Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print August 24, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.045153
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/6/1294    most recent
biolreprod.105.045153v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.
Agricola
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.
BIOLOGY OF REPRODUCTION 73, 1294–1301 (2005)
DOI: 10.1095/biolreprod.105.045153
© 2005 by the Society for the Study of Reproduction, Inc.


Research Article

Steroid Regulation of Cell Specific Secreted Phosphoprotein 1 (Osteopontin) Expression in the Pregnant Porcine Uterus1

Frankie J. White 3, Jason W. Ross 4, Margaret M. Joyce 3, Rodney D. Geisert 4, Robert C. Burghardt 3, and Greg A. Johnson 2 3

Department of Veterinary Integrative Biosciences,3 Texas A&M University, College Station Texas 77843 Department of Animal Science,4 Oklahoma State University, Stillwater, Oklahoma 74078

ABSTRACT

Secreted phosphoprotein 1 (SPP1, commonly referred to as osteopontin and formerly known as bone sialoprotein 1, early T-lymphocyte activation 1) is an extracellular matrix/adhesion molecule that is upregulated in the pregnant uterus of all mammals examined to date. This study focused on the pig, which has true epitheliochorial placentation and exhibits induction of SPP1 mRNA in luminal epithelium (LE) just before conceptus attachment and in glandular epithelium (GE) after Day 30 of pregnancy. The objective of this study was to determine steroid regulation of SPP1 mRNA and protein in porcine uterine epithelium. To examine the effect of estrogen, cyclic gilts were treated daily (Days 11–14) with 5 mg estradiol benzoate (i.m.) and hysterectomized on Day 15. To evaluate the long-term effect of pseudopregnancy, cyclic gilts were given daily injections (Days 11–15) with steroid as above and hysterectomized on Day 90. In situ hybridization showed high expression of SPP1 mRNA only in LE contiguous with apposing conceptus tissue on Day 15 of pregnancy. In contrast, estrogen injection resulted in moderate but uniform SPP1 mRNA in all LE of Day 15 nonpregnant gilts, with expression maintained through Day 90 of pseudopregnancy. SPP1 mRNA also localized to the GE of Day 90 pseudopregnant gilts, similar to expression in late gestation. Consistent with in situ hybridization results, SPP1 protein localized to the apical surface of LE in all estrogen-treated gilts and in the GE on Day 90 of pseudopregnancy. We conclude that, in pregnant pigs, SPP1 is induced by conceptus estrogen in uterine LE and is regulated in GE in a manner coincident with CL/placental progesterone production.

conceptus, gene regulation, pregnancy, steroid hormones, uterus

INTRODUCTION

Secreted phosphoprotein 1 (SPP1, commonly referred to as osteopontin and formerly known as bone sialoprotein 1, early T-lymphocyte activation 1) is an extracellular matrix (ECM) protein and integrin ligand that is abundantly expressed within the conceptus-maternal environment of pregnancy in numerous species. A member of the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of genetically related proteins that contain an Arg-Gly-Asp (RGD) binding site [1], SPP1 is entirely flexible in solution, a characteristic of proteins that have multiple binding partners [2]. Indeed, through the RGD and other binding sites, SPP1 interacts with several factors, including integrins, CD44, and complement factor H, as well as transglutaminase-mediated cross linking with itself to modify cell-cell and cell-matrix adhesion, and cell signaling, migration, survival, and proliferation [3–7]. Significantly, SPP1 undergoes extensive posttranslational modification resulting in multiple forms, which separately have immune, adhesion, migration, and proliferation functions [8, 9]. In addition, SPP1 binds to and alters the activity of matrix metalloproteinase3 (MMP3), an enzyme extensively involved in tissue remodeling [10]. Collectively, these properties allow SPP1 to influence a diverse array of physiological processes, including bone mineralization, cancer metastasis, cell-mediated immune responses, inflammation, and angiogenesis. Because the critical events of implantation and placentation involve extensive tissue remodeling at the maternal-fetal interface characterized by elements of inflammation, angiogenesis, and cell proliferation/migration/attachment/survival, SPP1 is of interest as a mediator of successful pregnancy.

Recent studies strongly suggest that SPP1 is a critical component of pregnancy [9], and significant increases in uterine expression have been observed in pigs, sheep, goats, rabbits, rats, mice, and humans [11–18]. Multiple integrin receptors for SPP1 are present on trophectoderm and luminal epithelium (LE) of humans, rodents, and domestic animals, some of which increase during the peri-implantation period [19–21]. Ovine and porcine trophectoderm and LE cells show evidence of integrin-receptor activation and cytoskeletal reorganization in response to SPP1 binding in vitro [13, 22]. Significantly, disruption of the Spp1 gene in mice decreases the number of pregnancies that are maintained through midgestation, and Spp1 null embryos are significantly smaller than wild-type counterparts at term [23]. Finally, localization of the SPP1 gene within the 95% confidence interval of putative quantitative trait loci for litter size and prenatal survival (correlated to birth weight) suggests roles for SPP1 in porcine pregnancy [24].

Previous work has defined the temporal and spatial expression of SPP1 mRNA and protein during pregnancy in the pig uterus. Total endometrial SPP1 mRNA increases 20-fold between Days 25 and 85 of pregnancy [13]. In contrast with humans and sheep, pigs express the SPP1 gene directly in the LE beginning on Day 12, whereas SPP1 mRNA is not induced in the glandular epithelium (GE) until between Days 30 and 35 of pregnancy [13, 25, 26]. Expression is then maintained in both LE and GE throughout gestation, resulting in SPP1 protein along the entire maternal and fetal components of the true epitheliochorial placenta [13]. Therefore, it is plausible that SPP1 released from LE binds integrin receptors on trophectoderm and LE to mediate elongation and attachment for implantation, and SPP1 secreted from GE is transported as histotroph to the fetal-placental unit to support development throughout gestation. Indeed, SPP1 protein at the maternal-fetal interface has the potential to affect attachment and communication between these tissues because in vitro incubation of SPP1-coated beads with porcine trophectoderm and LE cells results in RGD-dependent integrin activation and transmembrane assembly of cytoskeletal molecules at the apical cell surface, known as focal adhesions, in both cell types [13].

The pattern of uterine SPP1 gene expression in LE and GE suggests complex regulation in pigs. While the temporal and spatial pattern of SPP1 mRNA and protein expression in the uterus of the pig has been established, the hormonal regulation of this molecule in LE and GE remains to be defined. Induction of SPP1 in GE appears similar to that observed in sheep and humans in response to progesterone; however, this induction is delayed to Day 35 of pregnancy in the pig [13]. Further, SPP1 mRNA expression is induced immediately preceding attachment in Day 12 pregnant LE when conceptuses secrete estrogen, the pregnancy-recognition signal in the pig, and other growth factors, which suggests direct conceptus influence that is not evident in other mammals [13]. Therefore, we hypothesized that conceptus trophectoderm secretes a factor (steroid or protein) that induces expression of the SPP1 gene in LE and that long-term progesterone release from the corpora lutea supports induction of SPP1 from GE. The present studies used estrogen-treated nonpregnant pigs (i.e., pseudopregnant animals) to determine the hormonal regulation of uterine SPP1 and evaluated the contribution of the conceptus and corpus luteum to SPP1 expression. The results described are critical to understanding the role(s) of SPP1 in uterine physiology and may offer insight into development of SPP1-based strategies to enhance or regulate fertility in domestic animals and humans.

MATERIALS AND METHODS

Animals and Tissue Collection

All experimental and surgical procedures complied with the Guide for Care and Use of Agriculture Animals and were approved by the Institutional Agricultural Animal Care and Use Committee of Texas A&M University.

Effects of steroids and the conceptus on uterine SPP1 mRNA and protein expression in the pig were determined using a previously validated pseudopregnancy model [27]. Sexually mature crossbred gilts were observed daily for estrous behavior through direct exposure to intact boars. Gilts exhibiting at least two estrous cycles of normal duration (18–21 days) were randomly assigned on Day 0 (estrus/mating) to pseudopregnant or pregnant status. Gilts for pseudopregnancy received i.m. injections of estradiol benzoate (5 mg in 5 ml of corn oil/day) or corn oil alone (n = 4/treatment) on Days 11, 12, 13, and 14 of the estrous cycle. Gilts for pregnancy (n = 4) were mated to crossbred boars. All gilts were then ovariohysterectomized on Day 15 of pseudopregnancy or pregnancy. Pregnancy was confirmed by the presence of normal-appearing conceptuses in uterine flushings.

To evaluate the effects of long-term pseudopregnancy on uterine SPP1 mRNA and protein expression during late gestation, cycling gilts were randomly assigned on Day 0 (estrus/mating) to pseudopregnant or pregnant status. Long-term pseudopregnancy was induced in gilts (n = 3) through i.m. injections of estradiol benzoate (5 mg in 5 ml of corn oil/day) on Days 11, 12, 13, 14, and 15 of the estrous cycle. Gilts (n = 3) were mated to crossbred boars to establish pregnancy. Gilts were ovariohysterectomized on Day 90 of pseudopregnancy or pregnancy.

At hysterectomy, several sections (~0.5 cm) from the middle of each uterine horn were fixed in fresh 4% paraformaldehyde in PBS (pH 7.2) and embedded in Paraplast-Plus (Oxford Laboratory, St. Louis, MO). Several sections from each uterine horn were also embedded in Tissue-Tek Optimal Cutting Temperature (OCT) Compound (Miles, Oneonta, NY), snap frozen in liquid nitrogen, and stored at –80°C before sectioning. The remaining endometrium was physically dissected from the myometrium, frozen in liquid nitrogen, and stored at –80°C for RNA extraction.

Real Time Reverse Transcription-Polymerase Chain Reaction Analysis

Total cellular RNA was isolated from frozen endometrium using Trizol reagent (Invitrogen, Carlsbad, CA). Concentrations of SPP1 mRNA in endometrium were determined by real-time reverse transcription-polymerase chain reaction (RT-PCR). Primers were created from the porcine SPP1 sequence (GenBank accession number = x16575) [28]. Reactions contained 20 µl of the following reagents: 0.4 µl of probe from a 10 µM solution (sequence: TGGAAACCCGCAGCCAGGAGCAGTCCAAA; bp 786–814), 0.8 µl of both forward and reverse primers from 10 µM solutions (forward sequence: TTGGACAGCCAAGAGAAGGACAGT, bp 731–754; reverse sequence: GCTCATTGCTCCCATCATAGGTCTTG, bp 827–851), 10.0 µl of RT-PCR master mix (Qiagen), 0.2 µl of reverse transcriptase mix (Qiagen), and 2.8 µl of RNase-free water (Qiagen). Reactions also included 5 µl (25 ng/µl) of total RNA. The probe contained a 5' reporter dye (FAM) and 3' quenching dye (TAMRA) that allowed amplification of RNA to be evaluated on an ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). The reaction conditions consisted of 1 cycle to reverse transcribe RNA (50°C for 30 min, then 95°C for 15 min) followed by 45 cycles to amplify cDNA (94°C for 15 sec, then 60°C for 60 sec). Appropriate controls were conducted to ensure genomic DNA did not influence the amplification of the template. Following amplification, the RT-PCR product was analyzed on a 2% wt/vol agarose gel to further validate size (121 bp). The relative concentration of SPP1 mRNA was determined in duplicate samples via the comparative CT method as previously described [29] with 18S RNA as the normalization control (18S rRNA Control kit; Eurogentec, San Diego, CA). Data were analyzed by assigning an arbitrary threshold cycle (CT) to amplification plots, where the CT for a sample was the cycle that its amplification plot crossed the threshold. The CT was assigned in the log-linear range of amplification. The SPP1 {Delta}CT was determined by subtracting the 18S CT from the SPP1 CT for each sample assayed. Calculation of the {Delta}{Delta}CT involved using the highest {Delta}CT value as an arbitrary constant to subtract from all other {Delta}CT sample values. Fold-changes in gene expression are equivalent to 2{Delta}{Delta}CT.

In Situ Hybridization Analysis

SPP1 mRNA was localized in paraffin-embedded porcine uterine tissue by in situ hybridization using methods previously described [30]. Briefly, deparaffinized, rehydrated, and deproteinated uterine cross-sections (~5 µm) were hybridized with radiolabeled antisense or sense porcine SPP1 cRNA probes [31] synthesized by in vitro transcription with [{alpha}-35S]uridine 5-triphosphate (PerkinElmer Life Sciences, Wellesley, MA). After hybridization, washes, and RNase A digestion, autoradiography was performed using NTB-2 liquid photographic emulsion (Eastman Kodak, Rochester, NY). Slides were exposed at 4°C for 5 days, developed in Kodak D-19 developer, counterstained with Harris modified hematoxylin (Fisher Scientific, Fairlawn, NJ), dehydrated, and protected with cover slips.

Immunofluorescence Analysis

SPP1 protein was localized in frozen uterine cross sections (~8–10 µm) by immunofluorescence staining as previously described [32]. Briefly, tissues were fixed in –20°C methanol, washed in PBS containing 0.3% vol/vol Tween 20 in PBS, blocked in 10% vol/vol normal goat serum, and incubated overnight at 4°C with 2 µg/ml of a cocktail of rabbit anti-human recombinant osteopontin (LF-123 and LF-124) [33] or rabbit IgG (negative control). Tissue-bound primary antibody was then detected with fluorescein-conjugated goat anti-rabbit IgG (Chemicon International, Temecula, CA). Slides were overlaid with Prolong antifade mounting reagent (Molecular Probes, Eugene, OR) and a cover glass.

Photomicrography

Digital photomicrographs of in situ hybridization (autoradiographic film overviews, as well as representative bright-field and dark-field images of liquid emulsion autoradiography) and immunofluorescence staining were evaluated using an Axioplan 2 microscope (Carl Zeiss, Thornwood, NY) interfaced with an Axioplan HR digital camera and Axiovision 3.0 software. Photographic plates were assembled using Adobe Photoshop (version 6.0, Adobe Systems Inc., San Jose, CA).

Statistical Analysis

Changes in concentrations of SPP1 mRNA were quantified by evaluating effects of reproductive status (Day 15 cyclic treated with corn oil, Day 15 cyclic treated with estrogen, Day 15 pregnant, Day 90 pseudopregnant, and Day 90 pregnant) on the {Delta}CT from real-time RT-PCR. Changes in SPP1 mRNA were analyzed in a randomized block design using a mixed model procedure (Proc Mixed procedure; SAS Inst. Inc., Cary, NC), and reproductive status was included in the model as a fixed effect. Significant treatment effects were separated using a Student t-test with the PDIFF procedure of SAS (SAS Inst. Inc.).

RESULTS

Expression of SPP1 mRNA in Total Endometrium

The experimental design used estrogen-treated nonpregnant pigs to gain insight into the hormonal regulation and conceptus contribution to uterine SPP1 expression. Expression of SPP1 was minimal in corn oil-treated Day 15 cyclic gilts, and this expression was set as the baseline for comparing fold differences reported in Table 1. Expression of SPP1 mRNA was upregulated during pregnancy. Day 15 pregnant gilts showed a tendency for a 2-fold increase of SPP1 mRNA over Day 15 cyclic gilts (P = 0.06), and SPP1 mRNA increased over 350-fold between Days 15 and 90 of gestation (P < 0.001). Furthermore, as compared with Day 15 of the estrous cycle, i.m. injections of estrogen increased expression of SPP1 mRNA by 8-fold on Day 15 and by 280-fold by Day 90 of pseudopregnancy (P < 0.001). Estrogen-treated cyclic gilts had 4-fold more SPP1 mRNA than on Day 15 of pregnancy (P < 0.001), whereas endometrial SPP1 mRNA was 2.5 times greater on Day 90 of pregnancy compared with Day 90 of pseudopregnancy (P < 0.001).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Quantitative RT-PCR analysis of SPP1 mRNA expression in total uterine endometrium

Localization of SPP1 mRNA Within Endometrial Epithelium

Differences in SPP1 expression detected with real-time RT-PCR for Day 15 cyclic, pregnant, and estrogen-treated gilts were further elucidated by localizing SPP1 mRNA in the endometrium using in situ hybridization. Increased SPP1 associated with Day 15 of pregnancy or estrogen treatment was the result of SPP1 mRNA expression in endometrial LE. A strong hybridization signal for SPP1 mRNA was observed in LE in close proximity to conceptus trophectoderm, but was barely detectable or absent in LE without adjacent conceptus tissue on Day 15 of pregnancy (Fig. 1). In contrast, i.m. injection of estrogen resulted in uniform, albeit moderate, SPP1 mRNA hybridization within the entire LE of Day 15 cyclic gilts (Fig. 1). SPP1 mRNA was not present in gilts given exogenous corn oil in place of estrogen (Fig. 1).


Figure 1
View larger version (74K):
[in this window]
[in a new window]
 
FIG. 1. In situ hybridization analysis of SPP1 mRNA in cross -sections of porcine uterus. A) Representative autoradiographic images (Biomax-MR; Kodak) showing entire cross sections of the uterine wall from Day (D) 15 pregnant (P) and Day 15 cyclic (C) pigs treated with estrogen (E2) or corn oil (CO) are shown. Width of each field, 20 mm. B) Corresponding bright- and dark-field images from the same sectioned uteri shown above. Note the concentrated localization of SPP1 mRNA to LE in apposition to conceptus, but the more modest and uniform LE distribution of SPP1 mRNA in response to systemic estrogen. A representative section from Day 15 of pregnancy hybridized with radiolabeled sense cRNA probe (Sense) serves as a negative control. LE, luminal epithelium; Tr, trophectoderm; GE, glandular epithelium; ST, stroma. Width of each field, 870 µm

The estrogen-induced expression of SPP1 was sustained in the LE through Day 90 of pseudopregnancy (Fig. 2). SPP1 mRNA was also localized to the GE of Day 90 pregnant and pseudopregnant gilts (Fig. 2). Therefore, the spatial distribution of SPP1 mRNA in the endometrium of late pseudopregnant gilts was similar to that observed during late gestation of pregnant animals [13]. The significantly less SPP1 mRNA in endometrium of Day 90 pseudopregnant compared with Day 90 pregnant gilts detected with quantitative RT-PCR is likely due to underdevelopment of endometrial glands associated with pseudopregnancy (Fig. 2). In addition, a previously unreported population of cells distributed within the placenta were observed to express SPP1 mRNA on Day 90 of pregnancy. Similar SPP1-producing cells have been detected in the placenta of sheep and are hypothesized to be of immune cell origin [9].


Figure 2
View larger version (166K):
[in this window]
[in a new window]
 
FIG. 2. In situ hybridization analysis of SPP1 mRNA in cross sections of porcine uteri collected from Day (D) 90 pregnant (P) and pseudopregnant (PsP) gilts. Corresponding bright- and dark-field images of representative cross sections of Day 90 pseudopregnant and Day 90 pregnant endometrium are shown. Refer to Figure 1 for an example of representative negative control (Sense). Note that the pattern of SPP1 mRNA expression in the endometrial epithelium of pseudopregnant gilts is similar to that for pregnancy. Contrary to a previous report, SPP1 mRNA was detected in the porcine placenta [13]. LE, luminal epithelium; ST, maternal stroma, GE, glandular epithelium. Width of each field, 870 µm

Localization of SPP1 Protein Within Endometrial Epithelium

Consistent with in situ hybridization results, low levels of immunoreactive SPP1 protein were localized to the apical LE surface of estrogen- but not corn oil-treated Day 15 cyclic gilts (Fig. 3). SPP1 protein continued to be detectable on the LE of Day 90 pseudopregnant gilts (Fig. 4). Similar to in situ hybridization results, immunoreactive SPP1 protein was also present in the endometrial GE of late pseudopregnancy (Fig. 4).


Figure 3
View larger version (71K):
[in this window]
[in a new window]
 
FIG. 3. Immunofluorescence localization of SPP1 protein in frozen sections of endometrium from estrogen- and corn oil-treated Day 15 cyclic gilts. Tissues were immunostained using a cocktail of polyclonal rabbit anti-human osteopontin IgG (LF-123 + LF-124) [31]. SPP1 was present on the apical surface of LE from estrogen- but not corn oil-treated gilts. Normal rabbit serum (NRS) serves as a negative control. Width of each field is 540 µm


Figure 4
View larger version (74K):
[in this window]
[in a new window]
 
FIG. 4. Immunofluorescence localization of SPP1 protein in frozen sections of endometrium from Day 90 pseudopregnant gilts. Tissues were immunostained using a cocktail of polyclonal rabbit anti-human osteopontin IgG (LF-123 + LF-124) [31]. Note that SPP1 was present on the apical surface of LE and in GE. Normal rabbit serum (NRS) serves as a negative control. Width of each field is 540 µm

DISCUSSION

There is substantial correlative evidence to support the hypothesis that SPP1 (commonly referred to as osteopontin) has functions in implantation and placentation of mammalian species. However, the temporal and spatial pattern of SPP1 mRNA and protein expression is complex and species specific. The regulation of uterine SPP1 expression reflects this complexity and differs across species with different types of placentation. These differences may offer key insights into the variation that has evolved in placentation among mammalian species [34, 35].

Results reported here extend our understanding of the function and regulation of SPP1 in the endometrium of a species with true epitheliochorial placentation. They provide strong evidence that estrogen, secreted by the elongating pig conceptus during pregnancy recognition, either directly or indirectly induces expression of SPP1 in adjacent endometrial LE during the apposition phase of implantation. Additionally, these results are consistent with the idea that progesterone, the hormone of pregnancy, supports SPP1 expression in the endometrial GE that is associated with increasing production of histotroph required for fetal/placental development and growth.

Garlow et al. [13] previously noted an association between the initiation of SPP1 mRNA and protein expression in uterine LE coinciding with conceptus elongation, pregnancy recognition, and early attachment to the uterine wall for implantation and suggested that a paracrine factor from the conceptus may be responsible for this expression event. In the pig, the conceptus secretes estrogen beginning on Days 11 and 12 to signal initiation of pregnancy to the uterus and prevent luteolysis of corpora lutea, as well as to activate a number of endometrial growth factors and cytokine mediators of conceptus attachment and implantation [36]. In addition to estrogen, the elongating conceptus secretes a wide array of growth factors and cytokines, including interleukin-1ß, prostaglandin E, Type I and II interferons, and transforming growth factors-ß1, 2, and 3 that have been implicated in controlling implantation and early pregnancy events [37]. The current study reveals that estrogen regulates SPP1 expression in LE. It is not known whether estrogen acts directly on LE to induce SPP1 or whether it acts indirectly through another uterine factor(s). A direct effect cannot be ruled out because the rat and mouse Spp1 promoters have an SF1 response element (SFRE) that is activated by estrogen receptor alpha [38]. The pig SPP1 promoter has a Sp1 binding sequence and AP1 site [39], and estrogen receptor alpha is located within LE that also expresses SPP1 [40].

The restriction of SPP1 mRNA to LE near the conceptus of Day 15 pregnant gilts is likely due to sulfatase activity of trophectoderm. During pregnancy, pig endometrium rapidly converts estradiol to the biologically inactive estrone sulfate, and concentrations of estrone sulfate are high within the uterine lumen of pregnant pigs [41–43]. Trophectoderm has sulfatase activity that restores the biological activity of estrogen, allowing for a localized effect of estrogen to induce SPP1 mRNA in LE of pregnant gilts. However, systemic estrogen is not affected by sulfatase activity within the uterine lumen and therefore has a more uniform action on the uterus causing expression of SPP1 throughout the entire LE of estrogen treated cyclic gilts. It is intriguing that SPP1 continues to be expressed in the LE of pseudopregnant pigs through Day 90, even though injections of estrogen were not given after Day 15. Either the conceptus release of estrogen during the peri-implantation period is sufficient alone or other factors are necessary to maintain SPP1 expression in LE throughout gestation.

Earlier work in the pigs identified SPP1 expression by GE after Day 30 of pregnancy with a marked increase between Days 40 and 85 [13]. The current study reveals that SPP1 is present in the GE of Day 90 pseudopregnant pigs, suggesting that maintenance of corpus luteum progesterone secretion may, at least in part, be responsible for induction of SPP1 in GE. These results are not surprising because progesterone also regulates GE expression of SPP1 in sheep and rabbits [15, 44], as well as SPP1 synthesis by human Ishikawa cells [26]. However, other hormones, such as prolactin, placental lactogen, and growth hormone, may work in conjunction with progesterone to regulate GE expression of SPP1. Ovariectomized ewes treated with progesterone and placental lactogen exhibit increased GE development and SPP1 mRNA expression over ovarictomized ewes treated with progesterone alone [45]. It should be noted that effects of prolactin on SPP1 expression in pseudopregnant pigs cannot be ruled out because pseudopregnant pigs and pregnant pigs have similar concentrations of prolactin [46]. It is not known why SPP1 increases in the GE of pigs at significantly later stages of pregnancy than is observed for sheep and rabbits. Similar to SPP1, other constituents of histotroph in pigs, including uteroferrin and keratinocyte growth factor, are expressed in GE, with synthesis increasing after Day 35 of pregnancy [47–49]. Histotroph supplies nutrients to the conceptus, which may be essential in pigs that have greater separation of maternal and fetal blood supplies than species with more invasive placentation [47, 50, 51]. Indeed, the pig placenta is unique in the formation of chorionic structures, termed areolae, around the mouth of uterine glands for the uptake of these uterine secretions after Day 30 of pregnancy. Histotroph secretions increase after Day 30 of pregnancy in the pig and are regulated predominately by progesterone [52].

Although significant progress has been made toward deciphering the mechanism(s) through which progesterone influences uterine GE development, these processes are poorly understood in pigs. In sheep, it is known that GE upregulation of SPP1 coincides with the progesterone-induced downregulation of progesterone receptor (PR) after Days 11 and 12 of pregnancy [44]. Further, maximal SPP1 mRNA expression in GE is attained after sequential exposure to interferon-{tau}, progesterone, and placental lactogen in what has been termed a servomechanism [45]. In pigs, however, induction of SPP1 in GE is delayed over 20 days after the initial downregulation of PR, and a similar servomechanism has not been defined [13]. The idea that progesterone regulates SPP1 by downregulating its own receptor in GE cannot be ruled out because the amount of total PR mRNA in the uteri of pregnant pigs decreases between Days 30 and 45 of pregnancy, although the uterine cell-specific expression of PR during this time is not known [48]. Clearly, it is important that future studies determine the physiological, cellular, and molecular interactions between cell types within the uterine endometrium responsible for the delay in histotroph production by GE, including SPP1, until after Day 30 of pregnancy in the pig. SPP1 in the pig offers an excellent model to study these mechanisms because of its regulated and prominent GE expression in a species that depends significantly on histotroph throughout pregnancy.

In situ hybridization for SPP1 in uterine/placental cross sections from Day 90 pregnant pigs showed intense hybridization in a population of unidentified cells within the placenta. Surprisingly, these cells were not observed in a previous study [13], and it has been erroneously reported that, although SPP1-producing immune cells are present in the ovine placenta, SPP1 mRNA is not present in porcine placental tissues [9]. In this earlier publication, it was hypothesized that SPP1 was expressed by placental immune cells in sheep [9, 53]. Therefore, it is possible that SPP1 is a product of placental immune cells of both sheep and pigs, and by inference, this may also be the case in other species.

Collectively, these results strongly support the idea that conceptus estrogen induces SPP1 mRNA in endometrial LE during the peri-implantation period, resulting in SPP1 protein at the apical surface of the maternal/fetal interface. SPP1 protein can then cross-link with itself and other molecules potentially influencing conceptus trophectoderm and uterine LE adhesion, signal transduction, cell migration, and tissue remodeling, as well as alter immune cell migration and function at implantation sites. In addition, progesterone may regulate expression of SPP1 in GE after the peri-implantation period, and uterine secretions, including SPP1, provide nutrients to sustain conceptus survival and growth. It is becoming increasingly clear that, despite species differences in steroid regulation of cell-specific SPP1 mRNA, the presence of SPP1 protein at the conceptus-maternal interface is maintained throughout pregnancy and is observed in multiple mammalian species regardless of placental structure. This striking conservation across various forms of placentation suggests that SPP1 provides functions during pregnancy that have withstood the remarkable evolutionary selection that is a hallmark of mammalian pregnancy and placentation.

ACKNOWLEDGMENTS

The authors thank Dr. Larry W. Fisher of the National Institutes of Health for rabbit polyclonal LF-123 and LF-124 to recombinant human osteopontin; Dr. Jaro Sodek of the MRC Group in Periodontal Physiology and the Department of Biochemistry, University of Toronto, for the porcine SPP1 cDNA; and Mr. Kenton D. Lilie of the Texas Agricultural Experiment Station, Animal Science Department, Texas A&M University, for care and management of pigs.

FOOTNOTES

1 Supported in part by National Institutes of Health Grant P30ES0910607. A portion of this work was supported by the National Research Initiative Competitive grant 2002–35203–12262 from the USDA Cooperative State Research, Education, and Extension Service to R.D.G. Back

2 Correspondence: FAX: 979 847 8791; gjohnson{at}cvm.tamu.edu Back

Received: 1 July 2005.

First decision: 13 July 2005.

Accepted: 23 August 2005.

REFERENCES

  1. Fisher LW, Fedarko NS, Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res 2003 44:(suppl 1)33-40[Medline]
  2. Fisher LW, Torchia DA, Fohr B, Young MF, Fedarko NS, Flexible structures of SIBLING proteins, bone sialoprotein, and osteopontin. Biochem Biophys Res Commun 2001 280:460-465[CrossRef][Medline]
  3. Ruoslahti E, Pierschbacher MD, New perspectives in cell adhesion: RGD and integrins. Science 1987 238:491-497[Abstract/Free Full Text]
  4. Ross FP, Chappel J, Alvarez JI, Sander D, Butler WT, Farach-Carson MC, Mintz KA, Robey PG, Teitelbaum SL, Cheresh DA, Interactions between the bone matrix proteins osteopontin and bone sialoprotein and the osteoclast integrin alpha v beta 3 potentiate bone resorption. J Biol Chem 1993 268:9901-9907[Abstract/Free Full Text]
  5. Bautista DS, Xuan JW, Hota C, Chambers AF, Harris JF, A monoclonal antibody against osteopontin inhibits RGD-mediated cell adhesion to osteopontin. Ann N Y Acad Sci 1995 760:309-311[Medline]
  6. Hu DD, Lin EC, Kovach NL, Hoyer JR, Smith JW, A biochemical characterization of the binding of osteopontin to integrins alpha v beta 1 and alpha v beta 5. J Biol Chem 1995 270:26232-26238[Abstract/Free Full Text]
  7. Fedarko NS, Fohr B, Robey PG, Young MF, Fisher LW, Factor H binding to bone sialoprotein and osteopontin enables tumor cell evasion of complement-mediated attack. J Biol Chem 2000 275:16666-16672[Abstract/Free Full Text]
  8. Denhardt DT, Guo X, Osteopontin: a protein with diverse functions. FASEB J 1993 7:1475-1482[Abstract]
  9. Johnson GA, Burghardt RC, Bazer FW, Spencer TE, Osteopontin: roles in implantation and placentation. Biol Reprod 2003 69:1458-1471[Abstract/Free Full Text]
  10. Fedarko NS, Jain A, Karadag A, Fisher LW, Three small integrin binding ligand N-linked glycoproteins (SIBLINGs) bind and activate specific matrix metalloproteinases. FASEB J 2004 18:734-736[Abstract/Free Full Text]
  11. Nomura S, Wills AJ, Edwards DR, Heath JK, Hogan BL, Developmental expression of 2ar (osteopontin) and SPARC (osteonectin) RNA as revealed by in situ hybridization. J Cell Biol 1988 106:441-450[Abstract/Free Full Text]
  12. Carson DD, Lagow E, Thathiah A, Al-Shami R, Farach-Carson MC, Vernon M, Yuan L, Fritz MA, Lessey B, Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Mol Hum Reprod 2002 8:871-879[Abstract/Free Full Text]
  13. Garlow JE, Ka H, Johnson GA, Burghardt RC, Jaeger LA, Bazer FW, Analysis of osteopontin at the maternal-placental interface in pigs. Biol Reprod 2002 66:718-725[Abstract/Free Full Text]
  14. Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC, Global gene profiling in human endometrium during the window of implantation. Endocrinology 2002 143:2119-2138[Abstract/Free Full Text]
  15. Apparao KB, Illera MJ, Beyler SA, Olson GE, Osteen KG, Corjay MH, Boggess K, Lessey BA, Regulated expression of osteopontin in the peri-implantation rabbit uterus. Biol Reprod 2003 68:1484-1490[Abstract/Free Full Text]
  16. Girotti M, Zingg HH, Gene expression profiling of rat uterus at different stages of parturition. Endocrinology 2003 144:2254-2265[Abstract/Free Full Text]
  17. Johnson GA, Burghardt RC, Joyce MM, Spencer TE, Bazer FW, Gray CA, Pfarrer C, Osteopontin is synthesized by uterine glands and a 45-kDa cleavage fragment is localized at the uterine-placental interface throughout ovine pregnancy. Biol Reprod 2003 69:92-98[Abstract/Free Full Text]
  18. Joyce MM, Gonzalez JF, Lewis S, Woldesenbet S, Burghardt RC, Newton GR, Johnson GA, Caprine uterine and placental osteopontin expression is distinct among epitheliochorial implanting species. Placenta 2005 26:160-170[CrossRef][Medline]
  19. Burghardt RC, Johnson GA, Jaeger LA, Ka H, Garlow JE, Spencer TE, Bazer FW, Integrins and extracellular matrix proteins at the maternal-fetal interface in domestic animals. Cells Tissues Organs 2002 172:202-217[CrossRef][Medline]
  20. Lessey BA, Adhesion molecules and implantation. J Reprod Immunol 2002 55:101-112[CrossRef][Medline]
  21. Armant DR, Blastocysts don't go it alone. Extrinsic signals fine-tune the intrinsic developmental program of trophoblast cells. Dev Biol 2005 280:260-280[CrossRef][Medline]
  22. Johnson GA, Bazer FW, Jaeger LA, Ka H, Garlow JE, Pfarrer C, Spencer TE, Burghardt RC, Muc-1, integrin, and osteopontin expression during the implantation cascade in sheep. Biol Reprod 2001 65:820-828[Abstract/Free Full Text]
  23. Weintraub AS, Lin X, Itskovich VV, Aguinaldo JG, Chaplin WF, Denhardt DT, Fayad ZA, Prenatal detection of embryo resorption in osteopontin-deficient mice using serial noninvasive magnetic resonance microscopy. Pediatr Res 2004 55:419-424[CrossRef][Medline]
  24. King AH, Jiang Z, Gibson JP, Haley CS, Archibald AL, Mapping quantitative trait loci affecting female reproductive traits on porcine chromosome 8. Biol Reprod 2003 68:2172-2179[Abstract/Free Full Text]
  25. Johnson GA, Spencer TE, Burghardt RC, Bazer FW, Ovine osteopontin: I. Cloning and expression of messenger ribonucleic acid in the uterus during the periimplantation period. Biol Reprod 1999 61:884-891[Abstract/Free Full Text]
  26. Apparao KB, Murray MJ, Fritz MA, Meyer WR, Chambers AF, Truong PR, Lessey BA, Osteopontin and its receptor alphavbeta(3) integrin are coexpressed in the human endometrium during the menstrual cycle but regulated differentially. J Clin Endocrinol Metab 2001 86:4991-5000[Abstract/Free Full Text]
  27. Frank M, Bazer FW, Thatcher WW, Wilcox CJ, A study of prostaglandin F2alpha as the luteolysin in swine: III effects of estradiol valerate on prostaglandin F, progestins, estrone and estradiol concentrations in the utero-ovarian vein of nonpregnant gilts. Prostaglandins 1977 14:1183-1196[CrossRef][Medline]
  28. Wrana JL, Zhang Q, Sodek J, Full-length cDNA sequence of porcine secreted phosphoprotein-1 (SPP-1, osteopontin). Nucleic Acids Res 1989 17:10118-10119[Free Full Text]
  29. Hettinger AM, Allen MR, Zhang BR, Goad DW, Malayer JR, Geisert RD, Presence of the acute phase protein, bikunin, in the endometrium of gilts during estrous cycle and early pregnancy. Biol Reprod 2001 65:507-513[Abstract/Free Full Text]
  30. Johnson GA, Spencer TE, Hansen TR, Austin KJ, Burghardt RC, Bazer FW, Expression of the interferon tau inducible ubiquitin cross-reactive protein in the ovine uterus. Biol Reprod 1999 61:312-318[Abstract/Free Full Text]
  31. Wrana JL, Zhang Q, Sodek J, Full length cDNA sequence of porcine secreted phosphoprotein-I (SPP-I, osteopontin). Nucleic Acids Res 1989 17:10119[Free Full Text]
  32. Johnson GA, Burghardt RC, Spencer TE, Newton GR, Ott TL, Bazer FW, Ovine osteopontin: II. Osteopontin and alpha(v)beta(3) integrin expression in the uterus and conceptus during the periimplantation period. Biol Reprod 1999 61:892-899[Abstract/Free Full Text]
  33. Fisher LW, Stubbs JT, 3rd, Young MF, Antisera and cDNA probes to human and certain animal model bone matrix noncollagenous proteins. Acta Orthop Scand Suppl 1995 266:61-65[Medline]
  34. Roberts RM, Liu L, Guo Q, Leaman D, Bixby J, The evolution of the type I interferons. J Interferon Cytokine Res 1998 18:805-816[Medline]
  35. Hughes AL, Green JA, Garbayo JM, Roberts RM, Adaptive diversification within a large family of recently duplicated, placentally expressed genes. Proc Natl Acad Sci U S A 2000 97:3319-3323[Abstract/Free Full Text]
  36. Geisert RD, Yelich JV, Regulation of conceptus development and attachment in pigs. J Reprod Fertil Suppl 1997 52:133-149[Medline]
  37. Jaeger LA, Johnson GA, Ka H, Garlow JG, Burghardt RC, Spencer TE, Bazer FW, Functional analysis of autocrine and paracrine signalling at the uterine-conceptus interface in pigs. Reprod Suppl 2001 58:191-207[Medline]
  38. Vanacker JM, Pettersson K, Gustafsson JA, Laudet V, Transcriptional targets shared by estrogen receptor-related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta. EMBO J 1999 18:4270-4279[CrossRef][Medline]
  39. Zhang Q, Wrana JL, Sodek J, Characterization of the promoter region of the porcine opn (osteopontin, secreted phosphoprotein 1) gene. Identification of positive and negative regulatory elements and a ‘silent’ second promoter. Eur J Biochem 1992 207:649-659[Medline]
  40. Geisert RD, Brenner RM, Moffatt RJ, Harney JP, Yellin T, Bazer FW, Changes in oestrogen receptor protein, mRNA expression and localization in the endometrium of cyclic and pregnant gilts. Reprod Fertil Dev 1993 5:247-260[CrossRef][Medline]
  41. Flood PF, Steroid-metabolizing enzymes in the early pig conceptus and in the related endometrium. J Endocrinol 1974 63:413-414[Abstract/Free Full Text]
  42. Pack BA, Brooks SC, Cyclic activity of estrogen sulfotransferase in the gilt uterus. Endocrinology 1974 95:1680-1690[Abstract/Free Full Text]
  43. Robertson HA, King GJ, Plasma concentrations of progesterone, oestrone, oestradiol-17beta and of oestrone sulphate in the pig at implantation, during pregnancy and at parturition. J Reprod Fertil 1974 40:133-141[Abstract/Free Full Text]
  44. Johnson GA, Spencer TE, Burghardt RC, Taylor KM, Gray CA, Bazer FW, Progesterone modulation of osteopontin gene expression in the ovine uterus. Biol Reprod 2000 62:1315-1321[Abstract/Free Full Text]
  45. Spencer TE, Gray A, Johnson GA, Taylor KM, Gertler A, Gootwine E, Ott TL, Bazer FW, Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol Reprod 1999 61:1409-1418[Abstract/Free Full Text]
  46. Kensinger RS, Collier RJ, Bazer FW, Kraeling RR, Effect of number of conceptuses on maternal hormone concentrations in the pig. J Anim Sci 1986 62:1666-1674[Abstract/Free Full Text]
  47. Roberts RM, Bazer FW, The functions of uterine secretions. J Reprod Fertil 1988 82:875-892[CrossRef][Medline]
  48. Simmen RC, Baumbach GA, Roberts RM, Molecular cloning and temporal expression during pregnancy of the messenger ribonucleic acid encoding uteroferrin, a progesterone-induced uterine secretory protein. Mol Endocrinol 1988 2:253-262[Abstract/Free Full Text]
  49. Ka H, Spencer TE, Johnson GA, Bazer FW, Keratinocyte growth factor: expression by endometrial epithelia of the porcine uterus. Biol Reprod 2000 62:1772-1778[Abstract/Free Full Text]
  50. Brambel CE, Allantochorionic differentiation of the pig studied morphologically and histochemically. Am J Anat 1933 52:397-459[CrossRef]
  51. Wislocki GB, Dempsey EW, Histochemical reactions of the placenta of the pig. Am J Anat 1946 78:181-225[CrossRef]
  52. Roberts RM, Murray MK, Burke MG, Ketcham CM, Bazer FW, Hormonal control and function of secretory proteins. Adv Exp Med Biol 1987 230:137-150[Medline]
  53. Johnson GA, Burghardt RC, Joyce MM, Spencer TE, Bazer FW, Pfarrer C, Gray CA, Osteopontin expression in uterine stroma indicates a decidualization-like differentiation during ovine pregnancy. Biol Reprod 2003 68:1951-1958[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Toxicol PatholHome page
A. Banerjee, R. Rose, G. A. Johnson, R. C. Burghardt, and S. K. Ramaiah
The Influence of Estrogen on Hepatobiliary Osteopontin (SPP1) Expression in a Female Rodent Model of Alcoholic Steatohepatitis
Toxicol Pathol, June 1, 2009; 37(4): 492 - 501.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Song, K. A. Dunlap, J. Kim, D. W. Bailey, T. E. Spencer, R. C. Burghardt, G. F. Wagner, G. A. Johnson, and F. W. Bazer
Stanniocalcin 1 Is a Luminal Epithelial Marker for Implantation in Pigs Regulated by Progesterone and Estradiol
Endocrinology, February 1, 2009; 150(2): 936 - 945.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Seo, M. Kim, Y. Choi, C.-K. Lee, and H. Ka
Analysis of Lysophosphatidic Acid (LPA) Receptor and LPA-Induced Endometrial Prostaglandin-Endoperoxide Synthase 2 Expression in the Porcine Uterus
Endocrinology, December 1, 2008; 149(12): 6166 - 6175.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Lam Shang Leen, C. Filipe, A. Billon, B. Garmy-Susini, S. Jalvy, F. Robbesyn, D. Daret, C. Allieres, S. R. Rittling, N. Werner, et al.
Estrogen-Stimulated Endothelial Repair Requires Osteopontin
Arterioscler. Thromb. Vasc. Biol., December 1, 2008; 28(12): 2131 - 2136.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
K. A. Dunlap, D. W. Erikson, R. C. Burghardt, F. J. White, K. M. Reed, J. L. Farmer, T. E. Spencer, R. R. Magness, F. W. Bazer, K. J. Bayless, et al.
Progesterone and Placentation Increase Secreted Phosphoprotein One (SPP1 or Osteopontin) in Uterine Glands and Stroma for Histotrophic and Hematotrophic Support of Ovine Pregnancy
Biol Reprod, November 1, 2008; 79(5): 983 - 990.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. W. Ross, M. D. Ashworth, F. J. White, G. A. Johnson, P. J. Ayoubi, U. DeSilva, K. M. Whitworth, R. S. Prather, and R. D. Geisert
Premature Estrogen Exposure Alters Endometrial Gene Expression to Disrupt Pregnancy in the Pig
Endocrinology, October 1, 2007; 148(10): 4761 - 4773.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. M. Joyce, R. C. Burghardt, R. D. Geisert, J. R. Burghardt, R. N. Hooper, J. W. Ross, M. D. Ashworth, and G. A. Johnson
Pig Conceptuses Secrete Estrogen and Interferons to Differentially Regulate Uterine STAT1 in a Temporal and Cell Type-Specific Manner
Endocrinology, September 1, 2007; 148(9): 4420 - 4431.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. Heneweer, R. Houtman, J. Poortman, M. Groot, C. Maliepaard, and A. Peijnenburg
Estrogenic Effects in the Immature Rat Uterus after Dietary Exposure to Ethinylestradiol and Zearalenone Using a Systems Biology Approach
Toxicol. Sci., September 1, 2007; 99(1): 303 - 314.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. M. Joyce, J. R. Burghardt, R. C. Burghardt, R. N. Hooper, L. A. Jaeger, T. E. Spencer, F. W. Bazer, and G. A. Johnson
Pig Conceptuses Increase Uterine Interferon-Regulatory Factor 1 (IRF1), but Restrict Expression to Stroma Through Estrogen-Induced IRF2 in Luminal Epithelium
Biol Reprod, August 1, 2007; 77(2): 292 - 302.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
H. Ka, S. Al-Ramadan, D. W. Erikson, G. A. Johnson, R. C. Burghardt, T. E. Spencer, L. A. Jaeger, and F. W. Bazer
Regulation of Expression of Fibroblast Growth Factor 7 in the Pig Uterus by Progesterone and Estradiol
Biol Reprod, July 1, 2007; 77(1): 172 - 180.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
F. J White, R. C Burghardt, J. Hu, M. M Joyce, T. E Spencer, and G. A Johnson
Secreted phosphoprotein 1 (osteopontin) is expressed by stromal macrophages in cyclic and pregnant endometrium of mice, but is induced by estrogen in luminal epithelium during conceptus attachment for implantation.
Reproduction, December 1, 2006; 132(6): 919 - 929.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
73/6/1294    most recent
biolreprod.105.045153v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.
Agricola
Right arrow Articles by White, F. J.
Right arrow Articles by Johnson, G. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS