|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Monash Institute of Medical Research,3 Monash University, Melbourne, Victoria 3168, Australia
Australian Research Council Centre of Excellence in Biotechnology and Development,4
Department of Biochemistry and Molecular Biology,5 Monash University, Melbourne, Victoria 3168, Australia
ABSTRACT
Spermatogenic differentiation requires progressive gene expression changes, and proteins required for this must be transported into the nucleus. Many of these contain a nuclear localization signal and are likely to be transported by importin protein family members, each of which recognizes and transports distinct cargo proteins. We hypothesized that importins, as modulators of protein nuclear access, would display distinct expression profiles during spermatogenesis, indicating their potential to regulate key steps in cellular differentiation. This was tested throughout testicular development in rodents. Real-time PCR analysis of postnatal mouse testes revealed changing expression levels of Knpb1 (encoding importin beta 1) and Ranbp5 (encoding beta 3) mRNAs, with Knpb1 highest at 26 days postpartum and Ranbp5 highest in Day 26 and adult testis. Their distinctive cellular expression patterns visualized using in situ hybridization and immunohistochemistry were identical in mouse and rat testes where examined. Within the seminiferous epithelium, Knpb1 mRNA and importin beta1 protein were detected within mitotic Sertoli and germ cells during fetal and early postnatal development, becoming restricted to spermatogonia and spermatocytes in adulthood. Importin beta 3 protein in fetal germ cells displayed a striking difference in intracellular localization between male and female gonads. In adult testes, Ranbp5 mRNA was detected in round spermatids and importin beta 3 protein in elongating spermatids. This is the first comprehensive in situ demonstration of developmentally regulated synthesis of nuclear transport components. The contrasting expression patterns of importins beta 1 and 3 identify them as candidates for regulating nuclear access of factors required for developmental switches.
developmental biology, gametogenesis, signal transducers, spermatogenesis
INTRODUCTION
Development of a functional testis results from a series of triggers that drive progressive changes in both the somatic and germ cell compartments (reviewed in McCarrey [1]). Throughout this process, a progressive series of nuclear proteins, including transcription factors and chromatin remodeling proteins, are required to enable synthesis of the new gene products that are needed for each developmental stage. Many proteins known to govern testicular development and spermatogenesis translocate between the nucleus and cytoplasm to effect these changes in gene transcription.
Allocation of cells to the germline occurs in response to signaling by specific bone morphogenetic proteins (BMPs) [2, 3], requiring nuclear translocation of the BMP-dependent transcription factors SMAD1 and SMAD5 (reviewed in Zhao [4]). These indifferent primordial germ cells (PGCs) migrate to the genital ridge, where testis development requires nuclear SRY expression within the somatic Sertoli cells between Embryonic Day 10.5 (E10.5) and E12.5 [5]. SRY in turn drives an expression cascade of transcription factors and other genes, including Sox9, anti-Mullerian hormone (also known as Mullerian inhibitory substance), and Nr5a1 (also known as steroidogenic factor 1; reviewed in Morrish and Sinclair [6]), that results in commitment of PGCs to the male pathway of differentiation as gonocytes. Nuclear translocation of both SRY and SOX9 is essential for normal gonadal sexual differentiation; mutations within the nuclear import signal of SRY that reduce nuclear import are associated with male-to-female sex reversal in humans [7].
At the onset of postnatal spermatogenesis, testicular germ cells demonstrate their capacity to undergo self-renewal, as spermatogonial stem cells, to commence differentiation into sperm, and to undergo apoptosis; the balance of these is required for testicular homeostasis in both the developing and the adult testis [8]. The influence of many factors on the fate of these early germ cells has been documented, including the requirement for glial-derived neurotrophic factor signaling to sustain stem cells [9] and BMPs to drive spermatogonial differentiation [10], with the latter linked to movement of SMAD5 protein into the nucleus. The differentiating spermatogonia proceed through meiosis and then spermiogenesis as haploid round and elongating spermatids and are released into the seminiferous tubule lumen as spermatozoa. The radical reshaping of the sperm head and DNA compaction during spermatogenesis require production and nuclear import of a succession of DNA packaging proteins, first transition proteins to replace the histones and then protamines to replace the transition proteins [11].
These examples illustrate the reliance of normal sperm production on the movement of a wide variety of proteins into the nucleus, showing that timely movement of cargo into and out of the nucleus is an essential feature of spermatogenesis. Proteins larger than 45 kDa cannot enter the nucleus unassisted, with the passive diffusion of smaller proteins presumably insufficient to drive rapid developmental switches. So how is regulated nuclear transport accomplished? The importin protein family (also termed "karyopherins") is known to play a central role in mediating nucleocytoplasmic transport of proteins and mRNAs. The number of importins varies between species; in mouse there are three structurally distinct classes of importin alpha proteins to which the five family members belong, and at least 20 genes encoding importin beta proteins have been identified. Studies describing expression of these in relationship to organ function or development are sparse and limited in scope to a single time point or to analysis of cell lines [1214].
In this study we identify the expression patterns of importin beta 1 and importin beta 3 throughout testis development in both rat and mouse, common models used to study male reproduction. Their contrasting expression patterns are consistent with the concept that distinct nuclear transport proteins are synthesized to carry specialized cargo into the nucleus in accord with the cell's stage of maturation. We also present evidence that the intracellular localization of these proteins varies between male and female germ cells in the fetal ovary and testis, respectively. These findings suggest that both regulated synthesis and subcellular localization of these importin proteins relate to their roles in mediating the fundamental developmental changes that govern testis development and germ cell maturation.
MATERIALS AND METHODS
Experimental Animals and Tissues
Sprague-Dawley rats ranging from birth (Day 0 postpartum ["p]) to adulthood (6090 dpp) and fetal, juvenile, and adult Swiss and BalbC male mice were obtained from Monash University Central Animal Services. The animals were killed by decapitation (rats and mouse fetuses and juveniles) or cervical dislocation (adult mice) before tissue removal. All investigations conformed to the NHMRC/CSIRO/AAC Code of Practice for the Care and Use of Animals for Experimental Purposes and were approved by the Monash University Standing Committee on Ethics in Animal Experimentation. Tissue samples for RNA preparation were snap frozen immediately after collection and stored at 70°C until use. RNA was prepared using either the acid phenol extraction method [15] or TRIzol (Invitrogen, Victoria, Australia) for Northern blot analyses and Qiagen RNeasy (Qiagen, Victoria, Australia) for real-time PCR analyses following the manufacturer's instructions. Tissue samples for in situ hybridization and immunohistochemistry were placed in Bouin fixative for 5 h immediately after collection, then dehydrated through a graded ethanol series and embedded in paraffin. Sections of 35 µm were placed on Superfrost Plus II slides (Menzel-Glaser, Braunswchweig, Germany). Tissues for Western blot analysis were extracted immediately on collection.
Quantitative mRNA Analysis
For real-time PCR analysis of each postpartum time point, duplicate, independent RNA samples were prepared from the pooled testes of two animals per sample. Total RNA samples were treated with DNase-free (Ambion, Austin, TX) according to the manufacturer's specifications. Five hundred nanograms of this DNA-free total RNA were used for each 20 µl reverse transcription reaction with 100 U Superscript III reverse transcriptase (Life Technologies, Grand Island, NY) and oligo-dT primer, according to the enzyme manufacturer's guidelines.
PCR samples were prepared in a final volume of 10 µl using the Roche Diagnostics SYBR-Green PCR master mix containing 500 nM each forward and reverse primers for mouse (Knpb1 [accession no. NM-008379] forward primer: 5N tggagtcccatatccagagc 3N and reverse primer: 5N atcagggcatcttcttgcac 3N; Ranbp5 [accession no. NM_023579] forward primer: 5N ccagaaggagctgagacgc 3N and reverse primer: 5N taaccacgggaaggtactgc 3N), and 1 µl of reverse-transcribed template. PCR was performed on the LightCycler 2.0 Instrument (Roche Molecular Biochemicals) using the following light cycle conditions: denaturation: 95°C for 10 min, amplification 95°C for 15 sec, 60°C for 5 sec, 72°C for 10 sec, and 72°C for 7 min for 40 cycles. Melting curve analysis and agarose gel electrophoresis was used to monitor synthesis of the PCR products.
Each PCR reaction was performed in duplicate in each experiment, with negative controls, where water was used in place of the reverse-transcribed template, included for each primer pair to exclude PCR amplification of any contaminating DNA. The amount of Actb (also known as beta-actin) mRNA (accession no. NM-007393; forward primer: 5N aggctgtgctgtccctgtat 3N; reverse primer: 5N aaggaaggctggaaaagagc3N) was measured in each sample in a parallel run to normalize measurements between samples, and these values did not vary significantly between ages when using the same amount of input RNA per sample (data not shown). To correlate the threshold values (crossing points) from the sample amplification plot to relative copy number between samples, a standard curve was produced for each product using cDNA from adult mouse testis. The data were calculated as the mean ± SD.
In Situ Hybridization and Northern Blot Analyses
Northern blots were performed to assess the specificity of target recognition by the probes used for in situ hybridization analysis. Probes were generated initially using PCR-derived cDNAs created from adult rat testis with the following primers: LOC306182, encoding importin beta 1, forward primer: 5N tggagtcccatatccagagc 3N and reverse primer: 5N atcagggcatcttcttgcac 3N; Ranbp5 forward primer: 5N ccagaaggagctgagactgc 3N and reverse primer: 5N taaccacgggaaggtactgc 3N. The PCR products were subcloned into pGEMTEasy (Promega Corp., Madison, WI) following the manufacturer's instructions and sequenced for clone verification. The plasmids containing these importin cDNA fragments served as the template for PCR amplification with M13 forward and reverse primers. The products were labeled with [
-32P]dCTP for overnight hybridization at 42°C to Hybond XL membranes (Amersham Biosciences Pty., Ltd, Sydney, Australia) containing 20 µg each of adult and 10 dpp rat and adult mouse total testis RNA. Membranes were washed to a stringency of 0.1x SSC and 0.1% SDS up to 54°C. Relative sample loading was assessed using radiolabeled cDNAs encoding ribosomal protein S26 (accession no. x02414) and GAPDH. Three independent Northern blot hybridization experiments were performed on three independent RNA preparations, with identical results between experiments.
In situ hybridization was used to localize Knpb1 and Ranbp5 mRNAs on rat and mouse testis sections using procedures previously described [16]. The plasmids containing importin cDNA fragments were used to produce sense and antisense DIG-cRNAs using SP6 and T7 RNA polymerases in separate reactions. Hybridization was performed with 200 ng/µl DIG-cRNA, and 15-min washes were performed at temperatures up to 50°C in SSC at concentrations of 2x, 1x, and 0.1x (1x SSC contains 0.15 mol sodium chloride/L, 15 mmol sodium citrate/L pH 7, 1x Denhardt solution, 50% deionized formamide, 66 mmol phosphate buffer/L pH 8, 1 mg herring sperm DNA/ml, and 200 µg yeast RNA/ml). DIG-labeled cRNA were visualized in target tissue using an enzyme-catalyzed reaction that yielded a purple reaction product (BCIP/NBT; One-Step; Pierce, Rockford, IL). Sections were counterstained with Mayer hematoxylin and mounted under glass coverslips with GVA Histomount (Zymed, San Francisco, CA). Both antisense and sense (negative control) cRNAs were used at the same concentration on each sample, in every experiment, for each set of conditions tested. Identical results were obtained when at least three independent tissue samples were examined.
Western Blot and Immunohistochemical Analyses
Western blotting Tissue samples from either total adult mouse testis or from E12.5 mouse embryos were prepared by homogenization at 4°C in RIPA buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl chloride in PBS) in the presence of protease inhibitors (Protease Inhibitor Cocktail Set III; Calbiochem), essentially as described [17]. Sample protein concentration was determined using the Bio-Rad DC protein assay, and 30 µg of protein per lane were loaded onto a 12% SDS-PAGE gel with protein size standards (PageRuler Prestained Protein Ladder; Fermentas). Following electrophoresis, the proteins were transferred to Immobilon P PVDF transfer membrane (Millipore, Bedford, MA), and all subsequent incubations were performed at room temperature unless otherwise stated. The membranes were blocked by incubation in 5% nonfat milk/PBS for 1 h. Washes were performed with five changes of 1% nonfat milk/PBST, each lasting 5 min. Primary antibody incubations were performed overnight at 4°C (rabbit anti-importin beta 1 and anti-importin beta 3, each used at 1:5000; SC-11367 and SC-11369 from Santa Cruz Biotechnology, Santa Cruz, CA), followed by incubation with Alexa Fluor 680-coupled goat anti-rabbit secondary antibody (1:10000 dilution; Molecular Probes) for 60 min. Antibody binding was detected using the Li-Cor Odyssey System (John Morris Scientific). Western blots were repeated at least three times with each antibody with qualitatively identical results.
Immunohistochemistry
Immunohistochemistry with anti-importin antibodies was performed essentially as previously described [17]. Antigen retrieval was performed in 50 mM glycine (pH 3.5;
90°C maintained for 8 min), and the primary antibodies were applied at 0.51.0 µg/ml for overnight incubation at 4°C in 0.1% bovine serum albumin/PBS. Subsequent steps were performed at room temperature, with PBS washes between incubations. Primary antibody binding was detected using a biotinylated anti-rabbit antibody (DAKO; 1:500 dilution, 1 h) and then the Vectastain Elite ABC kit according to the manufacturer's instructions (Vector Laboratories, Burlingame, CA). Antibody binding was detected as a brown precipitate following development with 3,3N-diaminobenzidine tetrahydrochloride and Harris hematoxylin counterstain. The sections were mounted under glass coverslips in Depex (BDH Laboratories, Poole, UK). Germ cell types were identified primarily on the basis of their nuclear morphology and position within the developing gonad. Immunohistochemistry experiments were repeated at least two times on two different samples, with qualitatively identical results obtained.
RESULTS
Northern and Western Blots
Northern and Western blot analyses were performed initially to ascertain whether Knpb1 and Ranbp5 mRNAs and proteins were present at detectable levels in the testis and to validate the tools required to perform subsequent cellular localization studies. Transcripts encoding each importin were readily detectable by Northern blot in the adult rat and mouse and in the immature rat testis, with transcript sizes of 5.3 and 4.3 kb for importin Knpb1 and 4.0 kb for Ranbp5 detected (Fig. 1A). Western blots performed using lysates of adult mouse testis and of total Embryonic Day 12.5 mouse identified bands of approximately 97 kDa for importin beta 1 and approximately 120 kDa for importin beta 3 (Fig. 1B), in agreement with their previously reported sizes [18].
|
Quantitative mRNA Measurements
Quantitative measurements of relative changes in the mRNAs encoding importins beta 1 and beta 3 were obtained using real-time PCR on total testis RNA samples from a range of mouse testis postnatal ages (Fig. 2). These were normalized to the Actb level measured in each sample. Knpb1 mRNA levels were significantly higher (approximately 2.58-fold) than at other ages on Day 26. In contrast, Ranbp5 levels were significantly higher (approximately 10-fold) on Day 26 and Day 42 than at earlier ages.
|
Cellular Localization of Importin Proteins and mRNAs in Adult Testes
Using in situ hybridization, Knpb1 mRNA was detected in the adult rat and mouse testis as a deep purple stain in the cytoplasm of spermatogonia, spermatocytes, and Sertoli cells. The mRNA signal was faint to absent in round and elongated spermatids and within the somatic cells of the interstitium (Fig. 3, A and C, and summarized in Fig. 3F). Importin beta1 protein was prominently observed following immunohistochemistry as a dark brown reaction product in the cytoplasm of spermatogonia and spermatocytes and Sertoli cells in both species (Fig. 3, B, D, and E, and summarized in Fig. 3F).
|
The Ranbp5 mRNA signal appeared to be exclusively present in round spermatids of adult rat and mouse testis (Fig. 3, GI, and summarized in Fig. 3L). Importin beta 3 protein appeared most predominant in elongated spermatids (Steps 1117; Fig. 3, J and K, and summarized in Fig. 3L). In the adult mouse testis, Knpb1 mRNA and protein expression paralleled that observed in the adult rat testis, with intense mRNA signal in round spermatids and protein staining in the cytoplasm of elongating spermatids. This pattern is in accord with a common observation that proteins required in late spermatids are produced from transcripts that are synthesized and stored in early spermatids [19].
Importin Synthesis and Localization in Developing Postnatal Testes
Through the period of rat testis development examined, representing the onset of the first wave of spermatogenesis, the most striking changes in the importin beta 1 signals were in germ cells. By in situ hybridization, importin beta 1 mRNA was readily observed in rat testis Sertoli cells at 1 dpp, but the gonocyte cytoplasm appeared devoid of signal, as evidenced by a clear ring circling the nuclei of these cells (Fig. 4A). In contrast, while the mRNA signal was also present at 19 dpp in Sertoli cells, a strong signal was readily detected in both germ cell types present, spermatogonia and spermatocytes (Fig. 4B). Throughout the first wave onset, at Days 1, 5, 10, and 19 dpp, importin beta 1 protein was apparent in Sertoli cells (Figs. 4, CE). The immunohistochemistry signal within gonocytes (1 dpp; Fig. 4C) was weak, but by 5 dpp, when these cells have transformed into spermatogonia, the importin beta 1 protein signal is very intense (Fig. 4D). This staining intensity appears to persist in some spermatogonia through 10 dpp (Fig. 4E) and into 19 dpp, where signal is also observed in the emerging spermatocyte population (Fig. 4F). In the developing and adult rat testis, while importin beta 1 protein was detected in endothelial and other interstitial cells, there was no clear evidence of Knpb1 mRNA signal in these cells, though the intensity of the signal from germ cells may have precluded observation of such a signal.
|
In summary, protein localization visualized with an antibody to importin beta 1 was in general accord with its observed mRNA localization pattern, being detected in spermatogonia and spermatocytes throughout the first wave of spermatogenesis as well as in the adult mouse testis. Similar expression patterns were observed for rat and mouse in newborn (0 dpp; mouse data not shown) and adult testes.
Only before or at the onset of the first wave of spermatogenesis was expression of importin beta 3 evident in somatic cells. At 1 dpp, Ranbp5 mRNA was readily observed in rat testis Sertoli cells but undetectable in the gonocyte cytoplasm (Fig. 4G). A signal was also evident in some cells surrounding the cords, most likely the precursor myoid cells. At 19 dpp, the Sertoli cell mRNA signal was relatively faint, but a strong signal was readily detected in both spermatogonia and spermatocytes (Fig. 4I). The importin beta 3 protein was observed in Sertoli cells at 1 dpp but not thereafter (Figs 4, JL). Importin beta 3 protein was evident in the cytoplasm of gonocytes at 1 dpp (Fig. 4J), with the signal varying between a faint to intense perinuclear ring. An intense cytoplasmic signal was detectable in spermatogonia at 5 dpp (Fig. 4K) and in spermatogonia and spermatocytes at 19 dpp (Fig. 4L).
Importin Protein Localization in the Fetal Gonad
Despite the known importance of nuclear import of SRY and Sox9 for correct male gonad development, the cellular expression pattern of importins in the fetal gonads has not been previously described. Importin beta 1 protein was detectable as a cytoplasmic protein in both somatic and germ cells of male and female gonads at the time of visible sexual differentiation, E12.5 (Fig. 5, B and F). The expression of importin beta 3 in both male and female fetal gonads was predominant, if not exclusively, in germ cells at E12.5. However, in the testis at E12.5, importin beta 3 protein appeared to be nearly all cytoplasmic (Fig. 5, G and H), while in the ovary at this time, the immunohistochemistry signal was predominantly nuclear in female germ cells (Fig. 5, C and D).
|
DISCUSSION
This study has demonstrated that two functionally distinct members of the importin family of nuclear transport proteins are produced by germ cells in a developmentally regulated manner. Synthesis of Knpb1 and Ranbp5 mRNAs as well as subcellular localization of their encoded proteins varied according to the stage of germ cell and testis maturation. The observations indicate that the capacity of these proteins to influence gene transcription and other functions performed by nuclear proteins is regulated by both transcriptional and posttranslational events.
The quantitative measurements of RNA across a range of mouse postnatal ages from birth through adulthood indicate that the relative expression levels of each Knbp1 and Ranbp5 are elevated with the emergence of meiotic (between 16 and 26 dpp) and postmeiotic (between 26 and 42 dpp) germ cell populations, respectively. These data obtained from the mouse testis are supported by the distinct patterns of cellular expression observed for each gene in the adult testis. Knbp1 and importin beta 1 protein are most prominent in spermatogonia and spermatocytes. In stark contrast, Ranbp5 mRNA is detected only in round spermatids, while the importin beta 3 protein appears to be exclusively present in elongated spermatids. The regulated production of these proteins suggests that they perform distinct functions that are required for specific stages of male germ cell development. The identification of Ranbp5 as a testis-enriched mRNA that is expressed in developing mouse germ cells was previously reported [20]. This earlier study presented lines of evidence that indicate that the Ranbp5 mRNA may be present in germ cell stages in addition to those described here. However, the use of DIG-labeled riboprobes for in situ hybridization in the present study afforded a precise cellular localization pattern for the predominant Ranbp5-encoding mRNA, observations that correlate with the real-time PCR data and the expression of importin beta 3 protein in elongating spermatids.
Importin beta 1 (also known as importin beta and Kapß1) is the best studied of the importins, with a central role in several nuclear import pathways. In the classical nuclear import scenario, it forms a heterotrimer with one of the cargo-binding importin alpha proteins and with a cargo protein bearing a basic nuclear localization sequence. Importin beta 1 mediates passage of this complex through the nuclear pore by interacting with nucleoporins and then interacts with the small GTPase Ran-GTP in the nucleus, which effects dissociation of complex and cargo delivery (reviewed in Goldfarb et al. [21]). Nuclear import can also occur in the absence of an importin alpha protein through direct binding of a cargo protein to one of the more than 20 unique importin beta proteins known in mouse. Transport of SRY and SOX9 provide examples of this transport mode [22, 23].
The timely nuclear translocation of the sex-determining transcription factors SRY and SOX9 is essential for normal testicular development in mammals [6]. Mutations that affect the capacity of the C-terminal nuclear localization signal in SRY to bind to importin beta 1, in the absence of effects on DNA bending or sequence specificity, are associated with sex reversal in humans [7]. The current observation of importin beta 1 protein in Sertoli cells in the fetal mouse testis is in accord with these findings. At the time of gonadal sex differentiation (E11.5 in the mouse testis), the fibroblast growth factor (FGF) receptor 2 (FGFR2) translocates into the nucleus in response to FGF9 binding, concurrent with the appearance of Sox9 protein in the Sertoli cell nucleus [24]; however, the mechanism by which this occurs is not directly known. Because importin beta 1 has been demonstrated to facilitate nuclear translocation of both the FGF receptor subunit and SOX9 in other cell types [2527], its presence in fetal Sertoli cells at the time of gonadal sex determination may be related to these steps that are vital for correct differentiation of the male gonad.
As the binding partner to the wide variety of importin alpha subunits, the presence of importin beta 1 in all mitotic germ cell types and in early meiotic cells is consistent with its established role in classical nuclear transport events involving an associated importin alpha protein. Additional functions have recently been ascribed to importin beta 1, including regulation of spindle, nuclear membrane and nuclear pore assembly in mitotic cells, and chaperone-like and regulation of movements along cytoskeletal elements in interphase cells, each of which is relevant to the developing male germ cell and merits investigation in this context.
Analyses of importins in extracts of Xenopus eggs and in mammalian cell lines revealed that both importin alpha and beta proteins govern mitotic progression by sequestering microtubule accessory proteins required for spindle assembly, preventing microtubule nucleation except in the vicinity of chromosomes, where RanGTP concentrations are high and importin cargo release is enabled [28]. In mammalian cell lines, the transient association of importin beta 1 during mitotic metaphase with spindle poles has been implicated in normal spindle assembly [29]. We report here the presence of Knpb1 mRNA and protein in both mitotic and meiotic germ cells, with neither detected in spermatids. The prospect that importin beta 1 is involved in both mitotic and meiotic spindle assembly in mammalian germ cells remains to be formally tested.
Transport of macromolecules into the nucleus of postmeiotic germ cells is required for the host of changes essential for assembly of mature spermatozoa, including the chromatin remodeling events associated with spermiogenesis. In the absence of importin beta 1 in spermatids, it is most likely that other importin beta homologues perform nuclear transport roles in meiotic and postmeiotic germ cells without the requirement for an importin alpha protein. The restricted localization of importin beta 3 protein to the elongating spermatids in the adult testis supports this concept, conceivably representing a mechanism for effecting translational regulation in postmeiotic male germ cells. Importin beta 3 (also named Ran BP5) has been implicated in nuclear transport of ribosomal proteins [30, 31] as well as of certain transcription factors and viral proteins [32, 33]. The abundance of importin beta family members appears to provide some degree of functional redundancy, as illustrated by the ability of importins beta 1, 2, 3, and 7 all to mediate nuclear transport of the ribosomal protein L23a, at least in vitro [31]. Chromatin remodeling in postmeiotic spermatids requires progressive removal of histones, import of transition proteins, removal of transition proteins, and addition of protamines [19], and the prospect that importin beta 3 or other importin family members facilitate these processes merits examination. The potential role for importin beta 3 to serve as a chaperone for these highly charged proteins is suggested by the observation that, in mitotic cells, the importin beta proteins can prevent histone H1 aggregation and facilitate its transport into the nucleus [34].
Importin beta 3 is detected predominantly as a cytoplasmic protein [18]. In germ cells of the fetal gonads, the gender-specific localization of importin beta 3 protein in either the nucleus (female) or the cytoplasm (male) indicates that this protein may perform roles that govern the functional transitions from an indifferent to a committed germ cell. It is shortly after this time that the gonocytes and oogonia enter mitotic and meiotic arrest, respectively. In this context, we propose that both importin beta 1 and beta 3 may interact with spindle-activating factors or other chromatin-associated proteins to mediate the changes associated with their specific cell cycle changes. Identification of importin beta 1 and beta 3 binding partners at this interval should further our understanding of the mechanism by which these processes are governed, and studies to assess this prospect are currently under way in our laboratory.
The distinct patterns of importin mRNA and protein observed in the developing and adult rodent testes support our original hypothesis that importins have discrete functions related to testis and germ cell development. Each may be required to transport factors between the nucleus and cytoplasm at specific stages of spermatogenesis. The relative affinity of each importin for target nuclear import sequences is known to vary, and this can be modulated by local posttranslational modifications as well as the presence of competing substrate [35]. We hypothesize that the developmentally regulated nuclear transport of proteins such as transcription factors that are crucial for spermatogenic progression may be in part mediated by these distinct shifts in synthesis of the nuclear transport machinery. The findings of this study provide the first comprehensive demonstration that synthesis of key nuclear transport proteins is developmentally regulated throughout the growth and development of an organ. We are now in a position to expand on the principle that normal gonadal development is governed by appropriate nuclear import of key cargo, as demonstrated by importin beta 1 import of SOX9. The present analysis provides the foundation for identification of key cargoes of importin beta 1 and beta 3 that will be related to the successful progression of spermatogenesis, information that should aid in efforts to both control and enhance fertility.
FOOTNOTES
1 Supported by NHMRC of Australia (Fellowships 143792 to K.L. and 334013 D.A.J.), the Australian Research Council, and the Institute for Advanced Studies of the Australian National University is hereby acknowledged. ![]()
2 Correspondence: Kate Loveland, Monash Institute of Reproduction and Development, 2731 Wright Street, Clayton, Victoria 3168, Australia. FAX: 6 13 9594 7111; kate.loveland{at}med.monash.edu.au ![]()
Received: 14 April 2005.
First decision: 12 May 2005.
Accepted: 28 September 2005.
REFERENCES
This article has been cited by other articles:
![]() |
K. Poplonska, M. Kwiatkowska, A. Wojtczak, and J. Polit Immunogold Evidence Suggests That Endoplasmic Reticulum Is the Site of Protamine-Type Protein Synthesis and Participates in Translocation of These Proteins into the Nucleus During Chara vulgaris Spermiogenesis Biol Reprod, March 1, 2009; 80(3): 572 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Pradeepa, S. Manjunatha, V. Sathish, S. Agrawal, and M. R. S. Rao Involvement of Importin-4 in the Transport of Transition Protein 2 into the Spermatid Nucleus Mol. Cell. Biol., July 1, 2008; 28(13): 4331 - 4341. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Quan, Z.-L. Ji, X. Wang, A. M. Tartakoff, and T. Tao Evolutionary and Transcriptional Analysis of Karyopherin {beta} Superfamily Proteins Mol. Cell. Proteomics, July 1, 2008; 7(7): 1254 - 1269. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |