 99164-4231
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
follicle, granulosa cells, oocyte development, ovary, theca cells
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The coordination of the primordial to primary follicle transition is largely endocrine- and gonadotropin-independent. Ovaries cultured in serum-free medium contain primordial follicles that are fully competent to make the primordial to primary follicle transition [6–8]. Knockout mice who are null mutants for either FSH receptor or LH receptor are able to undergo the primordial to primary follicle transition [9, 10]. The primordial to primary follicle transition is coordinated primarily by locally produced regulatory factors [1]. The current study was designed to investigate one of these locally produced regulatory factors and the role of mesenchymal-epithelial cell interactions in this process.
A postnatal 4-day-old rat ovary culture system has been used to investigate local growth factors that promote the primordial to primary follicle transition. At this stage of development the ovary consists mostly of primordial follicles. Previously, kit ligand (KITL) [8] and leukemia inhibitory factor (LIF) [11] have been shown to be produced by the pregranulosa and to act on the oocyte to promote the primordial to primary follicle transition. Kit ligand also appears to function as a theca cell recruitment factor [12]. Kit ligand has been shown to interact with keratinocyte growth factor (KGF, also known as fibroblast growth factor-7 [FGF-7]) in the ovary to regulate ovarian surface epithelium [13] and large antral follicle growth [14]. Fibroblast growth factor-2 (FGF-2, also known as basic fibroblast growth factor [bFGF]) [15] has also been shown to be produced by the oocyte and acts on the pregranulosa to promote the primordial to primary follicle transition. Recently, bone morphogenic protein-4 (BMP4) has been found to be produced in the stroma of the ovary to act as a survival factor for the oocytes and primordial follicles [16]. Nerve growth factor also appears to influence primordial to primary follicle transition [17]. Interestingly, anti-Müllerian hormone (AMH) (i.e., Müllerian inhibiting substance) that is produced by granulosa cells of larger developing follicles can inhibit the primordial-to-primary follicle transition [18]. This allows developing follicles to regulate the onset of primordial follicle development.
An interesting question that arises in the study of primordial follicle development is, "At what stage of folliculogenesis does the mesenchymal theca cell originate?" In most species, morphologically distinct theca cells do not appear until an early preantral stage of folliculogenesis. In the rat, the theca become apparent during the transition to the primary follicle stage [4]. The assumption is that mesenchymal-epithelial interactions facilitate the primordial to primary follicle transition in all species, but the mesenchymal cells may not be morphologically distinct. The current study investigates a mesenchymal factor, KGF, for its ability to promote the primordial to primary follicle transition.
KGF, also termed FGF-7, is a prototypical mesenchymal factor [19]. KGF is a 28-kDa protein that is a member of the large fibroblast growth factor protein family [20, 21]. There are four receptors for the fibroblast growth factor family, with numerous splice variants. A splice variant of fibroblast growth factor receptor 2 is the unique receptor for KGF [22]. This splice variant is primarily expressed in epithelial cells. KGF has been shown to have a role in the developing antral ovarian follicle [23]. KGF is produced by the theca cells [23] and acts on the granulosa cells to promote KITL expression, which in turn acts back on the theca in a positive feedback loop [14]. This cell-cell interaction is coordinated by gonadotropins and steroids to facilitate the rapid growth of the antral follicle. The presence and action of KGF at earlier stages of folliculogenesis are unknown.
The hypothesis tested is that KGF from the stroma adjacent to the primordial follicle interacts with the pregranulosa cells. This sets up a mesenchymal-epithelial interaction that helps coordinate the primordial to primary follicle transition. Experiments in this study test whether KGF promotes the primordial to primary follicle transition, and whether KGF interacts with other paracrine growth factors to coordinate this developmental process.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Sprague Dawley rats from the Washington State University breeder colony (breeder rats came from Charles River Laboratories, NC) were used in this study. All animal procedures were approved by the Washington State University Institutional Animal Care and Use Committee. Ovaries from 4-day-old rats were cultured for 14 days. Whole ovaries were cultured as previously described [12] on floating filters (0.4 µm Millicell-CM; Millipore, Bedford, MD) in 0.5 ml Dulbecco modified Eagle medium (DMEM)-Ham F-12 medium (1:1, vol/vol) containing 0.1% BSA (Sigma, St. Louis, MO), 0.1% albumax (Gibco BRL, Gaithersburg, MD), 2.75 µg/ ml transferrin, and 0.05 mg/ml L-ascorbic acid (Sigma) in a 4-well culture plate (Nunc plate; Applied Scientific, South San Francisco, CA). Ovaries were cultured at 37°C in 5% CO2 with medium and treatments replaced every 2 days. Ovaries may be cultured in this manner for 2 wk and maintain a healthy appearance. The total number of follicles present in the ovaries is unchanged over the culture period, suggesting that there is very little follicle atresia [8]. Approximately 45% of follicles in untreated (control) ovaries initiate primordial follicle transition in culture, compared to approximately 35% in age-matched in vivo ovaries [8]. Ovaries were randomly assigned to treatment groups, with 1–3 ovaries per floating filter. From 3 to 8 ovaries were examined per treatment group. Treatments during organ culture were: KGF (100 ng/ml; R&D Systems, Minneapolis, MN), KITL (100 ng/ml; R&D Systems), LIF (100 ng/ml; R&D Systems), FGF2/ bFGF (100 ng/ml; R&D Systems), insulin 200 ng/ml, KGF neutralizing antibody (10 µg/ml; R&D Systems), and KIT (i.e., c-kit) neutralizing antibody (10 µg/ml; Gibco BRL) [8]. Medium was supplemented with penicillin, streptomycin, and gentamycin to prevent bacterial contamination. After culture, ovaries were fixed in Bouin fixative (Sigma) for 2 h. Ovaries were then embedded in paraffin, sectioned at 4µm, and stained with hematoxylin-eosin.
The number of follicles at each developmental stage was counted in two serial sections with the largest cross-section through the center of the ovary and averaged. Normally two ovaries were in each treatment group. Experiments were repeated three times, with n = 6 for each treatment group. Normally, 150–200 follicles were present in a cross-section. No change was found in total follicle number per section or ovary because of any treatment (data not shown). Ovaries cultured for 2 wk in this manner with or without treatment also show no loss in total follicle numbers [8]. Some variability exists between different experiments regarding the basal (i.e., endogenous) levels of primordial follicle development in the control. This accounts for the slight differences between the experiments in the degree of follicle development seen in controls and is why controls are run with each experiment.
Real-Time Polymerase Chain Reaction
Ovaries were isolated from 4-day-old rats and placed into culture as described above. Cultured ovaries were treated for 2 days with 50 ng/ml of either KGF or KITL, or were left untreated as controls. Three ovaries from the same culture well were pooled to make each RNA sample. RNA was extracted using the Trizol reagent (Sigma, St. Louis, MO). RNA samples were DNase treated using the TURBO-DNA-free kit (Ambion, Austin, TX). One to two micrograms of total RNA from each sample was reverse-transcribed to cDNA using a standard oligo-dT RT protocol in a reaction volume of 25µL. cDNA samples were diluted 1:10 and 2µL of diluted sample per well was used as template for real-time polymerase chain reaction (PCR) analysis. Each sample was run in triplicate. The Platinum SYBR Green qPCR Supermix kit (Invitrogen, Grand Island, NY) was used according to the manufacturer's instructions. The Kitl primers (NCBI: NM_021843) were rKitl-720: 5'ATTTATGTTACCCCCTGTTGCAGCC3' and rKitl-859: 5'CAATTACAAGCGAAATGAGAGCCG3'. The Kgf primers (NCBI_022182) were rKgf-1–670: 5'AGTGGGCCGTTTTTTGTTCTTT3' and rKgf-1–590: 5'GGGAAATGTTCGTGGCCTTAA3'. The S2 housekeeping reference gene primers (NCBI: NM_031838) were rS2-F: 5'CTGCTCCTGTGCCCAAGAAG3' and rS2-R: 5'AAGGTGG CCTTGGCAAAGTT3'. Real-time PCR was performed on an ABI-7000 real-time machine (Applied Biosystems, Inc., Foster City, CA). For Kitl, the protocol was 60°C for 2 min, 95° for 10 min, then 40 cycles of 95°C for 20 sec and 68°C for 90 sec. For Kgf the protocol was 40 cycles of 95°C for 20 sec, 64°C for 45 sec, and 72°C for 60 sec. Fluorescent detection data were analyzed and normalized for Kitl mRNA levels to S2 mRNA levels, and then KGF-treated sample values were normalized to their own experiments' control Kitl mRNA levels.
Immunohistochemistry
Localization of KGF protein was determined by immunohistochemical analysis. Four-day-old rat ovaries were cultured for 2 wk and then fixed in Bouin solution (0.9% picric acid, 9% formaldehyde, 5% acetic acid) for 1–2 h. Ovaries were paraffin-embedded and sectioned at 3–5 µm. Ovaries were deparaffinized in xylenes and hydrated through an ethanol series of 100%, 90%, and 70%. Antigens were exposed by boiling sections for 5 min in 0.01 M sodium citrate buffer, pH 6.0. A solution of 10% goat serum in phosphate-buffered saline (PBS) was used as a blocking agent before sections were incubated with primary antibody. Slides were incubated with polyclonal rabbit anti-human KGF antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) overnight at 4°C. Secondary antibody (biotinylated goat anti-rabbit IgG, Vector, Burlingame, CA) was detected by using the Vectastsain kit (Vector).
Western blot analysis was preformed to evaluate the antibody used for immunohistochemical localization of KGF. Antibodies were tested against recombinant human KGF (R&D Systems) and rat ovary protein lysates. Ovary lysates were prepared by homogenizing adult rat ovaries in homogenization/lysis buffer (0.3M sucrose, 10 mM Tris pH 8.0, 400 mM NaCI2, 0.5% NP40) with complete Mini protease inhibitor cocktail tablets (Roche, Indianapolis, IN), centrifuging at 10 000 x g for 30 min at 4°C, and collecting supernatant. The protein concentration in the supernatants was estimated using a Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA). Approximately 50µg protein lysates or 120 ng recombinant KGF in SDS sample loading buffer was boiled for 5 min and electrophoresed on a 10% SDS-polyacrilamide gel. The protein was subsequently transferred onto a PVDF membrane (Immobilon-P, Millipore) and probed with antibodies to KGF (Cat. Nos. sc-136 and sc-7882; Santa Cruz Biotechnology Inc.; and MAB251; R&D Systems). The specific antigen antibody complex was visualized using a chemiluminescent detection kit (Pierce, Rockford, IL).
Statistics
Treatment groups are compared using analysis of variance (ANOVA) followed by a Dunnett or Fisher LSD test where appropriate. In the case of real-time PCR experiments, the expression value for each treated group was normalized to its control, so all control values were equal to one. Therefore, the nonparametric Wilcoxon rank sums test was used to compare treatment groups. Groups were considered significantly different if P 
0.05. All statistics were calculated with the help of JMP v3.1 software (SAS Institute, Inc., Cary, NC).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
The role of endogenous KGF was investigated with a neutralizing anti-KGF antibody used to treat 4-day-old ovaries in culture (Fig. 3A). KITL was used as a stimulator of follicle development because of its close relationship with KGF in other mesenchymal-epithelial systems, such as in the antral follicle [14]. Antral follicle theca cells produce KGF that can act on granulosa cells to increase KITL production to feedback on theca cells to increase KGF expression [14]. The KGF antibody was unable to attenuate spontaneous primordial to primary follicle transition in the ovary. Interestingly, the KGF antibody was able to attenuate the stimulatory action of KITL on primordial follicle transition (Fig. 3A). This observation suggests that KGF and KITL interact in a similar manner to that of the antral follicle mesenchymal-epithelial systems. The inverse of this experiment was performed to further investigate any interaction between KGF and KITL. Ovaries were cultured in the presence of KGF and a neutralizing KIT (i.e., c-kit) antibody that blocks actions of the KITL receptor (Fig. 3B). The KIT antibody used was found to block KITL actions, as previously described [8]. In contrast to the actions of the KGF antibody, the KIT antibody was unable to attenuate the stimulatory action of KGF on the primordial to primary follicle transition. Therefore, KGF antibody can block KITL actions, but blocking KITL activity had no effect on KGF actions (Fig. 3).
|
A quantitative real-time PCR procedure was performed on RNA from whole postnatal 4-day-old ovaries to assess Kitl and Kgf expression in response to growth factors. As previously discussed, the neonatal ovary is primarily composed of early-stage primordial follicles. To investigate more direct actions of KGF, ovaries were incubated for 2 days in the absence or presence of KGF before RNA collection and analysis. KGF treatment was found to increase Kitl mRNA expression compared to controls (P 0.05) (Fig. 4A). The inverse of the above experiment was also performed. Ovaries were incubated in the absence or presence of KITL and then Kgf mRNA expression was measured. KITL treatment was found to increase Kgf mRNA expression (Fig. 4B).
|
Immunohistochemistry was performed to localize KGF protein in freshly isolated 4-day-old neonatal rat ovaries. KGF staining was present in selected mesenchymal cells and focal stromal areas around developing primordial follicles (Fig. 5). Observations suggest KGF is produced by individual stromal cells adjacent to the granulosa layer of the developing primordial follicle. Western blot analysis was preformed to evaluate the specificity of KGF antibodies to recombinant KGF and rat ovary lysates. The primary antibody (Cat. No. sc-7882) showed the expected bands at 18 and 36 kDa against recombinant KGF, and the same bands were present in the ovary lysates (data not shown). Antibody sc-1365 showed no bands in the ovary lysates and antibody MAB251 did not detect the recombinant KGF (data not shown). These antibodies were deemed inappropriate for immunohistochemistry and were not subsequently used. Although immunohistochemical and/or neutralizing antibodies do not always work well on Western blot analysis, the antibody that showed specificity on the Western blot and worked in immunohistochemistry was selected. The negative control nonimmune IgG showed no staining (Fig. 5C). This was not a peptide antibody, so blocking peptide experiments could not be performed. The hematoxylin-eosin stain was found to mask the KGF immunostain, so a separate hematoxylin-eosin stained ovary section is shown in Figure 5D. The KGF receptor (i.e., FGFR2 IIIb splice variant) has been previously localized to the ovarian follicle [14, 26]. The KGF receptor immunohistochemistry and mRNA were localized to the developing granulosa cells. Expression in granulosa cells increases as follicles develop into large antral follicles [14, 26].
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The organ culture experiments demonstrate that KGF promotes the primordial to primary follicle transition in vitro. KGF did not have an additive effect with other growth factors known to promote the primordial to primary follicle transition (Fig. 6). The inability of KGF to have an additive effect with insulin suggests a lack of direct action on the oocyte. Other growth factors, such as KITL and LIF, have been shown to possess an additive effect with insulin [24] and these are factors that appear to act directly upon the oocyte (Figs. 2 and 6). Growth factors that do not act upon the oocyte, such as FGF2, do not display an additive effect with insulin. Observations suggest that KGF acts as a mesenchymal factor on the epithelial granulosa cells, which are the site of KITL expression (Fig. 6).
|
The neutralizing KGF antibody was unable to retard any endogenous KGF activity in the organ culture experiment. However, the KGF antibody was able to attenuate the stimulatory action that exogenous KITL had on the primordial to primary follicle transition. This suggests that the KITL from the pregranulosa promotes the production or action of KGF, presumably derived from the mesenchymal cells, to coordinate the primordial to primary follicle transition. This was confirmed with the results of real-time PCR analysis showing that KITL treatment of ovaries stimulates Kgf mRNA expression. Observations suggest that KGF is a mesenchymally-derived factor from a precursor theca cell that acts on the granulosa (Fig. 6). The inverse experiment was performed with KGF and neutralizing KIT antibody. The KIT antibody was unable to attenuate KGF promotion of the primordial to primary follicle transition. Although KGF was shown to stimulate Kitl mRNA expression, KGF must have a capacity to stimulate primordial to primary follicle transition that is independent of Kitl expression. KGF appears to have the ability to act directly on the primordial follicle through stimulating KITL expression, as well as having KITL-independent mechanisms. An alternative consideration is that the KIT antibody was not completely effective in blocking KITL actions. However, this KIT antibody was found to be active and to block KITL actions [8]. Further investigation is needed to clarify the mechanisms of KGF action.
Interestingly, both KITL and KGF were able to increase expression of each other, creating a positive feedback loop. This is similar to the interaction described for KITL and KGF in larger antral follicles [14]. The experiments to assess alterations in mRNA levels used ovary organ cultures. Therefore, changes in the populations of different follicle categories present could influence changes in mRNA. It is not possible to purify cell populations to assess direct effects on gene expression from these early stage follicles. To address this, only a 2-day culture period was used, in which no change in follicle development was detected (data not shown) [8]. This shorter incubation period for analysis of effects on mRNA levels corrected for the use of the organ cultures and supports a direct effect of these factors on gene expression.
The current model of the primordial to primary follicle transition involving KGF is presented in Figure 6. The granulosa produces LIF that acts upon the granulosa cells and the oocyte. The oocyte produces FGF2/bFGF that acts upon the granulosa and theca cells. Insulin acts as an endocrine agent on the oocyte. The theca and the surrounding stroma produce BMP4, which acts as a follicular survival factor. In this study, it is proposed that the granulosa cells produce KITL that acts upon the oocyte and also acts on the stroma to recruit theca cells that produce KGF, which then acts upon the granulosa to promote the primordial to primary follicle transition. This model of KITL and KGF action is consistent with a previous hypothesis of KITL acting as a theca cell recruiter and organizer [12]. The KITL acts to recruit theca cells, which, among other functions, begin to produce KGF that promotes the primordial to primary follicle transition (Fig. 6).
The regulation of the primordial to primary follicle transition is one of the critical factors in establishing the size of the primordial follicle pool and thus the length of a female's reproductive life. Elucidation of the factors that control the size of the primordial follicle pool provides insight into the pathological conditions that result in premature menopause or premature ovarian failure. The current study suggests communication occurs between the developing granulosa/oocyte unit and the immediately surrounding stroma to promote the primordial to primary follicle transition. Observations support a mesenchymal-epithelial interaction involving KGF and KITL in the initiation of primordial follicle development. Establishing this interaction provides valuable insight into the biology of the primordial follicle and may lead to a better understanding and design of therapeutics for the treatment of pathological conditions caused by primordial follicle dysfunction.
|
FOOTNOTES |
|---|
Received: 21 April 2005.
First decision: 6 May 2005.
Accepted: 5 July 2005.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Dole, E. E Nilsson, and M. K Skinner Glial-derived neurotrophic factor promotes ovarian primordial follicle development and cell-cell interactions during folliculogenesis Reproduction, May 1, 2008; 135(5): 671 - 682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Buratini Jr., M.G.L Pinto, A.C Castilho, R.L Amorim, I.C Giometti, V.M Portela, E.S Nicola, and C.A Price Expression and Function of Fibroblast Growth Factor 10 and Its Receptor, Fibroblast Growth Factor Receptor 2B, in Bovine Follicles Biol Reprod, October 1, 2007; 77(4): 743 - 750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Nilsson, N. Rogers, and M. K Skinner Actions of anti-Mullerian hormone on the ovarian transcriptome to inhibit primordial to primary follicle transition Reproduction, August 1, 2007; 134(2): 209 - 221. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Choi, Y. Qin, M. F. Berger, D. J. Ballow, M. L. Bulyk, and A. Rajkovic Microarray Analyses of Newborn Mouse Ovaries Lacking Nobox Biol Reprod, August 1, 2007; 77(2): 312 - 319. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wang, J. Li, C. Ying Wang, A. H. Yan Kwok, and F. C. Leung Epidermal Growth Factor (EGF) Receptor Ligands in the Chicken Ovary: I. Evidence for Heparin-Binding EGF-Like Growth Factor (HB-EGF) as a Potential Oocyte-Derived Signal to Control Granulosa Cell Proliferation and HB-EGF and Kit Ligand Expression Endocrinology, July 1, 2007; 148(7): 3426 - 3440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G Knight and C. Glister TGF-{beta} superfamily members and ovarian follicle development. Reproduction, August 1, 2006; 132(2): 191 - 206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E Nilsson, C. Detzel, and M. K Skinner Platelet-derived growth factor modulates the primordial to primary follicle transition. Reproduction, June 1, 2006; 131(6): 1007 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.J. Hutt, E.A. McLaughlin, and M.K. Holland Kit ligand and c-Kit have diverse roles during mammalian oogenesis and folliculogenesis Mol. Hum. Reprod., February 1, 2006; 12(2): 61 - 69. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
