Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print September 14, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.045484
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/1/102    most recent
biolreprod.105.045484v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.
Agricola
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.
BIOLOGY OF REPRODUCTION 74, 102–108 (2006)
DOI: 10.1095/biolreprod.105.045484
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Cullin3 Is a KLHL10-Interacting Protein Preferentially Expressed During Late Spermiogenesis

Shouhua Wang, Huili Zheng, Yumiko Esaki, Fiona Kelly, and Wei Yan 1

Department of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, Nevada 89557

ABSTRACT

Kelch-like 10 (KLHL10) is a member of the BTB (Bric-a-brac, Tramtrack, and Broad-Complex)-kelch protein superfamily essential for spermiogenesis and male fertility. In a search for KLHL10-interacting proteins using a yeast two-hybrid assay, we identified Cullin3 (CUL3) as one of multiple KLHL10-interacting partners. Yeast cotransformation assays revealed that CUL3 bound the BTB/POZ domain of KLHL10. Northern blot and quantitative RT-PCR analyses demonstrated that Cul3 mRNA was preferentially expressed in the testis. In situ hybridization analysis localized Cul3 mRNA to spermatids in the adult testis. CUL3 protein was detected in elongating and elongated spermatids (steps 10–16) by immunofluorescent microscopy. The expression pattern of CUL3 resembles KLHL10. CUL3 was coimmunoprecipated with KLHL10, and KLHL10 was also detected in the CUL3 immunoprecipitants using testis lysates. These findings suggest that KLHL10, like other BTB/kelch proteins, interacts with CUL3 to form a CUL3-based ubiquitin E3 ligase that functions specifically in the testis to mediate protein ubiquitination during spermiogenesis.

BTB protein, Cullin3, infertility, spermatid, spermatogenesis, testis, Ubiquitin E3 ligase, ubiquitination

INTRODUCTION

Most cellular processes require a tightly controlled coordination between synthesis and degradation of proteins. Regulating protein turnover allows cells to adapt rapidly to various internal and external cues, and to eliminate proteins that are no longer needed or are deleterious in the new environment [1, 2]. Ubiquitin-dependent degradation by the 26S proteasome has emerged as a central mechanism to control protein turnover. It is now clear that ubiquitin-dependent degradation pathways regulate many biological processes, including cell cycle progression, transcription, and cell-fate specification [3]. Covalent attachment of a polyubiquitin chain on lysine residues of a given substrate mediates its recognition and subsequent degradation by the proteasome. The polyubiquitination reaction requires three classes of different enzymes: E1, E2, and E3. The ubiquitin-activating enzyme (E1) and the ubiquitin-conjugating enzyme (E2) are involved in activating and transferring ubiquitin through thioester bond formation. Ubiquitin ligases (E3) are multiprotein complexes that recognize specific substrates and mediate their ubiquitin-dependent degradation. Two classes of E3 ligases have been characterized: HECT-type and RING-H2-type E3s [4]. HECT-type E3 ligases display catalytic activity, whereas RING-H2-type E3 ligases promote ubiquitination by positioning the activated E2 in a close proximity to the substrate.

In mammals, an increasing body of evidence shows that the ubiquitin pathway plays important roles in gametogenesis [1, 5]. Ubiquitin and its associated enzymes E1 and E2 are highly expressed in germ cells in gonads; ubiquitin-dependent proteolysis is believed to be an important pathway for rapid elimination of unneeded proteins during spermatogenesis. The ubiquitin-conjugating enzyme HR6B is required for the formation of the synaptonemal complex and meiotic recombination in spermatocytes, and Hr6b knockout mice are sterile because of disrupted spermatogenesis [6]. The mammalian Siah1a encodes a highly conserved protein that acts as a component of E3 ubiquitin ligase complexes that facilitate the ubiquitination and degradation of diverse protein partners including beta-Catenin, N-CoR, and DCC [7]. Siah1a knockout males are sterile because of disrupted transition from metaphase to telophase during meiosis I [7]. Ubiquitin-dependent proteolysis is also involved in chromatin remodeling and histone ubiquitination [8, 9] and, most noticeably, in the elimination of sperm mitochondria during fertilization [5] and of defective spermatozoa in epididymis ([10].

Kelch-like 10 (KLHL10) is a member of a large BTB (Bric-a-brac, Tramtrack, and Broad-Complex)-kelch protein superfamily, characterized by an amino terminal BTB/POZ domain and kelch repeats at the carboxyl terminus [11, 12]. Male mice with a null mutation in one allele of Klhl10 are infertile because of disrupted spermatogenesis, displaying asynchronous spermatid maturation, degeneration of late spermatids, and significant reduction in late spermatid number [12]. These data suggest that KLHL10 plays an essential role in spermiogenesis. However, the molecular mechanisms by which KLHL10 functions remain unknown.

Unlike many kelch-repeat proteins that are involved in the cytoskeleton organization through interaction with actins and intermediate filaments, KLHL10 is not an actin-interacting protein [12]. However, the presence of the BTB domain provides a promising clue to a potential function in the ubiquitination process, because Cullin3 (CUL3) has been identified to interact with BTB domain-containing proteins to form E3 ubiquitin ligase complexes in several recent studies [13, 14]. In C. elegans, the BTB protein MEL-26 serves as substrate-specific adaptor for the CUL3-based ubiquitin ligase [15]. Recent studies have identified numerous CUL3-binding BTB domain-containing proteins, including eight BTB/Kelch proteins [16]. These diverse BTB proteins may constitute a large number of distinct BTB-CUL3-based E3 ubiquitin ligases that target specific substrate proteins in the cell.

To investigate the molecular mechanism by which KLHL10 regulates spermiogenesis, we performed a yeast two-hybrid assay to identify KLHL10-interacting proteins. CUL3 was one of 10 proteins identified to interact with KLHL10 in our yeast two-hybrid assay. Here we report the expression profile of CUL3 during spermatogenesis, and its interaction with KLHL10 in vivo.

MATERIALS AND METHODS

Animals

C57 BL/6J mice were maintained in a standard animal facility with free access to food and water in the University of Nevada School of Medicine. All experimental procedures were performed according to the guidelines of the Institutional Animal Care and Use Committee of the University of Nevada, Reno.

Yeast Two-Hybrid Screening

To search for KLHL10-interacting proteins, a yeast two-hybrid system (MatchMaker, CLONTECH Laboratories, Inc.) was employed following the manufacturer's instructions. Briefly, we prepared a cDNA prey library using total RNA isolated from adult testes. Using the pGBKT7 vector, we generated 4 bait constructs that express the full-length KLHL10 protein (1–608 amino acid [a.a.], bait1), amino terminus containing the BTB domain (1–260 a.a., bait2), middle part (280–360 a.a.) containing the BTB and C-terminal kelch (BACK) domain (bait3), and carboxyl terminus (370–608 a.a.) containing the 6 kelch repeats (bait4) (Fig. 1A), respectively. All constructs were confirmed by sequencing analyses. Bait1 construct was used to transform the Y187 competent yeast cells. The bait1-transformed Y187 yeast cells were then mated with testis library-containing AH109 yeast cells. After mating, clones that grew on selection plates (SD/-Ade/-His/-Leu/-Trp) were isolated and candidate pGADT7-cDNAs were sequenced. For cotransformation assays, pGADT7-Cul3 cDNA (encoding the amino terminus 206 a.a. of CUL3) was used to transform Y187 competent yeast cells together with baits1–4, respectively. Cotransformations of two empty vectors (pGBKT7 + pGADT7) and pGBKT7–53 (expressing p53 as a control plasmid) + CUL3 were used as controls. The transformed cells were plated on nonselective (SD/-Leu/-Trp) and selective (SD/-Ade/-His/-Leu/-Trp) plates, respectively.


Figure 1
View larger version (72K):
[in this window]
[in a new window]
 
FIG. 1. Yeast two-hybrid assay.A) Schematic presentation of the structure of four bait constructs used for yeast 2-hybrid screening and later cotransformation experiments. Four cDNA fragments designed to express full-length KLHL10 (Bait1), N-terminal portion containing BTB domain (Bait2), middle portion containing BACK domain (Bait3), and C-terminal portion containing 6 kelch repeats (Bait4) were subcloned into the pGBKT7 vector. B) A representative result of the yeast cotransformation experiments, confirming that CUL3 interacts with the BTB domain of KLHL10

RNA Preparation and Northern Blot Analysis

Total RNA was isolated from each tissue using a RNA STAT60 Kit following the manufacturer's instructions (Leedo Medical Laboratories). Northern blot analyses were performed as described [17]. A PCR fragment corresponding to nucleotides 928-1351 of Cul3 cDNA (GenBank accession no. BC027304) was used as a probe. Blots were stripped and hybridized with an 18S rRNA cDNA for loading controls.

Real-Time Quantitative RT-PCR

Total RNA isolated from multiple tissues and developing testes was treated with DNase to remove potential genomic DNA contamination using a DNA-free Kit (Ambion Inc.). One µg of DNA-free total RNA was then used to synthesize first-strand cDNAs as described previously [17]. Primers (forward: GCCATGGTGATGATTAGAGACA, reverse: CCGTACCAACTTGATCTCGAAAA) encompassing a 13-kb intron of Cul3 were used in PCR to generate a fragment of 118 bp. As a control, the housekeeping gene Gapdh (Genbank accession no, NM_001001303) was amplified (forward primer, CCAGGAGCGAGACCCCACTAACA; reverse primer, TTCACACCCATCACAAACAT). Gapdh standard curves were generated by regression analysis of RT-PCRs performed on log10-diluted cDNA using GeneAmp 5700 sequence detector (Applied Biosystems) [18], and were then used to calculate levels of Cul3 relative to Gapdh in each tissue or testes at different developmental stages. PCR was conducted in 25 µl of reaction volume containing 12.5 µl Sybergreen mix (Applied Biosystems), 0.1µM of each primer, and 2µl of cDNA template with the following conditions: 50°C for 2 min to prevent carryover contamination, 95°C for 15 min to activate hot-start polymerase, and 40 cycles of 94°C for 15 sec, 58°C for 30 sec, and 72°C for 30 sec. PCR was repeated three times for each tested tissue, and mean values were used for comparison with standard error of mean.

In Situ Hybridization

A 424-bp cDNA fragment of mouse Cul3 was obtained using RT-PCR (forward primer, AAGGTGGTGGAGAGGGAACT; reverse primer, GCCCTTTGACTCCCTTTTTC), and then subcloned into pGEM-T easy vectors (Promega). The plasmid was linearized with SpeI or NcoI for generating antisense and sense riboprobes using a Riboprobe In Vitro Transcription System (Promega). Slide treatment, hybridization, washing, and autoradiography were performed as described previously [19].

Immunofluorescence

Testis cryosections were prepared as described [12]. Sections were incubated with rabbit anti-CUL3 antibodies (diluted at 1/100; Abcam, Inc.) overnight, followed by three washes (15 min each) in TBST (10 mM Tris-HCl, pH8.0, 100 mM NaCl, 0.1% Tween 20). The slides were then incubated with 3 µg/ml of FITC-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.) for 45 min. DNA was counterstained with DAPI (1 µg/ml) for 10 min. Preimmune serum was used for controls. The staining patterns were observed and photographed using a confocal laser scanning microscope (Model LSM500, Carl Zeiss Microimaging) and its imaging system.

Immunoprecipitation and Western Blot Analysis

Testes were lysed in a buffer (50 mM Tris-HCl, pH 7.4, 2 mM EDTA, 150 mM NaCl, and 1% Triton X-100), and cleared by centrifugation at 10,000 x g for 30 min. Two aliquots of testis lysates (~200 µg) were incubated with rabbit anti-KLHL10 (5 µl) [12] and rabbit anti-CUL3 (20 µl) antibodies (Abcam) at 4°C overnight with gentle shaking. Each lysate was then combined with 20 µl of protein A-agarose and allowed to incubate for 2 h at 4°C. The mixture was centrifuged at 2,000 x g for 5 min at 4°C to pellet. The immunoprecipitants were then washed 4 times with a buffer containing 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% NP-40, 100 mM NaF, 200 µM Na3VO4, 100 IU/ml aprotinin, 1 mM PMSF, and 10 µg/ml leupeptin. The pellet was resuspended in a loading buffer (400 mM Tris-HCl, 40% glycerol, 8% SDS, 0.4 M DTT, and 0.1% bromophenol blue), boiled for 2.5 min, and then centrifuged at 4°C for 2 min. The supernatant was subjected to electrophoresis using a 12.5% SDS-polyacrylamide gel. Proteins in the gel were transferred onto a nitrocellulose membrane (Schleicher & Schuell, Inc.). The membrane was incubated in a blocking buffer (10 mM Tris-HCl, pH 8.0, 0.1% Tween-20, and 5% nonfat milk powder) followed by incubations with anti-CUL3 (1:100 dilution) or anti-KLHL10 (1:1000 dilution) and finally incubation with HRP-conjugated donkey anti-rabbit antibodies (Amersham Bioscience Corp.). The membrane was then subject to chemiluminiscent detection using an ECL detection kit following the manufacturer's instructions (Amersham Bioscience Corp.).

RESULTS

CUL3 Interacts with KLHL10 in the Yeast Two-Hybrid System

Six out of 63 clones obtained in the initial screening using Bait1 (expressing full-length KLHL10 protein) contained cDNA inserts encoding the amino terminus of CUL3. To further confirm and localize the interacting domain, we performed cotransformation assays using pGADT7/Cul3 (expressing the amino terminus 206 a.a. of CUL3 isolated from the identified positive clones) and baits1–4 (Fig. 1B). Yeast cells from all four cotransformations grew on the nonselective plate, indicating that all constructs used were not toxic to yeast cells. Yeast cells contransformed using pGADT7/Cul3 and bait1, or bait2 grew on the selective plates, demonstrating that KLHL10 interacted with the amino terminus of CUL3 through its BTB domain. This finding is consistent with several recent studies showing that BTB/Kelch proteins bind CUL3 through their BTB domains [1316, 2024].

Cul3 Is Preferentially Expressed in the Testis

Northern blot analysis revealed that Cul3 was expressed in 11 tissues examined, but preferentially in testis (Fig. 2A). Only a single transcript of ~3.0 kb was detected. Consistent with the Northern blot results (Fig. 2A), real-time quantitative PCR demonstrated that Cul3 expression levels in the testis were at least 5-fold higher than in any other tissues examined (Fig. 2B). In the developing testis, very low levels of Cul3 mRNA were detected in the first 10 days after birth. Cul3 mRNA levels were greatly increased from Postnatal Day 15 onward, coinciding with the first appearance of haploid cells (spermatids) in the developing testes (~Postnatal Day 15–18) [25]. The expression pattern of Cul3 in the developing testis suggested that Cul3 mRNA was mainly expressed in spermatids. The developmental expression pattern of Cul3 mRNA is similar to that of Klhl10 mRNA [12].


Figure 2
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2. Expression of Cul3 mRNA in mouse tissues. A) Northern blot analysis of Cul3 mRNA expression in multiple mouse tissues including heart (He), liver (Li), spleen (Sp), lung (Lu), kidney (Ki), brain (Br), stomach (St), small intestine (In), testis (Te), ovary (Ov), and uterus (Ut). Levels of 18S rRNA were used as a loading control. B) Real-time quantitative RT-PCR analysis of Cul3 mRNA in multiple mouse tissues (abbreviations are similar to those in A). Graphs represent relative expression levels (in fold) of Cul3 in each tissue against Gapdh levels. Error bars represent SEM (n = 3). C) Real-time quantitative RT-PCR analysis of Cul3 mRNA in developing mouse testes at Postnatal Days 3, 5, 7, 10, 15, 20, 35, and adulthood. Graphs represent relative expression levels (in fold) of Cul3 mRNA in each stage against expression levels of Gapdh. Error bars represent SEM (n = 3)

Cul3 mRNA and Protein Are Localized in Spermatids

In situ hybridization was performed to localize Cul3 mRNA in the testis. The strongest hybridization signals were confined to spermatids at all maturation steps (steps 1–16, Fig. 3). Control slides using sense probes showed no hybriodization signals above background levels (Fig. 3). Preferential expression of Cul3 mRNA in spermatids resembles Klhl10 mRNA expression, which is detected exclusively in spermatids [12]. Using immunofluorescent confocal microscopy, CUL3 protein was first detected in late step 9 and early step 10 spermatids in which elongation is beginning. Levels of CUL3 then increased and remained high from step 11 through step 15 (Fig. 4). Cul3 mRNA and protein expression patterns are similar to those of KLHL10. For comparison, we schematically summarized the mRNA and protein expression sites of CUL3 and KLHL10 in Figure 4E.


Figure 3
View larger version (156K):
[in this window]
[in a new window]
 
FIG. 3. Localization of Cul3 mRNA in the mouse testis by in situ hybridization. Bright-field (A, B, andC) and dark-field (A', B', and C') images are shown. Low-power images (A and A', x200) show that the hybridization signals are confined to the luminal compartments of seminiferous tubules. High-power images (B and B',x400) display a stage X tubule with hybridization signals over step 10 spermatids (Sd10). Controls using sense probes display background without specific hybridization signals (C and C', x200)


Figure 4
View larger version (85K):
[in this window]
[in a new window]
 
FIG. 4. Immunofluorescent detection of CUL3 protein. AD) Four representative confocal micrographs (x630) showing different stages (Roman numerals) of the seminiferous epithelial cycle. Nuclei were counterstained with DAPI (blue), and CUL3 was revealed using FICT-conjugated anti-rabbit secondary antibody (green). CUL3 is detected in the cytoplasm of elongating and elongated spermatids (steps 10–15). E) A schematic summary of the expression patterns of Cul3 and Klhl10 mRNAs and proteins. Frames represent the expression windows of Cul3 and Klhl10 mRNAs and their proteins during spermiogenesis. The width of the frames represents expression levels. Arabic numbers represent the steps of spermatids, and Roman numerals indicate stages of the seminiferous epithelium

CUL3 Interacts with KLHL10 In Vivo

To verify interaction between CUL3 and KLHL10 in vivo, we attempted immunoprecipitation and Western blot analyses using testis lysates. CUL3 protein (85 kd) was detected in the KLHL10 immunoprecipitants using testis lysates prepared from Postnatal Days 20 and 60 mice, but not from Day 5 mice (Fig. 5A). Similarly, KLHL10 (66 kd) was detected in the CUL3 immunoprecipitants using testis lysates from Postnatal Days 20 and 60 mice, but not from Day 5 mice (Fig. 5B). Positive detection of each protein in mutual immunoprecipitants demonstrates that CUL3 physically interacts with KLHL10 in vivo.


Figure 5
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. Coimmunoprecipitation of CUL3 and KLHL10 in vivo. A) Western blot analysis of CUL3 in the KLHL10 immunoprecipitants using testis lysates from 5-, 20-, and 60-day old mice, respectively. B) Western blot analysis of KLHL10 in the CUL3 immunoprecipitants using testis lysates from 5-, 20-, and 60-day old mice, respectively

DISCUSSION

In late spermiogenesis, transcription ceases and ubiquitination pathways are believed to play important roles in the regulation of protein turnover [1, 5, 26, 27]. However, little is known about the components of the molecular machinery used by the ubiquitination pathways. Here, we report that KLHL10 interacts with CUL3 through its BTB domain. Our data support recent studies demonstrating that some BTB domain-containing proteins are linked to ubiquitin-dependent protein degradation by forming Cullin-based E3 ligases [14, 28].

CUL3-based E3 ligases have been identified in a broad range of eukaryotic organisms. In the A. thaliana plant, two redundant CUL3 proteins interact with RBX1 and BTB proteins to form E3 ubiquitin ligase complexes essential for embryonic development [29, 30]. In C. elegans, a CUL3 ubiquitin ligase is required for degradation of MEI-1/Katanin, a microtubule-severing protein, during the transition from meiosis to mitosis [15]. In mice, deletion of the Cul3 gene results in embryonic death at or before Embryonic Day 7.5 because of developmental abnormalities and increased accumulation of cyclin E [31]. These findings indicate that CUL3-based E3 ligases play essential roles in diverse organs across eukaryotic organisms. However, it is not known how CUL3 functions during testicular development and spermatogenesis. Because CUL3 interacts with KLHL10 and both proteins display similar expression and localization patterns in the testis, CUL3-KLHL10 complex appears to be an active E3 ligase that functions exclusively in the testis.

Unlike other Cullin-based E3 ligases, such as SCF (Skp1-CUL1-F box) and ECS (ElonginC-CUL2-SOCS box) that require two distinct proteins to bridge the substrate and Cullin [3234], CUL3-based E3 ligases use a single polypeptide, the BTB protein, to bridge Cullin and the substrate [15, 24]. Human BTB-kelch protein KEAP1 binds CUL3 and substrate NRF2 via its BTB and kelch domains, respectively, serving as a CUL3-ROC1 ligase targeting NRF2 for ubiquitination [35]. Our data strongly suggest that KLHL10 functions similarly to KEAP1 as a component of CUL3-based E3 ligases. Here, we propose a novel putative CUL3-based E3 ligase that uses KLHL10 as a substrate adaptor (Fig. 6). In this model, the BTB domain of KLHL10 is proposed to interact with the CUL3 component of the E3 ubiquitin-ligase complexes and the kelch repeat is presumed to act as the substrate-recognition module [14]. The middle portion of the BTB-kelch proteins has been identified as the BACK (for BTB and C-terminal kelch) domain because it is found predominantly in proteins with BTB and C-terminal kelch repeats [28]. Based on the crystal structure analyses, the BACK domain has been suggested to function through positioning the kelch repeat and its bound substrate in the CUL3 E3 complexes [28].


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6. A proposed scheme of CUL3-KLHL10 complex acting as a testis-specific ubiquitin E3 ligase. The BTB domain of KLHL10 directly binds CUL3 to form a core E3 ligase. Substrate proteins bind to the kelch repeats. The BACK domain of KLHL10 may interact with another protein to help orientate the substrate protein. E2 binds to the C-terminal of CUL 3 to translocate ubiquitins to the substrate

Ubiquitination of substrate proteins requires three distinct steps: activating ubiquitin by E1, passing ubiquitin to E2, and finally binding ubiquitin to a targeted substrate [3]. Because a large number of intracellular proteins are regulated through ubiquitin-mediated degradation pathways, ubiquitin E3 ligases should be diverse but must also be specific. This can be achieved through recruitment of a substrate-specific adaptor protein as a component of Cullin-based E3 ligase complex [23]. Such an adaptor appears to be those BTB-Kelch proteins [13, 15, 24]. Given that KLHL10 is exclusively expressed in the testis and that it interacts directly with CUL3, it is likely that KLHL10 functions as a substrate-specific adaptor responsible for recruitment of unneeded proteins for ubiquitination during spermiogenesis through its kelch repeats. Further molecular biological analyses of all components of CUL3-KLHL10 ubiquitin ligase complexes will help us identify substrate(s) targeted by CUL3-KLHL10 ligase as well as other facilitating proteins either required or involved in ubiquitination.

ACKNOWLEDGMENTS

We thank Drs. Viktor J. Horváth and Tomas Ordog for providing Gapdh primers and help in real-time PCR, Dr. James Kenyon for reading the manuscript.

FOOTNOTES

1 Correspondence: Wei Yan, Department of Physiology and Cell Biology, University of Nevada School of Medicine, MS352, 1664 North Virginia Street, Reno, NV 89557. FAX: 775 784 6903; weiyan{at}unr.edu Back

Received: 12 July 2005.

First decision: 5 August 2005.

Accepted: 14 September 2005.

REFERENCES

  1. Baarends WM, Roest HP, Grootegoed JA, The ubiquitin system in gametogenesis. Mol Cell Endocrinol 1999 151:5-16[CrossRef][Medline]
  2. Ciechanover A, The ubiquitin-proteasome proteolytic pathway. Cell 1994 79:13-21[CrossRef][Medline]
  3. Hershko A, Ciechanover A, The ubiquitin system. Annu Rev Biochem 1998 67:425-479[CrossRef][Medline]
  4. Glickman MH, Ciechanover A, The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol Rev 2002 82:373-428[Abstract/Free Full Text]
  5. Sutovsky P, Ubiquitin-dependent proteolysis in mammalian spermatogenesis, fertilization, and sperm quality control: killing three birds with one stone. Microsc Res Tech 2003 61:88-102[CrossRef][Medline]
  6. Baarends WM, Wassenaar E, Hoogerbrugge JW, van Cappellen G, Roest HP, Vreeburg J, Ooms M, Hoeijmakers JH, Grootegoed JA, Loss of HR6B ubiquitin-conjugating activity results in damaged synaptonemal complex structure and increased crossing-over frequency during the male meiotic prophase. Mol Cell Biol 2003 23:1151-1162[Abstract/Free Full Text]
  7. Dickins RA, Frew IJ, House CM, O'Bryan MK, Holloway AJ, Haviv I, Traficante N, de Kretser DM, Bowtell DD, The ubiquitin ligase component Siah1a is required for completion of meiosis I in male mice. Mol Cell Biol 2002 22:2294-2303[Abstract/Free Full Text]
  8. Baarends WM, Hoogerbrugge JW, Roest HP, Ooms M, Vreeburg J, Hoeijmakers JH, Grootegoed JA, Histone ubiquitination and chromatin remodeling in mouse spermatogenesis. Dev Biol 1999 207:322-333[CrossRef][Medline]
  9. Liu Z, Oughtred R, Wing SS, Characterization of E3Histone, a novel testis ubiquitin protein ligase which ubiquitinates histones. Mol Cell Biol 2005 25:2819-2831[Abstract/Free Full Text]
  10. Sutovsky P, Moreno R, Ramalho-Santos J, Dominko T, Thompson WE, Schatten G, A putative, ubiquitin-dependent mechanism for the recognition and elimination of defective spermatozoa in the mammalian epididymis. J Cell Sci 2001 114:1665-1675[Abstract]
  11. Adams J, Kelso R, Cooley L, The kelch repeat superfamily of proteins: propellers of cell function. Trends Cell Biol 2000 10:17-24[CrossRef][Medline]
  12. Yan W, Ma L, Burns KH, Matzuk MM, Haploinsufficiency of kelch-like protein homolog 10 causes infertility in male mice. Proc Natl Acad Sci U S A 2004 101:7793-7798[Abstract/Free Full Text]
  13. Geyer R, Wee S, Anderson S, Yates J, Wolf DA, BTB/POZ domain proteins are putative substrate adaptors for cullin 3 ubiquitin ligases. Mol Cell 2003 12:783-790[CrossRef][Medline]
  14. Pintard L, Willems A, Peter M, Cullin-based ubiquitin ligases: Cul3-BTB complexes join the family. EMBO J 2004 23:1681-1687[CrossRef][Medline]
  15. Pintard L, Willis JH, Willems A, Johnson JL, Srayko M, Kurz T, Glaser S, Mains PE, Tyers M, Bowerman B, Peter M, The BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase. Nature 2003 425:311-316[CrossRef][Medline]
  16. Furukawa M, He YJ, Borchers C, Xiong Y, Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat Cell Biol 2003 5:1001-1007[CrossRef][Medline]
  17. Yan W, Rajkovic A, Viveiros MM, Burns KH, Eppig JJ, Matzuk MM, Identification of Gasz, an evolutionarily conserved gene expressed exclusively in germ cells and encoding a protein with four ankyrin repeats, a sterile-alpha motif, and a basic leucine zipper. Mol Endocrinol 2002 16:1168-1184[Abstract/Free Full Text]
  18. Ordog T, Redelman D, Miller LJ, Horvath VJ, Zhong Q, Almeida-Porada G, Zanjani ED, Horowitz B, Sanders KM, Purification of interstitial cells of Cajal by fluorescence-activated cell sorting. Am J Physiol Cell Physiol 2004 286:C448-456[Abstract/Free Full Text]
  19. Yan W, Samson M, Jegou B, Toppari J, Bcl-w forms complexes with Bax and Bak, and elevated ratios of Bax/Bcl-w and Bak/Bcl-w correspond to spermatogonial and spermatocyte apoptosis in the testis. Mol Endocrinol 2000 14:682-699[Abstract/Free Full Text]
  20. Furukawa M, Ohta T, Xiong Y, Activation of UBC5 ubiquitin-conjugating enzyme by the RING finger of ROC1 and assembly of active ubiquitin ligases by all cullins. J Biol Chem 2002 277:15758-15765[Abstract/Free Full Text]
  21. Kobayashi A, Kang MI, Okawa H, Ohtsuji M, Zenke Y, Chiba T, Igarashi K, Yamamoto M, Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol 2004 24:7130-7139[Abstract/Free Full Text]
  22. van den Heuvel S, Protein degradation: CUL-3 and BTB—partners in proteolysis. Curr Biol 2004 14:R59-R61[Medline]
  23. Krek W, BTB proteins as henchmen of Cul3-based ubiquitin ligases. Nat Cell Biol 2003 5:950-951[CrossRef][Medline]
  24. Xu L, Wei Y, Reboul J, Vaglio P, Shin TH, Vidal M, Elledge SJ, Harper JW, BTB proteins are substrate-specific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature 2003 425:316-321[CrossRef][Medline]
  25. Bellve AR, Purification, culture, and fractionation of spermatogenic cells. Methods Enzymol 1993 225:84-113[Medline]
  26. Baarends WM, van der Laan R, Grootegoed JA, Specific aspects of the ubiquitin system in spermatogenesis. J Endocrinol Invest 2000 23:597-604[Medline]
  27. Grootegoed JA, Siep M, Baarends WM, Molecular and cellular mechanisms in spermatogenesis. Baillieres Best Pract Res Clin Endocrinol Metab 2000 14:331-343[CrossRef][Medline]
  28. Stogios PJ, Prive GG, The BACK domain in BTB-kelch proteins. Trends Biochem Sci 2004 29:634-637[CrossRef][Medline]
  29. Dieterle M, Thomann A, Renou JP, Parmentier Y, Cognat V, Lemonnier G, Muller R, Shen WH, Kretsch T, Genschik P, Molecular and functional characterization of Arabidopsis Cullin 3A. Plant J 2005 41:386-399[Medline]
  30. Figueroa P, Gusmaroli G, Serino G, Habashi J, Ma L, Shen Y, Feng S, Bostick M, Callis J, Hellmann H, Deng XW, Arabidopsis has two redundant Cullin3 proteins that are essential for embryo development and that interact with RBX1 and BTB proteins to form multisubunit E3 ubiquitin ligase complexes in vivo. Plant Cell 2005 17:1180-1195[Abstract/Free Full Text]
  31. Singer JD, Gurian-West M, Clurman B, Roberts JM, Cullin-3 targets cyclin E for ubiquitination and controls S phase in mammalian cells. Genes Dev 1999 13:2375-2387[Abstract/Free Full Text]
  32. Schulman BA, Carrano AC, Jeffrey PD, Bowen Z, Kinnucan ER, Finnin MS, Elledge SJ, Harper JW, Pagano M, Pavletich NP, Insights into SCF ubiquitin ligases from the structure of the Skp1-Skp2 complex. Nature 2000 408:381-386[CrossRef][Medline]
  33. Zheng N, Schulman BA, Song L, Miller JJ, Jeffrey PD, Wang P, Chu C, Koepp DM, Elledge SJ, Pagano M, Conaway RC, Conaway JW, et al Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature 2002 416:703-709[CrossRef][Medline]
  34. Stebbins CE, Kaelin WG, Jr. Pavletich NP, Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 1999 284:455-461[Abstract/Free Full Text]
  35. Furukawa M, Xiong Y, BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol 2005 25:162-171[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
P. Puri, K. Myers, D. Kline, and S. Vijayaraghavan
Proteomic Analysis of Bovine Sperm YWHA Binding Partners Identify Proteins Involved in Signaling and Metabolism
Biol Reprod, December 1, 2008; 79(6): 1183 - 1191.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Wojtczak and M. Kwiatkowska
Immunocytochemical and Ultrastructural Analyses of the Function of the Ubiquitin-Proteasome System During Spermiogenesis with the Use of the Inhibitors of Proteasome Proteolytic Activity in the Alga, Chara vulgaris
Biol Reprod, April 1, 2008; 78(4): 577 - 585.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Zheng, C. J. Stratton, K. Morozumi, J. Jin, R. Yanagimachi, and W. Yan
Lack of Spem1 causes aberrant cytoplasm removal, sperm deformation, and male infertility
PNAS, April 17, 2007; 104(16): 6852 - 6857.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. N. Yatsenko, A. Roy, R. Chen, L. Ma, L. J. Murthy, W. Yan, D. J. Lamb, and M. M. Matzuk
Non-invasive genetic diagnosis of male infertility using spermatozoal RNA: KLHL10mutations in oligozoospermic patients impair homodimerization
Hum. Mol. Genet., December 1, 2006; 15(23): 3411 - 3419.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. M. Beard, G. C. Froggatt, and G. L. Smith
Vaccinia virus kelch protein A55 is a 64 kDa intracellular factor that affects virus-induced cytopathic effect and the outcome of infection in a murine intradermal model
J. Gen. Virol., June 1, 2006; 87(6): 1521 - 1529.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/1/102    most recent
biolreprod.105.045484v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.
Agricola
Right arrow Articles by Wang, S.
Right arrow Articles by Yan, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS