|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Department of Obstetrics and Gynecology, Keio University School of Medicine, Tokyo 160-8582, Japan
ABSTRACT
Many signaling events induced by ovarian steroid hormones, cytokines, and growth factors are involved in the process of decidualization of human and rodent endometrium. We have reported previously that tyrosine kinase activation of SRC functionally participates in decidualization of human endometrial stromal cells. To address its essential role in decidualization, we examined, using wild-type and Src knockout mice, whether the process of decidualization was impaired in the absence of SRC. Immunohistochemistry using an antibody specific for the active form of SRC revealed that the active SRC was expressed prominently in the decidualizing stromal cells of the pregnant wild-type mouse. Moreover, the active SRC was upregulated in the uterine horn with artificially stimulated decidual reaction. In comparison with wild-type and Src heterozygous mice, the uterus of Src null mice showed no apparent decidual response following artificial stimulation. Ovarian steroid-induced decidualization in vitro, as determined by morphological changes and expression of decidual/trophoblast prolactin-related protein and prostaglandin-endoperoxide synthase 2 (also known as Cox2), both of which are decidualization markers, did not occur in a timely fashion in endometrial stromal cells isolated from the uteri of SRC-deficient mice compared to those from wild-type and Src heterozygous mice. Our results collectively suggest that SRC is an indispensable signaling component for maximal decidualization in mice.
decidua, estradiol, female reproductive tract, kinases, progesterone
INTRODUCTION
Successful pregnancy requires precise coordination between the receptive uterus and the activated state of the blastocyst. Embryo-uterine interactions are followed by stromal cell proliferation and differentiation into decidual cells (decidualization). In rodents, decidualization also can be elicited by application of an artificial stimulus (intraluminal oil infusion) to a pseudopregnant uterus or to one that has been prepared appropriately by exogenous progesterone (P4) and estrogen. The process of decidualization is under the control of these ovarian steroids in the presence of blastocysts or, particularly in rodents, deciduogenic stimuli. Besides the steroids, numerous factors, including growth factors, cytokines, and prostaglandins, have been implicated in human and rodent decidualization [13].
Studies using knockout mice demonstrated that leukemia-inhibitory factor (LIF) and interleukin-11 receptor
chain 1 (IL11RA1) play an essential role for implantation and subsequent decidualization [4, 5]. In addition, inhibitory peptide-mediated knockdown experiments revealed that signal transducer and activator of transcription 3 (STAT3), which acts as a signaling molecule of the JAK (Janus kinase)/STAT pathway downstream of the LIF receptor and IL11RA1 [6, 7], is indispensable for implantation and decidualization [8]. Thus, elucidation of endometrial growth factor/cytokine and their downstream signaling molecules will broaden our understanding of mechanisms underlying decidualization.
Several growth factor/cytokine receptors, including IL11RA1, couple not only with STAT proteins but also with SRC family kinases (SFKs) [9]. A prototype of the SFK, SRC is activated on ligand binding of many cell surface receptors. Activated SRC, in turn, phosphorylates various cellular proteins on tyrosine residues, thereby transmitting the extracellular stimuli to the intracellular signaling [9]. Thus, SRC serves as a critical signaling molecule, playing a pivotal role in a variety of cell functions, such as growth, differentiation, and tumorigenesis [9].
We have reported previously that the kinase activation of SRC is the cellular event tightly associated with in vitro as well as in vivo decidualization of human endometrial stromal cells (ESCs) [10, 11]. To elucidate the role of decidual SRC activation, we attempted to examine whether knockdown of SRC activity by specific SFK inhibitors results in impaired decidualization [12]. However, these inhibitors unexpectedly promoted decidualization together with a paradoxical activation of SRC [12]. Although the enhancement of decidualization by positive modification of SRC activity implicates SRC in decidual transformation, we failed to draw a definite conclusion regarding its essential role [12]. In the present study, to explore the precise role of endometrial SRC, we used wild-type and Src knockout (Src/) mice for induction of decidualization employing a defined steroid hormonal treatment schedule in vivo and in vitro.
MATERIALS AND METHODS
Mice
C57BL/6J, Src heterozygous (Src+/, B6.129S7-Srctm1Sor), male and female mice [13] were purchased from the Jackson Laboratory. They were maintained in our animal care facility at the Keio University School of Medicine in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals. Tail DNA was isolated, and mice were genotyped by PCR analysis as described previously [14]. Primers used for genotyping the endogenous Src allele were SrcF (CAGCAACAAGAGCAAGCCCAAGGACG), NeoS (CAGTCATAGCCGAATAGCCTCTCCACC), and NSrc3 (GGGAGGTGACGGTGTCCGAGGA) [14]. Adult female wild-type mice were bred with fertile males for timed pregnancies. The morning of finding a vaginal plug was considered to be Day 1 of pregnancy.
Treatment Schedules for Decidualization
The protocol for the induction of decidualization (deciduoma) has been described previously [15]. In brief, 11- to 13 wk-old wild-type and Src mutant mice were ovariectomized, and 2 wk later, they were treated with three daily subcutaneous injections of 100 ng of 17ß-estradiol (E2) in 100 µl of sesame oil, followed by 2 days of no treatment. Animals were then given daily subcutaneous injections of 6.7 ng of E2 together with 1 mg of P4 in 100 µl of sesame oil for the reminder of the experiment. Sesame oil (100 µl) was injected into the lumen of the left uterine horn 6 h after the third injections of P4 plus E2. Whole uterus was dissected out and weighed 6 h after the eighth injections of P4 plus E2.
Immunohistochemistry and Histology
Immunohistochemistry of the mouse uteri using clone 28 [16], a mouse monoclonal antibody specifically recognizing the active form of SRC, was performed as described previously [11]. In brief, the deparaffinized sections from formaldehyde-fixed specimens were washed with 50 mM Tris-HCl (pH 7.6) containing 150 mM NaCl, treated with microwaves for 10 min, and washed again. The internal peroxidase activity and nonspecific binding sites were blocked by 0.3% hydrogen peroxide-methanol for 20 min and then blocking buffer (DAKO) for 10 min. Then, the slides were incubated with clone 28 (0.75 µg/ml) for 1 h. As a negative control, mouse control immunoglobulin (Ig) G (Dako Japan) was used at the same concentration as clone 28. After being washed, bound antibody was visualized using biotinylated anti-mouse IgG (Vector Laboratories) and VECTASTAIN Elite ABC KIT (Vector Laboratories) according to the manufacturer's instruction. Next, the samples were incubated with 0.02% 3,3'-diaminobenzidine for 5 min. Nuclei were lightly stained by hematoxylin. Each step except microwave treatment was performed at room temperature. For histological examination, frozen sections (thickness, 6 µm) were stained with hematoxylin-eosin. Images were collected using an inverted Leica DMIRE2 microscope (Leica Microsystems) equipped with a CCD camera (VB-700; Keyence Corp.).
Isolation of ESCs from Mouse Uterus and Treatment with Hormones or Growth Factors
Mouse ESCs were isolated and cultured as described elsewhere [17] with some modifications. Briefly, uteri were removed from 11- to 13-wk-old wild-type and Src mutant mice. Each uterine horn was slit longitudinally to expose the endometrial surface, transferred to the culture dish, rinsed with Dulbecco PBS (Sigma), and minced into small pieces. The uterine pieces were transferred to a disposable, sterile, 50-ml polypropylene tube and incubated in PBS containing 0.25% collagenase (Wako) and 0.3% BSA for 1 h at 37°C in a humidified atmosphere of 5% CO2 in air.
After the enzymatic digestion, the cell suspension was incubated for 5 min at room temperature. Because most of the ESCs were present as single cells or small aggregates but most of the epithelial cells remained in larger clumps, ESCs were separated by differential sedimentation at unit gravity during this step. The supernatant enriched with ESCs was sequentially filtered through 41- and 11-µm nylon meshes to remove undigested tissue. The filtered supernatant was then centrifuged at 1000 rpm for 5 min. The pelleted ESCs were rinsed with Dulbecco modified Eagle medium (DMEM) and gently resuspended in DMEM supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic mixture (Invitrogen/Life Technologies). Viable cells, as determined by the trypan blue exclusion method, were seeded at 1.5 x 105 cells/well in 24-well Matrigel-coated dishes (BD BioCoat Matrigel Cellware; BD Biosciences) and cultivated in a humidified atmosphere of 5% CO2 in air for 1 h at 37°C. After the cells were allowed to attach for 1 h, the unattached cells were gently removed with medium, and ESCs that remained attached were treated with hormones or growth factors. As for hormonal stimulation, ESCs were treated without or with 0.1 nM E2 plus 100 nM P4 (E2+P4) for the indicated time. Culture medium was changed every 2 days. As for growth factor stimulation, ESCs were precultured for 24 h in DMEM supplemented with 1% FBS and then treated without or with 50 ng/ml of platelet-derived growth factor-BB (PDGF-BB; Sigma) or 10 nM (76 ng/ml) of insulin-like growth factor 1 (IGF1; BD Biosciences) for 5 min.
Immunoblotting
Total cell lysates were prepared with radioimmune precipitation assay buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate, 0.1% SDS, 1 mM Na3VO4, 50 mM NaF, and 1 mM Na2MoO4) [11] containing protease inhibitor cocktail (Roche Molecular Biochemicals). The protein concentration was measured using DC protein assay kit (Bio-Rad). Thirty micrograms of the lysates derived from uterine tissues or cultured ESCs were separated on 8% SDS-PAGE and then transferred onto polyvinylidene difluoride membrane (Immobilon P; Millipore). Nonspecific binding sites were blocked in 5% BSA in Tris-buffered saline for 1 h at room temperature. The membranes were incubated with clone 28, clone 327 monoclonal antibody (Calbiochem) reacting with both active and inactive forms of SRC, phospho-p44/42 mitogen-activated protein kinase (MAPK; Thr202/ Tyr204) E10 monoclonal antibody (New England Biolabs) recognizing the phosphorylated form of MAPK3/MAPK1, or anti-MAPK 1/2 antibody (Upstate Biotechnology, Inc.) against MAPK3/MAPK1 for 1 h at room temperature. Blots were washed three times, incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature, and then washed three times. Blots were developed using the ECL Plus detection kit (Amersham Biosciences). When indicated, immunoblots were stripped in the buffer (62.5 mM Tris [pH 6.8], 2% SDS, 100 mM ß-mercaptoethanol) at 50°C for 30 min and then reprobed with clone 327. The intensity of the signals on the immunoblot was quantitated using the NIH Image program (Version 1.62; Research Services Branch, National Institutes of Health).
Semiquantitative RT-PCR
Total RNA was extracted from cell cultures or uterine tissues using TRIzol reagent (Invitrogen/Life Technologies) according to the manufacturer's instructions. Semiquantitative RT-PCR was carried out with 100300 ng of total cellular RNA, on which RT was performed, using the OneStep RT-PCR kit from Qiagen according to the manufacturer's recommendation. After the reaction for 30 min at 50°C, the samples were heated for 15 min at 90°C as the initial PCR activation step. The thermal cycling profiles for progesterone receptor (Pgr), estrogen receptor 1 (Esr1, also known as ER
), estrogen receptor 2 (Esr2, also known as ERß), decidual/trophoblast PRL-related protein (Dtprp) [18], glyceraldehyde 3-phosphate dehydrogenase (Gapd), Src, and prostaglandin-endoperoxide synthase 2 (Ptgs2, also known as Cox2) were as follows: Pgr, 60 sec at 94°C, 60 sec at 58°C, and 90 sec at 72°C for 30 cycles; Esr1, 60 sec at 94°C, 60 sec at 58°C, and 90 sec at 72°C for 30 cycles; Esr2, 60 sec at 94°C, 60 sec at 54°C, and 90 sec at 72°C for 34 cycles; Dtprp, 60 sec at 95°C, 60 sec at 60°C, and 60 sec at 72°C for 24 cycles; Gapd, 60 sec at 95°C, 60 sec at 60°C, and 60 sec at 72°C for 26 cycles; Src, 60 sec at 94°C, 60 sec at 58°C, and 90 sec at 72°C for 32 cycles; Ptgs2, 60 sec at 94°C, 60 sec at 56°C, and 90 sec at 72°C for 21 cycles, followed by 10 min at 72°C as the last primer extension step. Primers used to amplify Pgr, Esr1, Esr2, Dtprp, Gapd, Src, and Ptgs2 were as follows: Pgr, 5'-CTAAATGAGCAGAGGATGAAGGAG-3' and 5'-TGGGCAACTGGGCAGCAATAAC-3'; Esr1, 5'-GGAAAGACCGCCGAGGAG-3' and 5'-CGCCAGACGAGACCAATC-3'; Esr2, 5'-TTACGGTGTCTGGTCCTGTG-3' and 5'-CTGGTTCTCTTGGCTTTGTT-3'; Dtprp, 5'-GCTGCCATTGAGTCAACCTCACTTC-3' and 5'-ATCAACGCGTAGGCAGTGAGAAAGG-3'; Gapd, 5'-TTCACCACCATGGAGAAGGC-3' and 5'-GGCATGGACTGTGGTCATGA-3'; Src, 5'-GGGCAGCAACAAGAGCAAG-3' and 5'-CGGTAGTGAGGCGGTGACA-3' Ptgs2, 5'-TGTACAAGCAGTGGCAAAGG-3' and 5'-GCTGTGGATCTTGCACATTG-3'. Preliminary experiments determined the optimum PCR cycle number within the linear range of amplification for each gene being measured. The PCR products were separated on 3% agarose gel electrophoresis and visualized by ethidium bromide staining.
Statistical Analysis
Data were analyzed by the Wilcoxon rank-sum test or Student t-test. A P value of less than 0.05 was considered to be significant.
RESULTS
Expression and Localization of the Active Form of SRC in the Nonpregnant and Pregnant Mouse Uterus
To elucidate the role of SRC in mouse decidualization, we first examined whether SRC became activated during decidualization in mice, as happens similarly in humans [10, 11]. Figure 1 shows immunohistochemical analyses on the nonpregnant (Fig. 1, AC) and the early pregnant (Fig. 1, DK) uterus using clone 28 (Fig. 1, A, B, DF, H, and J) or control IgG (Fig. 1, C, G, I, and K). In nonpregnant endometrium, the active form of SRC was expressed prominently in the luminal and glandular epithelium, whereas its expression was low to undetectable in the stroma (Fig. 1, A and B), which is consistent with our previous results using human endometrial samples [11]. On Day 5, the high levels of immunostaining with clone 28 persisted in the luminal and glandular epithelium (Fig. 1D). In addition, the subluminal epithelial stroma became positive for active SRC (Fig. 1D). On Days 68, active SRC was strongly detected, primarily in the whole decidua (Fig. 1, E, F, H, and J), in agreement with our previous data regarding human [11]. Also, embryos and the luminal epithelium at the interimplantation site were positive for active SRC (Fig. 1, F and H). All the sections immunostained with nonspecific IgG showed no significant signals (Fig. 1, C, G, I, and K; not all data are shown).
|
Upregulation of the Active Form of SRC in Deciduoma Induced by Mechanical Stimulation
In rodents, decidualization also is elicited by application of an artificial stimulus (intraluminal oil infusion) to the uterus that has been prepared appropriately by exogenous P4 and estrogen [15, 19]. We then employed this artificial decidualization system to examine whether the active form of SRC is upregulated on mechanical stimulation. Figure 2A shows immunoblot staining of the total lysates derived from the oil-infused or noninfused uterus using clone 28 or clone 327. Although clone 28 usually reacts with two bands, we previously identified the upper band (Fig. 2A, arrow), which corresponds to immunoprecipitated or exogenously overexpressed SRC, as the active form of SRC [11]. The active SRC was expressed more prominently in the oil-infused uterus than in the noninfused uterus (Fig. 2A, top), whereas the levels of total SRC detected by clone 327 were almost constant throughout the treatment (Fig. 2A, bottom). Densitometric analyses revealed that the oil-infused uterus showed a significant increase (2.0-fold, P < 0.05) in the immunoblot staining intensity with clone 28 as compared to the noninfused uterus.
|
Defects of Decidual Responses in Src/ Mice
Our present data demonstrating that activation of SRC was the event tightly associated with decidualization in mice prompted us to address the question of whether the decidualization process is impaired in the absence of SRC. We treated ovariectomized wild-type (Src+/+) and Src mutant mice with a low dose of estrogen and a high dose of P4, followed by mechanical stimulation of the left uterine horn of each animal [15]. The unstimulated right uterine horn served as a control. The decidual response, as determined by an increase in uterine horn size, was observed consistently in the stimulated left uterine horn in wild-type and Src+/ mice (Fig. 3, A and B). However, the uterine horn of the Src/ mouse revealed little or no detectable responses on treatment with 1 mg of P4 (Fig. 3, A and B). The weight ratio of the stimulated to the unstimulated horn was approximately 2.8 in Src/ mice but approximately 5.4 and 6.5 in wild-type and Src+/ mice, respectively (Fig. 3B). In addition to the uterine weight changes, histological examinations revealed that enlarged and rounded decidual cells were dominant in the wild-type uterus treated with oil infusion (Fig. 3C). In contrast, decidualization was not observed in the Src/ uterus infused with oil (Fig. 3C). Uterine response to mechanical traumatization (decidual stimulation) is a PGR-dependent process [20]. As shown in Figure 3D, no difference was found in the levels of uterine Pgr mRNA among the wild-type and Src mutant mice. Although ESR1 and ESR2 are not necessarily required for P4-induced decidualization in mice [2022], they are thought to contribute, independently and partially, to the upregulation of PGR [23]. The uteri derived from wild-type and Src mutant mice expressed similar levels of Esr1 and Esr2 mRNA (Fig. 3D). Taken together, our findings suggest that the impairment of decidual response was not attributable to the expression level of these ovarian steroid receptors.
|
Upregulation of the Active Form of SRC During In Vitro Decidualization of Mouse ESCs
To understand better the molecular mechanism underlying the role of SRC in decidualization, we attempted to establish an in vitro model for decidualization of mouse ESCs. Kimura et al. [17] have reported that mouse ESCs exhibit functional and morphological decidualization when cultured for several days in the presence of E2+P4 and proposed in vitro model of decidual transformation. We employed this system, except we used Matrigel-coated dishes instead of noncoated plastic dishes, because ESCs derived from Src/ mice did not sufficiently attach to either noncoated or collagen-coated dishes.
As shown in Figure 4A, ESCs isolated from wild-type and Src+/ mice became enlarged and rounded, resembling decidual cells, when cultured for 10 days in the presence of E2+P4. In contrast, ESCs remained fibroblastic when cultured in the control media for the same duration (Fig. 4A). Immunoblot staining with clone 28 and clone 327 revealed that the active form of SRC was upregulated in decidualized ESCs derived from both wild-type and Src+/ cells (Fig. 4B, top), whereas the expression levels of the total SRC were almost constant (Fig. 4B, bottom).
|
Partial Impairment of In Vitro Decidualization of ESCs Isolated from Src/ Mice
We next examined whether in vitro decidualization process is impaired in the absence of SRC, as found with our present data on decidualization in vivo. As shown in Figure 5A, ESCs from wild-type mice became morphologically decidualized when cultured in the presence of E2+P4 for 5 days. In contrast, ESCs isolated from Src/ mice remained morphologically unchanged when cultured in the presence of E2+P4 for the same duration (Fig. 5A). At this time point, ESCs were harvested and subjected to RT-PCR analyses followed by RNA extraction. Figure 5B shows that decidualizing wild-type ESCs expressed Dtprp mRNA, an established decidualization marker [18], consistent with the previous report [17]. In contrast, treatment with E2+P4 for the same duration did not induce Dtprp mRNA in Src/ ESCs (Fig. 5B). Further prolonged treatment with E2+P4, however, elicited morphological decidualization even in the Src/ ESCs (Fig. 5C). Moreover, the expression of Dtprp mRNA was induced by treatment with E2+P4 for 10 days in Src/ ESCs at the same magnitude as wild-type and Src+/ ESCs (Fig. 5D).
|
Likewise, stimulation with E2+P4 for 5 days induced Ptgs2 mRNA expression, another decidual cell-specific marker gene [20, 24], in wild-type and Src+/ ESCs but not in Src/ ESCs (Fig. 5E). Treatment with E2+P4 for 10 days, however, exerted the induction of Ptgs2 mRNA, even in Src/ ESCs (Fig. 5E). These findings collectively suggest that functional and morphological decidualization occurred in Src/ ESCs in response to prolonged treatment with E2+P4.
Activation of Endometrial SRC by IGF1
A number of cytokines and growth factors, including PDGF and IGF1, activate MAPK via SRC-dependent and/or SRC-independent pathways [9]. To address which growth factors are involved in endometrial SRC activation, we tested whether stimulation of IGF1 and/or PDGF-BB activates SRC and MAPK in wild-type ESCs. Immunoblot analysis using clone 28 and an antibody specific for activated MAPK revealed that IGF1, but not PDGF-BB, induced the active form of SRC, whereas both growth factors activated MAPK (Fig. 6).
|
DISCUSSION
Only one major phenotype of Src/ mice is severe osteopetrosis caused by an intrinsic defect in osteoclasts [13]. In addition, Src/ mice have greatly reduced fertility [14]. We experienced that Src/ mice were unhealthy. Approximately one-third of them died between 36 wk of age, and they continued to die thereafter, as described previously [13, 14]. Amling et al. [25] reported that all Src/ mice died progressively between 2.5 and 6 mo of age by suffocation caused by airway obliteration as a result of progressive odontoma growth. The high rates of morbidity and mortality hamper detailed analysis of SRC functions in various organ systems, including female reproduction, in these mice.
We therefore employed an artificial decidualization system and in vitro culture model, but even mechanical stimuli often caused death of Src/ mice. We first found that the active form of SRC was upregulated during in vivo and in vitro decidualization of wild-type mouse ESCs. We then demonstrated that decidualization did not occur in a timely and proper manner, both in vivo and in vitro, in the absence of SRC. These results collectively indicate an essential role of SRC for maximal decidualization in mice. The severe infertile phenotype of Src/ mice can be rescued completely by reintroduction of SRC [14]. The poor health status of Src/ mice may have adverse effects on their reproductive behaviors, leading to impaired fertility; however, it is unlikely that their unhealthy condition affected artificially induced decidualization per se. Taken together, we postulate that impaired decidualization resulting from the loss of maternal SRC function in stromal cells is one of the causes of female infertility in Src/ mice.
Paria et al. [20] have demonstrated that P4 alone induces decidualization in ovariectomized wild-type or ESR1-deficient mice in response to intraluminal oil infusion in the absence of estrogen. They propose that stromal cell sensitivity to decidualization is critically dependent on P4-regulated events, and estrogenic induction of PGR via classical nuclear ESR1 is not essential for this process [20]. How SRC integrates into P4-induced signaling networks responsible for decidualization remains to be elucidated. Increasing evidence suggests several candidate pathways, including interplay between SRC and P4. For instance, PGR interacts directly with the Src homology 3 domain of SRC and activates it on P4 binding [26]. Another candidate network, v-SRC, a dominant active form of SRC, potentially activates the promoter of Ptsg2, one of the established decidualization markers, via a cAMP-responsive element [27]. In agreement, we have demonstrated in the present study that SRC is, at least in part, required for the induction of Ptsg2 during in vitro decidualization.
The phenotype of the Src/ mice seems to be similar to that of LIF- and IL11RA1-deficient mice in the sense that they all exhibit an impaired decidualization [4, 5]. The receptors for LIF and IL11RA1 induce activation of the STAT family of signal transducers, particularly STAT3, via the JAK/STAT pathway [6, 7]. Consistently, STAT3 has been identified recently as a critical signaling component responsible for implantation and decidualization [8]. In addition to JAK/STAT pathway, STAT3 also can be phosphorylated and, thereby, activated by growth factors via SFK-mediated signaling cascade [28, 29]. Given the role of STAT3 as a downstream signal transducer of SFKs, it is conceivable that SRC deficiency may deteriorate STAT3 function and, thereby, adversely affect the LIF- and/or IL11RA1-mediated signaling cascade in Src/ mice, ultimately leading to the decidualization-impaired phenotype, similar to LIF- or IL11RA1-deficient mice.
In the present study, we demonstrated that activated SRC was expressed constitutively at a high level in the luminal and glandular epithelium of the nonpregnant endometrium and also the early pregnancy decidua. At Days 68 of pregnancy, decidualizing stromal cells highly expressed the active form of SRC. Similarly, phosphorylated STAT3 is expressed prominently in the luminal and/or glandular epithelium on Days 4 and 5 of pregnancy; thereafter, it becomes abundant in decidual cells on Days 68 of pregnancy [30]. Thus, the expression and localization pattern of active STAT3 is similar to that of active SRC as presented herein, substantiating a possible interplay between STAT3 and SRC. Moreover, because decidualization of the stroma is dependent on an intact luminal epithelium [31], activation of endometrial epithelial SRC also may contribute to the process of decidualization, presumably integrating into STAT3-mediated signaling pathway.
In vivo experiments using knockout animals to study such molecular mechanisms of decidual SRC function are limited. Therefore, we attempted in the present study to establish an in vitro model of decidualization, and we demonstrated that mouse ESCs displayed morphological and functional decidualization in vitro together with upregulation of active SRC, similar to what has been observed in humans [10, 11]. In contrast to wild-type ESCs, 5 days of treatment with ovarian steroids did not induce decidualization in Src/ ESCs. Insufficient ability of Src/ ESCs to decidualize may be attributable to the absence of proper SRC-mediated cytokine/growth factor signaling pathways. Also, SRC is known to integrate into the signaling cascades downstream of adhesion molecules, such as integrins [9]. Given the critical role of integrins in decidual transformation [32], an aberrant integrin-mediated signaling also may cause impairment of decidualization. Indeed, we found that Src/ ESCs did not attach sufficiently to either noncoated or collagen-coated dishes but could adhere to Matrigel-coated plates, indicating that the Src/ ESCs lacked normal adhesive potentials. Despite such possible defects of Src/ ESCs, they became maximally decidualized on prolonged treatment for 10 days.
At present, we do not have data accounting for the mechanism by which in vitro decidualization of Src/ ESCs caught up with that of wild-type ESCs. One possibility is that prolonged treatment with ovarian steroids activates a different signaling pathway responsible for decidualization. For instance, other SFKs, such as FYN and YES, may compensate for SRC. In humans, FYN was not activated during in vitro decidualization [10, 11], but SFKs are redundant in mice. Therefore, Src/ mice exhibit only one major phenotype, osteopetrosis, as the result of compensation for SRC function by other SFKs [9, 33].
Our data seem to be discrepant in that in vivo decidual responses following mechanical stimuli were abolished completely in Src/ mice but in vitro decidualization was impaired only partially in Src/ ESCs. It is reasonable to assume that our in vitro model did not mimic precisely the in vivo phenomenon of decidualization. Indeed, the mechanism by which treatment with E2+P4 alone can induce in vitro decidualization of mouse ESCs remains to be clarified, given that (pre)decidualization, unlike in humans, is not observed in nonpregnant mature female mice in any estrous cycle or treated with E2+P4 followed by ovariectomy. As discussed elsewhere [17], isolation procedures, including dissection and dispersion, may be potent mechanical stimuli, which may correspond to in vivo deciduogenic stimuli, to induce decidualization in vitro. Such isolation and culture condition may change the character of the mouse ESCs dramatically, predisposing them to respond to ovarian steroids and eventually leading to maximal decidualization overcoming the loss of SRC function.
Numerous factors, including growth factors, cytokines, homeotic genes, adhesion molecules, and prostaglandins, have been implicated in implantation and subsequent decidualization processes [3]. Paria et al. [34] have demonstrated, by introducing beads loaded with purified growth factors into the receptive uterus, that heparin-binding epidermal growth factor-like growth factor (HBEGF)- and IGF1-loaded beads can induce many of the local changes in the uterus normally elicited by a living embryo, suggesting that these growth factors are key molecules that trigger and/or maintain implantation and decidualization processes. The SRC is a nonreceptor tyrosine kinase that couples with various growth factor receptors, including IGF receptors [9]. These transmembrane receptors recruit and activate SRC on ligand binding [9]. In agreement with the previous results, we demonstrated in the present study that endometrial SRC was activated by IGF1 but not PDGF, substantiating the idea that SRC may be involved preferentially in IGF1-mediated signaling pathways during implantation and decidualization. Recently, Razandi et al. [35] have reported that SRC-dependent stimulation of matrix metalloproteinase activity in response to E2 releases HBEGF and, thereby, leads to EGF-receptor transactivation [35], suggesting an alternative possibility that a similar interplay among SRC, HBEGF, and ovarian steroids may take place during implantation and decidualization.
In conclusion, in vivo and in vitro decidualization processes were impaired in the absence of SRC, implicating SRC as an indispensable signaling component for maximal decidualization in mice. Our present results provide a clue for elucidation of novel signaling pathways responsible for decidualization and also demonstrate the potential of the SRC-deficient mouse as a useful animal model to study the molecular mechanism underlying decidualization.
ACKNOWLEDGMENTS
We thank Pamela L. Schwartzberg and Ana Venegas for their advice on the genotyping of Src mutant mice, Koji Owada for the generous gift of clone 28, and Nao Suzuki for technical advice on in vivo decidualization. We also thank all the members of our laboratory for their technical assistance, advice, critique, and encouragement.
FOOTNOTES
1 Supported, in part, by Grant-in-Aids for Young Scientists (13770938 to A.S.) and for Scientific Research (B15390511 to T.M. and B12470348 to Y.Y.) from the Japan Society for the Promotion of Science, by Keio Gijuku Academic Development Funds (to T.M.), and by grants from the Keio Health Counseling Center (to T.M.). Presented in part at the 11th World Congress of Gynecological Endocrinology, Florence, Italy, September 2730, 2004, and at the ENDO 2005 meeting, San Diego, CA, June 47, 2005. ![]()
2 Correspondence: Tetsuo Maruyama, Department of Obstetrics and Gynecology, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. FAX: 81 3 3226 1667; tetsuo{at}sc.itc.keio.ac.jp ![]()
Received: 7 March 2005.
First decision: 4 April 2005.
Accepted: 15 August 2005.
REFERENCES
-deficient mice. Endocrinology 1999 140:2704-2710
knockout mouse uterus. Proc Natl Acad Sci U S A 1999 96:3646-3651
knockout mouse. Biol Reprod 2001 64:272-283This article has been cited by other articles:
![]() |
T. Nagashima, T. Maruyama, H. Uchida, T. Kajitani, T. Arase, M. Ono, H. Oda, M. Kagami, H. Masuda, S. Nishikawa, et al. Activation of SRC Kinase and Phosphorylation of Signal Transducer and Activator of Transcription-5 Are Required for Decidual Transformation of Human Endometrial Stromal Cells Endocrinology, March 1, 2008; 149(3): 1227 - 1234. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ihnatovych, W. Hu, J. L. Martin, A. T. Fazleabas, P. de Lanerolle, and Z. Strakova Increased Phosphorylation of Myosin Light Chain Prevents in Vitro Decidualization Endocrinology, July 1, 2007; 148(7): 3176 - 3184. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |