Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print October 5, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.046748
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/2/253    most recent
biolreprod.105.046748v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.
Agricola
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.
BIOLOGY OF REPRODUCTION 74, 253–264 (2006)
DOI: 10.1095/biolreprod.105.046748
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Monozygotic Twin Model Reveals Novel Embryo-Induced Transcriptome Changes of Bovine Endometrium in the Preattachment Period1

Claudia Klein 3 4, Stefan Bauersachs 3 45 , Susanne E. Ulbrich 6, Ralf Einspanier 7, Heinrich H.D. Meyer 6, Susanne E.M. Schmidt 4, Horst-Dieter Reichenbach 8, Margarete Vermehren 9, Fred Sinowatz 9, Helmut Blum 5, and Eckhard Wolf 2 4,5

Institute of Molecular Animal Breeding and Biotechnology,4 Laboratory for Functional Genome Analysis,5 Gene Center, Ludwig-Maximilians University, 81377 Munich, Germany Physiology-Weihenstephan,6 Technical University of Munich, 85354 Freising, Germany Institute of Veterinary Biochemistry,7 Free University of Berlin, 14163 Berlin, Germany Institute of Animal Breeding,8 Bavarian Research Center for Agriculture, 85586 Grub, Germany Institute of Veterinary Anatomy, Histology and Embryology,9 Ludwig-Maximilians University, 80539 Munich, Germany

ABSTRACT

Initiation and maintenance of pregnancy are critically dependent on an intact embryo-maternal communication in the preimplantation period. To get new insights into molecular mechanisms underlying this complex dialog, a holistic transcriptome study of endometrium samples from Day 18 pregnant vs. nonpregnant twin cows was performed. This genetically defined model system facilitated the identification of specific conceptus-induced changes of the endometrium transcriptome. Using a combination of subtracted cDNA libraries and cDNA array hybridization, 87 different genes were identified as upregulated in pregnant animals. Almost one half of these genes are known to be stimulated by type I interferons. For the ISG15ylation system, which is assumed to play an important role in interferon tau (IFNT) signaling, mRNAs of four potential components (IFITM1, IFITM3, HSXIAPAF1, and DTX3L) were found at increased levels in addition to ISG15 and UBE1L. These results were further substantiated by colocalization of these mRNAs in the endometrium of pregnant animals shown by in situ hybridization. A functional classification of the identified genes revealed several different biological processes involved in the preparation of the endometrium for the attachment and implantation of the embryo. Specifically, elevated transcript levels were found for genes involved in modulation of the maternal immune system, genes relevant for cell adhesion, and for remodeling of the endometrium. This first systematic study of maternal transcriptome changes in response to the presence of an embryo on Day 18 of pregnancy in cattle is an important step toward deciphering the embryo-maternal dialog using a systems biology approach.

Bos taurus, conceptus, embryo-maternal cross talk, gene regulation, implantation, microarray, pregnancy, SSH, uterus

INTRODUCTION

Establishment and maintenance of a pregnancy are critically dependent on an intact embryo-maternal communication. In ruminants, interferon tau (IFNT) has been identified as the major embryonic pregnancy recognition signal that prevents luteolysis and prepares the endometrium for the implantation of the embryo that occurs after Day 18 of gestation. IFNT is a type I interferon [1] encoded by multiple genes [2], which mediates its effects by binding to endometrial type I IFN receptors [3]. IFNT mRNA is specifically localized in the extraembryonic mononucleate trophoblast cells [4]. Maximum secretion of IFNT occurs at Day 17 [5], which coincides with the time of maternal recognition of pregnancy. Several studies have shown that intrauterine application of recombinant IFNT or interferon alpha results in a prolongation of the estrous cycle [6–8]. IFNT has been shown to induce the expression of a number of genes, such as interferon-stimulated gene 15 (ISG15) [9–11], 2'-5'-oligoadenylate synthetase (OAS) [12], bovine ubiquitin activating E1-like enzyme (UBE1L) [13], members of the 1–8 family (IFITM1–3) [14], MX1 and MX2 [15], granulocyte-macrophage colony stimulating factor 1 (GMCSF1) [16], interferon regulatory factors 1 (IRF1) and 2 (IRF2) [17] and signal transducer and activator of transcription 1 (STAT1) and 2 (STAT2) [18]. Thus, IFNT supports the maintenance of a pregnancy via multiple mechanisms.

Even though many experimental findings indicate a pivotal role of IFNT in the context of embryo-maternal communication in ruminants, a number of other systems may be involved, such as the insulin-like growth factor (IGF) system, growth hormone, fibroblast growth factors, vascular endothelial growth factor, transforming growth factor beta, and the hyaluronic acid system (reviewed in [19]).

In several nonruminant species, e.g., mouse, rhesus monkey, and human, microarray analyses were undertaken to find mRNAs with differential expression levels during embryonic implantation or during the stage of the sexual cycle coincident with the window of implantation [20–23]. These studies revealed numerous genes that may have important functions during the outlined processes. But in contrast with primates and rodents, where a hemochorial placenta is formed, in cattle and other ruminants, an epitheliochorial placenta develops by a relatively noninvasive placentation process and also the time of implantation is different. Therefore, it is essential to perform a transcriptome analysis also in ruminants. Recently, more than 130 genes were identified as differentially regulated in the bovine endometrium between the estrous and the diestrous stage using a combination of subtracted cDNA libraries and array hybridization [24] to provide basal information about gene expression changes during the estrous cycle. In the present study, we applied a similar approach to identify genes upregulated in the bovine endometrium due to the presence of a conceptus at Day 18 of gestation—the preimplantation stage. The experimental design used the genetic uniformity of monozygotic twin pairs to eliminate effects of genetic variability on endometrium gene expression profiles [25].

MATERIALS AND METHODS

Animals and Tissue Collection

The estrous cycle of five monozygotic twin pairs (Simmental cows, nonlactating; Institute of Animal Breeding, Bavarian Research Center for Agirculture), generated by embryo splitting, which had given birth to one or two calves previously, was synchronized by a single intramuscular injection of 500 µg Cloprostenol (Estrumate; Essex Tierarznei, München, Germany) at diestrus. Animals were observed for sexual behavior (i.e., toleration, sweating, vaginal mucus) to determine standing heat, which occurred around 60 h after Estrumate injection. Seven days after standing heat, two in vitro-produced bovine blastocysts (Day 7 after in vitro fertilization) in 200 µl culture medium were transferred into the ipsilateral uterine horn of one twin of each pair. In vitro production of embryos was performed as described previously [26], with minor modifications. The corresponding twin served as a control and received a sham transfer of the same amount of transfer medium without embryos. On Day 18 of pregnancy, or of the estrous cycle, respectively, the animals were slaughtered. Blood samples for determination of serum progesterone levels were taken just before slaughter. All animals displayed high progesterone values (mean 3.7 ng/ml), which did not differ significantly between both groups, indicating the presence of an endocrinologically active corpus luteum. The uterine horns were opened longitudinally with a scissors and intercaruncular endometrial tissue samples from defined uterine regions (for further details see [24]) were dissected using a scalpel. Pregnancy was confirmed by the presence of an apparently normal conceptus in the uterine lumen. Tissue samples of the endometrium were transferred into tubes containing 4 ml of RNAlater (Ambion, Huntington, U.K.) within 20 min after slaughter, stored overnight at 4°C and then at –20°C until further processing. For gene expression analyses, only those tissue samples of pregnant animals, which had been in contact with an embryo were used, i.e., the middle and caudal sections of the uterine horn ipsilateral to the ovary bearing the corpus luteum. In control animals, endometrial samples from the same uterine sections were analyzed. All experiments with animals were carried out with permission from the local veterinary authorities.

Generation of Subtracted cDNA Libraries and Array Hybridization

One twin pair was selected for the preparation of a subtracted library enriched for cDNAs of genes upregulated due to the presence of a conceptus during the preimplantation period. Total RNA was isolated using Trizol reagent (Invitrogen, Karlsruhe, Germany) according to the manufacturer's recommendations. Quality of total RNA was checked by agarose gel electrophoresis and quantity was determined by spectrometry. Double-stranded cDNA was synthesized starting from 50 µg of total RNA using Superscript II (Invitrogen) for first strand synthesis and cDNA primer 1 (AACTGCGGCCGCGTACAGCT20VN, V = A, C, or G). The second strand was synthesized with RNase H, Escherichia coli DNA ligase, and E. coli DNA polymerase I (Invitrogen) according to the manufacturer's instructions. The first subtracted library was generated using the suppression subtractive hybridization (SSH) method [27] and was done as reported previously by Bauersachs et al. [28] with a minor modification: at the second step of subtractive hybridization, no driver cDNA was added. A second library was constructed using a purchased subtracted cDNA (vertis AG, Freising, Germany). Subtraction was performed as previously described by Ros and coworkers [29] using the same RNA samples as used for construction of the SSH library. Preparation of cDNA arrays and hybridization were done as previously described [30]. In brief, 4608 cDNA clones (SSH 3072, vertis library 1536) were randomly picked from the libraries, cDNA inserts amplified by PCR and used to prepare three cDNA arrays containing 1536 PCR products each. The cDNA arrays were hybridized with 33P-labeled cDNA probes derived from the endometrial tissue samples of the five twin pairs.

Analysis of Array Data

Array analysis was done using AIDA Image Analyzer software (Version 4.00, Raytest, Straubenhardt, Germany). Background was subtracted with the function weighted image regions. For further analysis, raw data (integral minus background) were exported to Microsoft Excel and normalized to the median signal intensity of internal reference cDNA clones of each array. Pairwise comparison (pregnant-control) was performed within twin pairs, thus eliminating changes in gene expression due to a different genetic background of individuals. Complementary DNA clones that exhibited a difference in signal intensity of 2-fold or more in four out of five twin pairs were assumed to be upregulated at the preimplantation period. To test significance of expression differences, a paired Student t-test was performed and the coefficient of variation (CV) of the expression ratios between pregnant and nonpregnant animals was calculated. Due to the nature of subtracted libraries, 37 genes were represented by more than one cDNA fragment on the arrays. The expression ratios of these genes resulted from the mean of the obtained signal ratios of the corresponding cDNA fragments. Deposits have been made in NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number GSE3677.

Sequencing of cDNAs with Differential Hybridization Signals and Data Analysis

Those cDNA clones that showed a difference in signal intensity of 2-fold or more in at least four out of five twin pairs were sequenced directly from spotting solutions by automated DNA sequencing (3100-Avant Genetic Analyzer; Applied Biosystems, Langen, Germany). Resulting sequences were compared with public sequence databases using the basic local alignment search tool at the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/blast/blast.cgi). The cDNAs without similar entries in the nr database subset (all GenBank + RefSeq Nucleotides + EMBL + DDBJ + PDB sequences, but no EST, STS, GSS, or phase 0, 1, or 2 HTGS sequences) were in addition compared with the est database subset (database of GenBank + EMBL + DDBJ sequences from EST divisions) or the raw version of the bovine genome (http://pre.ensembl.org/Multi/blastview?species=Bos_taurus). Based on the data for the human orthologous genes, simplified gene ontologies were built of the data obtained with the gene ontology filter function of the Bibliosphere software (Version 5.02; GenomatiX, Munich, Germany) to categorize the genes regarding their molecular function or the biological processes in which they are involved, respectively. Resulting data were supplemented with additional information from Entrez Gene (www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene) and from the literature. Bibliosphere was further used to identify relationships between the identified genes based on cocitations in NCBI Pubmed. Cocitations were limited to sentence level, i.e., two genes are cocited in the same sentence. Sequences were deposited in GeneBank (dbEST) with accession numbers DV936132–DV936579.

Real-Time RT-PCR

The same RNA samples as for array hybridization were used. The concentration of the total RNA, which was subjected to cDNA synthesis, was exactly determined by UV spectrometry. One microgram of each sample of total RNA was reverse transcribed in a total volume of 60 µl, containing 1x buffer (Promega, Madison, WI), 0.5 mM dNTPs (Roche, Mannheim, Germany), 2.5 µM hexamer primers (Gibco BRL, Grand Island), and 200 U M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Promega). Primers were designed to amplify specific fragments referring to selected regulated genes: C1R (for 5'-AGGGGATAGTGGAGGGGTC; rev 5'-GGACATTGGTGTAAAACCCG [117 bp]), C1S (for 5'-AACAGGAGTGGGTCATCCAG; rev 5'-CGGCTGTGTTGGTCTTTCAG [149 bp]), DTX3L (for 5'-AAAGGATGTCTTGAGCCAAGC; rev 5'-CTCCAGAAATGACAACCTTGC [139 bp]), HSXIAPAF1 (for 5'-GAGGAGGCTCTGAGCTTGC; rev 5'-GCAGAGAAAGATGTCCGTCC [143 bp]), IFITM3 (for 5'-CGTGTGGTCCCTGTTCAAC; rev 5'-CCATCTTCCGGTCCCTAGAC [95 bp]), ISG15 (for 5'-GACAGCAGGGAGGTGCTG; rev 5'-ACCCTTGTCGTTCCTCACC [203 bp]), SERPING1 (for 5'-ACCAACCTCAGGATCAGGC; rev 5'-CTATCTTCCACTTGGCGCTC [97 bp]), UBE1L (for 5'-GTGTTCATACCGCACGTGAC; rev 5'-GGTTGTGGCAGGAATGTACC [105 bp]), UTMP (for 5'-ATATCATCTTCTCCCCCATGG; rev 5'-GTGCACATCCAACAGTTTGG [126 bp]), and the mRNA for polyubiquitin (Z18245) as a housekeeping gene (for 5'-AGATCCAGGATAAGGAAGGCAT; rev 5'-GCTCCACCTCCAGGGTGAT [198 bp]) (referring to [31]). All amplified PCR fragments were sequenced with forward and reverse primers (3100-Avant Genetic Analyzer; Applied Biosystems) to verify the resulting PCR product. Thereafter, the specific melting point of the amplified product served as verification of the product identity [32]. For each of the following real-time PCR reactions, 1 µl of cDNA was used to amplify specific target genes. Quantitative real-time PCR reactions using the LightCycler DNA Master SYBR Green I protocol (Roche) were performed as described previously [32]. In each PCR reaction, 17 ng/µl cDNA were introduced and amplified in a 10-µl reaction mixture (3 mM MgCl2, 0.4 µM primer forward and reverse each, 1x Light Cycler DNA Master SYBR Green I; Roche) using a real-time LightCycler instrument (Roche). The annealing temperature was 60°C for all reactions. To ensure an accurate quantification, a high-temperature fluorescence measurement was undertaken in a fourth segment of the PCR (C1R and UTMP 80°C, C1S and IFITM3 81°C, DTX3L and HSXIAPAF1 75°C, ISG15 87°C, SERPING1 83°C, UBE1L 82°C and polyubiquitin 78°C, respectively). As negative controls, water instead of cDNA was used.

Data Analysis of Real-time RT-PCR

The cycle number required to achieve a definite SYBR Green fluorescence signal (= crossing point; CP) was calculated by the second derivative maximum method (LightCycler software, version 3.5.28) [32]. The CP is correlated inversely with the logarithm of the initial template concentration. The housekeeping gene polyubiquitin showed no statistical difference between pregnant and control animals. Therefore, the CP determined for the target genes were normalized against ubiquitin ({Delta}CP). Differences between pregnant (ET) and control animals are stated as {Delta}{Delta}CP [33]. From the {Delta}{Delta}CP of every twin pair, the fold change was calculated. Significance of differences between groups was tested using a paired Student t-test.

In Situ Hybridization

In situ hybridization was performed as previously described [24]. The sequences of the antisense oligonucleotides were as follows: C1R: 5'-GGACATTGGTGTAAAACCCG, C1S: 5'-CTGGATGACCCACTCCTGTT, DTX3L: 5'-GCTTGGCTCAAGACATCCTTT, HSXIAPAF1: 5'-GCAGAGAAAGATGTCCGTCC, IFITM3: 5'-CCATCTTCCGGTCCCTAGAC, SERPING1: 5'-CTATCTTCCACTTGGCGCTC, and UBE1L: 5'-GTCACGTGCGGTATGAACAC. Negative controls were done omitting the oligonucleotide probe and by hybridization with sense oligonucleotide probes (complementary sequences of the antisense oligonucleotides).

Results

Detection of Differentially Expressed Genes in Endometrial Tissue Samples of Pregnant and Nonpregnant Animals

Total RNA was isolated from endometrial tissue samples obtained from five twin pairs at Day 18 of gestation or Day 18 of the estrous cycle for the control twins, respectively. Two subtracted cDNA libraries were constructed using two different subtraction techniques to enrich genes upregulated in the bovine endometrium due to the presence of a conceptus and were analyzed by cDNA array hybridization. Figure 1 illustrates the experimental strategy. A total of 4608 individual cDNA clones were analyzed by array hybridization. Expression ratios for every twin pair were calculated, resulting in 375 cDNA fragments that displayed a difference in signal intensity of 2-fold or more in at least four out of five twin pairs. Sequence analysis revealed 87 different genes or mRNAs, respectively (Table 1). Fifteen genes displayed a difference in signal intensity of 2-fold or more in only four out of five twin pairs, whereas the signal ratio for the fifth twin pair ranged from 1.1 to 1.96 in these cases. For three of these genes, the t-test P value was slightly higher than 0.05, but they were still assumed to be upregulated. The mean coefficient of variation of expression ratio between pregnant and nonpregnant was 41%. Eighty genes corresponded to genes with known or inferred function, either the bovine gene or the human orthologue. For 7 genes, a match with bovine ESTs was obtained only. The expression of 38 genes has been previously described to be stimulated by type I interferons (Table 1). To get an overview of the identified genes regarding their function, a simplified gene ontology classification was performed based on the human orthologous genes. In Table 1, genes are sorted according to their apparent function or the biological process in which they play a role. The majority of genes are either involved in one of the biological processes: regulation of gene expression; cell communication; and cell growth, proliferation, and differentiation; or exhibit cell adhesion molecule activity or an immune-related function (Fig. 2).


Figure 1
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1. Overview of the experimental design for the identification of specific transcriptome patterns at Day 18 of pregnancy. The use of monozygotic twins eliminates genetic variability as a factor potentially causing differences in transcriptome profiles


View this table:
[in this window]
[in a new window]
 
TABLE 1. Genes that show higher mRNA expression levels in bovine endometrium of pregnant animals


View this table:
[in this window]
[in a new window]
 
TABLE 1. Continued


View this table:
[in this window]
[in a new window]
 
TABLE 1. Continued


Figure 2
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. Classification of the identified genes into functional categories. Multiple naming is possible

Validation and Precise Quantification of mRNA Expression by Quantitative Real-Time RT-PCR for Selected Genes

For nine selected genes (C1S, C1R, DTX3L, HSXIAPAF1, IFITM3, ISG15, SERPING1, UBE1L, and UTMP), the expression in the bovine endometrium was quantified by the use of real-time RT-PCR (qPCR) to verify the results obtained by array hybridization and to perform more precise quantitative measurements for these transcripts. The same 10 RNA samples as for hybridization experiments were used. In addition to the fold-upregulation revealed by qPCR and by array hybridization, Table 2 shows the mean of the CP, the mean of the CP normalized to the polyubiquitin mRNA ({Delta}CP), and the expression difference in form of the {Delta}{Delta}CP. On the basis of the CP, the expression level of the mRNAs can be estimated (low CP = high and high CP = low expression). The abundance of all investigated transcripts was significantly higher in the pregnant stage. The highest expression ratio (186-fold) was found for the ISG15 mRNA. The ratios found by qPCR were in most cases slightly higher and in some cases, e.g., UTMP and ISG15, clearly higher compared with those obtained by array hybridization. The reasons for deviations in expression ratios between array hybridization and qPCR have already been discussed elsewhere [30]. Overall, the results of qPCR and array hybridization correlated very well.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Validation of array results by quantitative real-time RT-PCR.a

Localization of mRNA Expression for C1S, C1R, DTX3L HSXIAPAF1, IFITM3, SERPING1, and UBE1L by In Situ Hybridization

For seven selected genes (C1S, C1R, DTX3L, HSXIAPAF1, IFITM3, SERPING1, and UBE1L), in situ hybridization with bovine endometrial tissue sections was performed to localize the mRNA expression in this complex tissue. A specific pattern of mRNA distribution was found for each of these genes (Fig. 3). The hybridization signal was always confined to cells of the endometrium and was absent in the myometrium and the serosa. No specific signals were observed in sections hybridized with the sense strand (Fig. 3c) or in sections incubated with buffer only instead of the oligonucleotide probe (not shown). Table 3 summarizes the results of the in situ hybridization experiments. The mRNAs of DTX3L, IFITM3, HSXIAPAF1, and UBE1L, which were selected due to their potential role in the ISG15ylation system showed a very similar expression pattern with strong signals in the luminal epithelium (except for DTX3L), in the superficial and deep uterine glands, and weak expression in stromal cells. The three members of the complement system also showed a similar expression pattern. Colocalization was found in the luminal epithelium and the superficial glands. Specific expression of SERPING1 mRNA was not detectable in stromal cells.


Figure 3
View larger version (118K):
[in this window]
[in a new window]
 
FIG. 3. In situ hybridization. Endometrial tissue samples were obtained from animals slaughtered at Day 18 of gestation for the detection of C1S, C1R, IFITM3, HSXIAPAF1, SERPING1, and UBE1L mRNAs. Endometrial sections near the epithelial surface (a), of the deep uterine glands (b), and the corresponding sense controls (c) are shown. Original magnification x50, C1R (a) x62.5


View this table:
[in this window]
[in a new window]
 
TABLE 3. Results of in situ hybridization with bovine endometrium.a

Analysis of Gene Expression Data Using a Literature Data Mining Tool

For the identification of interactions between the differentially expressed genes, cocitations of input genes in NCBI PubMed abstracts were identified using data-mining software (Bibliosphere). This software requires a gene list in the form of a unique identifier (e.g., GenBank accession number, gene ID, or gene symbol) as input and searches NCBI Pubmed based on all approved gene names or aliases for every gene. Cocitations are identified and can be viewed as networks, so-called bibliospheres. Furthermore, expert curated interactions (i.e., interaction of the corresponding proteins was evaluated by an expert of GenomatiX on the basis of the scientific literature) and molecular pathways can be integrated. Figure 4 shows exemplary two bibliospheres centered for ISG15 or STAT1, respectively, two central genes of the IFNT response, which are cocited with 12 or 17 genes, at the sentence level (two genes are cocited in the same sentence).


Figure 4
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Bibliosphere pathway view for ISG15 and STAT1. Literature data mining software (Bibliosphere) was used to identify cocited genes in NCBI Pubmed abstracts. A bibliosphere centered for ISG15 or for STAT1, respectively, was generated restricted to sentence level, which means two genes or proteins are cocited in the same sentence. IRF1 and STAT1 are transcription factors. The number of cocitations is indicated. Two signaling pathways were assigned to the ISG15 bibliosphere. Dashed lines stand for cocitation and identification of a putative binding site for the corresponding transcription factor. Transcription of the IRF1 gene is regulated by STAT1

Discussion

The objective of the present study was to elucidate changes in gene expression of the bovine endometrium due to the presence of a conceptus at the preimplantation stage, i.e., Day 18 of gestation. Only a few other studies have been conducted to investigate genes involved in the process of embryonic implantation in the rhesus monkey [21] and in mice [20, 22], and this is, to our knowledge, the first study of this kind in the bovine species. The study was performed using monozygotic twin pairs, which is a unique possibility to eliminate genetic variability as a factor potentially affecting the results of gene expression analyses. Eighty-seven different genes were detected as upregulated in the bovine endometrium of pregnant vs. control animals at Day 18 of gestation. The main criterion for upregulation was a difference in signal intensity of 2-fold or more in at least four out of five twin pairs. Significance of changes in gene expression levels was tested using a paired Student t-test. Although four genes exhibited a P value slightly higher than 0.050, they were assumed to be interesting genes because they fulfilled the main criterion and exhibited a regulation in the same direction in the fifth twin pair or showed a very high level of average upregulation in the case of LY6G6C, respectively. The moderate variation of expression ratios between pregnant and nonpregnant animals (mean coefficient of variation, 41%) indicates consistent mechanisms of gene regulation.

Genes Stimulated by Type I Interferons

The expression of 38 of the identified genes is known to be stimulated by type I interferons, reflecting the response to IFNT, which is the embryonic pregnancy recognition signal in ruminants. Several of these genes have already been described in the context of early pregnancy in ruminants, like ISG15 [9–11], OAS [12], IRF1 [17], IFITM1 and IFITM3 [14], MX1 and MX2 [15], MHCI and B2M [34], but only little information exists concerning the putative roles of these interferon stimulated genes in the context of early pregnancy. The 2', 5'-oligoadenylate synthetase is hypothesized to affect PGF2{alpha} secretion by the endometrial epithelium, possibly by altering arachidonic acid metabolism [12]. The MX protein is assumed to function as a conceptus-induced component of the antiluteolytic mechanism and/or regulator of endometrial secretion or uterine remodeling [35]. IFITM1 and IFITM3 proteins might function in adhesion of the conceptus because members of the 1–8 family are involved in interferon-stimulated adhesion processes [36, 37]. Furthermore, IFITM1 protein was shown to suppress the activity of natural killer cells [38], suggesting a role in preventing maternal rejection of the fetal semiallograft. GBP1, GBP3–5, MX1, and MX2 are members of an interferon-inducible family of large GTPases. A unique feature of the encoded proteins is their ability to hydrolize GTP to GDP and GMP [39]. In human endometrium samples, induction of GBP1 mRNA has been shown during the window of implantation [40]. In consideration of the important role of GTPases in cell proliferation, differentiation, signal transduction, and intracellular protein transport [41–43], the expression profile of GBP1 mRNA in human endometrium and the increased expression in endometrium of Day 18 pregnant animals shown for GBP1, GBP3–5, MX1, and MX2 in the present study suggests that this gene family could play an important role in the process of implantation. G1P3 and ISG12a are members of a recently identified gene family [44]. For ISG12a, enhanced expression in human endometrium during the window of implantation has been shown. However, the specific function of G1P3 and ISG12a is still unknown.

With the signal transducer and activator of transcription 1 (STAT1), a central member of the IFNT signal-transduction cascade was identified. In response to IFNT, STAT proteins become tyrosine-phosphorylated, translocate into the nucleus, and form homo- and heterodimers. They bind to specific response elements present in the regulatory region of genes stimulated by interferons [18]. STAT1 homodimers increase the expression of genes, such as interferon regulatory factor 1 (IRF1) [45]. The mRNA of this gene exhibited a 3-fold upregulation in the present study.

A further particular interesting gene is ISG15 and recently several studies were dedicated to clarify the role of the ISG15 protein at the embryo-maternal interface [9, 10, 46]. ISG15, one of the most markedly upregulated genes in the present study, encodes a ubiquitin-like protein [47] that is conjugated to intracellular proteins [48]. Recently identified proteins that become conjugated to ISG15 include several serine proteinase inhibitors [49] and signal transduction proteins, like phospholipase C gamma1, JAK1, ERK1, and STAT1 [50, 51]. Because conjugated ISG15 remains in the uterus as late as Day 45 of pregnancy, Austin and coworkers [10] postulated that one function of ISG15 is to stabilize proteins rather than target them to degradation as described for polyubiquitination. In the present study, the gene for bovine ubiquitin-activating enzyme-1-like protein (UBE1L), the initiating enzyme for ISG15ylation [13], was also identified as an upregulated gene. Furthermore, the mRNAs of IFITM1 and IFITM3, encoding proteins hypothesized to possess E2 enzyme activity based on a conserved E2 motif in the protein sequence, were found to be upregulated in endometrium from pregnant animals [14]. Until now, E3 enzymes specific for ISG15 have not been identified. In this study, we found upregulated mRNA levels for DTX3L, coding for a protein with E3 ubiquitin ligase activity [52]. In addition, HSXIAPAF1 (XAF1) mRNA levels were increased in pregnant endometrium. The product of this gene was described as antagonist of XIAP [53], an antiapoptotic protein that possesses E3 ubiquitin ligase activity [54]. If XIAP plays a role in ISG15ylation due to its E3 ligase activity, it would be possible that HSXIAPAF1, as inhibitor of XIAP, plays a role in regulation of the ISG15ylation system. The mRNA expression patterns of IFITM3, DTX3L, and HSXIAPAF1 revealed by in situ hybridization in the bovine endometrium were very similar to that of UBE1L. Based on this result and the described functions in the literature, these genes can be seen as potential components of the ISG15 system and are probably involved in the regulation of the response of the endometrium to the signaling of the embryo.

Regulation of the Maternal Immune System in the Endometrium

The intense cross talk of the maternal endometrium with the fetal semiallograft is reflected in the upregulation of various genes participating in cell communication, as well as those with immune-related functions. The conceptus triggers a specific reaction of the local immune system in the endometrium, which is particularly reflected in the enhanced expression of several complement components. The in situ hybridization experiments revealed specific expression of C1S and C1R mRNA mainly in the luminal and glandular epithelial cells but also weakly in the stromal cells. The simultaneous upregulation of SERPING1, encoding a protein known as C1 inhibitor [55], in the luminal and glandular epithelial cells could be a mechanism to protect the embryo against an attack of the complement system. UTMP is another gene that may play a role in the modulation of the maternal immune system. For the ovine UTMP protein inhibition of NK-like activity was shown and a role in protecting the conceptus from maternal cytotoxic lymphocytes was suggested [56]. As in our study of pregnant cows, UTMP mRNA was found to be upregulated in endometrium of pregnant sheep [57].

Genes Involved in Cell Adhesion

In domestic ruminants, endometrial invasion, as it takes place in humans and rodents, does not occur; thus definite implantation is achieved by tight adhesion of the mononuclear trophoblast cells to the endometrial luminal epithelium. The present study revealed three genes, whose products are involved in cell adhesion; CTGF, GPLD1, and MFGE8. None of them has been mentioned to play a role in bovine implantation yet. Connective tissue growth factor (CTGF) has been shown to promote cell adhesion directly by binding to two integrins, namely alpha(v)beta(3) and alpha(2b)beta(3) [58, 59]. The analysis of the deduced amino acid sequence of GPLD1, the glycosylphosphatidylinositol-specific phospholipase D1, revealed four regions of internal homology, which show a significant similarity with the metal ion-binding domains of the alpha subunits of integrins. These sequences share an aspartate-rich core flanked by short, conserved segments that occur only in integrins and glycoproteins involved in cell adhesion [60]. MFGE8 is the gene-encoding milk fat globule-EGF factor 8, which contains an Arg-Gly-Asp (RGD) cell adhesion sequence motif recognized by integrin receptors [61, 62] and, moreover, functional analyses have shown that MFGE8 protein is a specific ligand for certain integrins [63].

Endometrium Remodeling

The categorization of the identified genes according to their function revealed the orchestrated interaction of various processes and mechanisms with regard to the preparation of the maternal endometrium for embryonic implantation. Genes involved in cell growth, proliferation, and differentiation as well as regulation of gene expression and regulation of apoptosis underline the extensive molecular and structural changes taking place during the preimplantation stage, which involve, for example, reorganization of the luminal epithelium [64] and synthesis and secretion of histotroph by the glandular epithelium [65]. With MMP19 and TIMP2, two genes coding for components of the matrix metalloproteinase system, which is classically considered to be involved in tissue remodeling, were identified. Until now, neither MMP19 nor TIMP2 mRNA has been described to be upregulated in the bovine endometrium around the time of embryonic implantation. A study in normal breast tissue and mammary-gland tumors revealed strong expression of MMP19 protein in all tumor cells of benign lesions, whereas the progression toward an invasive phenotype and neoplastic dedifferentiation led to the disappearance of MMP19, and a concomitant rise in the levels of MMP2 protein was observed [66]. These findings suggest an important role of MMP19 and TIMP2, the inhibitor of MMP2 [67], for the regulation of the conceptus attachment.

CTGF, which is assumed to be involved in stromal remodeling and uterine cell growth, has been studied at the utero-placental interface in pigs [68], mice [69], and humans [70]. This is the first description of CTGF mRNA expression in the bovine endometrium at Day 18 of gestation, and CTGF protein seems to be a universal factor involved in endometrial remodeling with regard to the variety of species exhibiting increased expression of CTGF mRNA in the maternal environment during the implantation period. As another gene important for endometrium remodeling, EPSTI1 was found, and mRNA expression in bovine endometrium was shown for the first time. The expression of EPSTI1 mRNA has been shown in tissues characterized by extensive epithelial-stromal interaction and there is evidence that EPSTI1 expression reflects an important event associated with organ development and tissue remodeling. Using a tissue mRNA panel, the most prominent expression has been detected in human placenta [71], underlining the potential importance of this gene for endometrial remodeling before attachment of the embryo.

Insulin-Like Growth Factor System

The insulin-like growth factor system is assumed to play a vital role in endometrial tissue remodeling by regulating uterine growth [19]. The changes in abundance of the mRNAs of IGFBP2 and CTGF, encoding a low-affinity IGF-binding protein, indicate the potential importance of IGFBP regulation of uterine IGFs during this time period. Furthermore, upregulation of MMP19 protein might lead to proteolysis of IGFBP3, which was shown to result in increased IGF signaling in human keratinocytes [72].

Expression Levels of Some Genes Are Rather Maintained at a Higher Level than Induced by the Embryo

The expression of six genes, namely ATP1B2, IDH1, LY6G6C, MS4A8B, PENK, and TIMP2, is likely to not be specifically upregulated by the presence of a conceptus because they were identified as upregulated at diestrus in a study of transcriptome changes in bovine intercaruncular endometrium comparing late estrus and diestrus [24]. The regulation of these genes can be explained in the way that the presence of the embryo maintains a high level of expression by preventing the progression of the estrous cycle.

In conclusion, this study provides a holistic view of the quantitative changes of endometrial transcript levels associated with the complex embryo-maternal cross talk in the bovine species. The importance of IFNT as an embryo-derived pregnancy recognition signal is underlined. The identification of several new genes, which are assumed to be important for endometrial preparation with respect to conceptus attachment, provides many new starting points for more detailed investigations. Future studies will investigate earlier stages of pregnancy using a similar approach to provide a comprehensive view of the dynamic transcriptome changes underlying maternal pregnancy recognition.

ACKNOWLEDGMENTS

We thank Myriam Weppert for in vitro production of the bovine embryos and Maximilian Pickl from the Institute of Animal Breeding of the Bavarian Research Center for Agriculture in Grub for organization of the slaughter of the animals.

FOOTNOTES

1 Supported by the Deutsche Forschungsgemeinschaft (FOR 478/1) and the H. Wilhelm Schaumann Stiftung. Back

2 Correspondence: FAX: 49 89 218076849; ewolf{at}lmb.uni-muenchen.de Back

3 These authors contributed equally to this work. Back

Received: 18 August 2005.

First decision: 12 September 2005.

Accepted: 30 September 2005.

REFERENCES

  1. Martal JL, Chene NM, Huynh LP, L'Haridon RM, Reinaud PB, Guillomot MW, Charlier MA, Charpigny SY, IFN-tau: a novel subtype I IFN1. Structural characteristics, non-ubiquitous expression, structure-function relationships, a pregnancy hormonal embryonic signal and cross-species therapeutic potentialities. Biochimie 1998 80:755-777[Medline]
  2. Ealy AD, Green JA, Alexenko AP, Keisler DH, Roberts RM, Different ovine interferon-tau genes are not expressed identically and their protein products display different activities. Biol Reprod 1998 58:566-573[Abstract/Free Full Text]
  3. Han CS, Mathialagan N, Klemann SW, Roberts RM, Molecular cloning of ovine and bovine type I interferon receptor subunits from uteri, and endometrial expression of messenger ribonucleic acid for ovine receptors during the estrous cycle and pregnancy. Endocrinology 1997 138:4757-4767[Abstract/Free Full Text]
  4. Morgan G, Wooding FB, Godkin JD, Localization of bovine trophoblast protein-1 in the cow blastocyst during implantation: an immunological cryoultrastructural study. Placenta 1993 14:641-649[CrossRef][Medline]
  5. Bazer FW, Spencer TE, Ott TL, Interferon tau: a novel pregnancy recognition signal. Am J Reprod Immunol 1997 37:412-420[Medline]
  6. Bleach EC, Peiris ID, Grewal TS, Shepherd DA, Savva D, Effect of administration of a novel recombinant bovine interferon on length of oestrous cycle in cattle. Res Vet Sci 1998 64:73-77[CrossRef][Medline]
  7. Plante C, Thatcher WW, Hansen PJ, Alteration of oestrous cycle length, ovarian function and oxytocin-induced release of prostaglandin F-2 alpha by intrauterine and intramuscular administration of recombinant bovine interferon-alpha to cows. J Reprod Fertil 1991 93:375-384[Abstract/Free Full Text]
  8. Plante C, Hansen PJ, Thatcher WW, Prolongation of luteal lifespan in cows by intrauterine infusion of recombinant bovine alpha-interferon. Endocrinology 1988 122:2342-2344[Abstract/Free Full Text]
  9. Johnson GA, Austin KJ, Van Kirk EA, Hansen TR, Pregnancy and interferon-tau induce conjugation of bovine ubiquitin cross-reactive protein to cytosolic uterine proteins. Biol Reprod 1998 58:898-904[Abstract/Free Full Text]
  10. Austin KJ, Carr AL, Pru JK, Hearne CE, George EL, Belden EL, Hansen TR, Localization of ISG15 and conjugated proteins in bovine endometrium using immunohistochemistry and electron microscopy. Endocrinology 2004 145:967-975[Abstract/Free Full Text]
  11. Austin KJ, Ward SK, Teixeira MG, Dean VC, Moore DW, Hansen TR, Ubiquitin cross-reactive protein is released by the bovine uterus in response to interferon during early pregnancy. Biol Reprod 1996 54:600-606[Abstract]
  12. Schmitt RA, Geisert RD, Zavy MT, Short EC, Blair RM, Uterine cellular changes in 2',5'-oligoadenylate synthetase during the bovine estrous cycle and early pregnancy. Biol Reprod 1993 48:460-466[Abstract]
  13. Rempel LA, Francis BR, Austin KJ, Hansen TR, Isolation and sequence of an interferon-tau-inducible, pregnancy- and ISG15-specific, bovine ubiquitin-activating E1-like (UBE1L) enzyme. Biol Reprod 2005 72:365-372[Abstract/Free Full Text]
  14. Pru JK, Austin KJ, Haas AL, Hansen TR, Pregnancy and interferon-tau upregulate gene expression of members of the 1–8 family in the bovine uterus. Biol Reprod 2001 65:1471-1480[Abstract/Free Full Text]
  15. Ott TL, Yin J, Wiley AA, Kim HT, Gerami-Naini B, Spencer TE, Bartol FF, Burghardt RC, Bazer FW, Effects of the estrous cycle and early pregnancy on uterine expression of Mx protein in sheep (Ovis aries). Biol Reprod 1998 59:784-794[Abstract/Free Full Text]
  16. Emond V, Asselin E, Fortier MA, Murphy BD, Lambert RD, Interferon-tau stimulates granulocyte-macrophage colony-stimulating factor gene expression in bovine lymphocytes and endometrial stromal cells. Biol Reprod 2000 62:1728-1737[Abstract/Free Full Text]
  17. Spencer TE, Ott TL, Bazer FW, Expression of interferon regulatory factors one and two in the ovine endometrium: effects of pregnancy and ovine interferon tau. Biol Reprod 1998 58:1154-1162[Abstract/Free Full Text]
  18. Stewart DM, Johnson GA, Vyhlidal CA, Burghardt RC, Safe SH, Yu-Lee LY, Bazer FW, Spencer TE, Interferon-tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon-responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 2001 142:98-107[Abstract/Free Full Text]
  19. Wolf E, Arnold GJ, Bauersachs S, Beier HM, Blum H, Einspanier R, Frohlich T, Herrler A, Hiendleder S, Kolle S, Prelle K, Reichenbach HD, Stojkovic M, Wenigerkind H, Sinowatz F, Embryo-maternal communication in bovine—strategies for deciphering a complex cross-talk. Reprod Domest Anim 2003 38:276-289[CrossRef][Medline]
  20. Reese J, Das SK, Paria BC, Lim H, Song H, Matsumoto H, Knudtson KL, DuBois RN, Dey SK, Global gene expression analysis to identify molecular markers of uterine receptivity and embryo implantation. J Biol Chem 2001 276:44137-44145[Abstract/Free Full Text]
  21. Sun XY, Li FX, Li J, Tan YF, Piao YS, Tang S, Wang YL, Determination of genes involved in the early process of embryonic implantation in rhesus monkey (Macaca mulatta) by suppression subtractive hybridization. Biol Reprod 2004 70:1365-1373[Abstract/Free Full Text]
  22. Yoshioka K, Matsuda F, Takakura K, Noda Y, Imakawa K, Sakai S, Determination of genes involved in the process of implantation: application of GeneChip to scan 6500 genes. Biochem Biophys Res Commun 2000 272:531-538[CrossRef][Medline]
  23. Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC, Global gene profiling in human endometrium during the window of implantation. Endocrinology 2002 143:2119-2138[Abstract/Free Full Text]
  24. Bauersachs S, Ulbrich SE, Gross K, Schmidt SE, Meyer HH, Einspanier R, Wenigerkind H, Vermehren M, Blum H, Sinowatz F, Wolf E, Gene expression profiling of bovine endometrium during the oestrous cycle: detection of molecular pathways involved in functional changes. J Mol Endocrinol 2005 34:889-908[Abstract/Free Full Text]
  25. Reichenbach H-D, Schwartz J, Wolf E, Brem G, Effects of embryo developmental stage, quality and short-term culture on the efficiency of bovine embryo splitting. Theriogenology 1998 49:224
  26. Stojkovic M, Westesen K, Zakhartchenko V, Stojkovic P, Boxhammer K, Wolf E, Coenzyme Q(10) in submicron-sized dispersion improves development, hatching, cell proliferation, and adenosine triphosphate content of in vitro-produced bovine embryos. Biol Reprod 1999 61:541-547[Abstract/Free Full Text]
  27. Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD, Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A 1996 93:6025-6030[Abstract/Free Full Text]
  28. Bauersachs S, Blum H, Mallok S, Wenigerkind H, Rief S, Prelle K, Wolf E, Regulation of ipsilateral and contralateral bovine oviduct epithelial cell function in the postovulation period: a transcriptomics approach. Biol Reprod 2003 68:1170-1177[Abstract/Free Full Text]
  29. Ros B, Thummler F, Wenzel G, Analysis of differentially expressed genes in a susceptible and moderately resistant potato cultivar upon Phytophthora infestans infection. Mol Plant Pathol 2004 5:191-201[CrossRef]
  30. Bauersachs S, Rehfeld S, Ulbrich SE, Mallok S, Prelle K, Wenigerkind H, Einspanier R, Blum H, Wolf E, Monitoring gene expression changes in bovine oviduct epithelial cells during the oestrous cycle. J Mol Endocrinol 2004 32:449-466[Abstract]
  31. Neuvians TP, Pfaffl MW, Berisha B, Schams D, The mRNA expression of insulin receptor isoforms (IR-A and IR-B) and IGFR-2 in the bovine corpus luteum during the estrous cycle, pregnancy, and induced luteolysis. Endocrine 2003 22:93-100[CrossRef][Medline]
  32. Ulbrich SE, Schoenfelder M, Thoene S, Einspanier R, Hyaluronan in the bovine oviduct—modulation of synthases and receptors during the estrous cycle. Mol Cell Endocrinol 2004 214:9-8[CrossRef][Medline]
  33. Livak KJ, Schmittgen TD, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001 25:402-408[CrossRef][Medline]
  34. Choi Y, Johnson GA, Spencer TE, Bazer FW, Pregnancy and interferon tau regulate major histocompatibility complex class I and beta2-microglobulin expression in the ovine uterus. Biol Reprod 2003 68:1703-1710[Abstract/Free Full Text]
  35. Hicks BA, Etter SJ, Carnahan KG, Joyce MM, Assiri AA, Carling SJ, Kodali K, Johnson GA, Hansen TR, Mirando MA, Woods GL, Vanderwall DK, Ott TL, Expression of the uterine Mx protein in cyclic and pregnant cows, gilts, and mares. J Anim Sci 2003 81:1552-1561[Abstract/Free Full Text]
  36. Evans SS, Collea RP, Leasure JA, Lee DB, IFN-alpha induces homotypic adhesion and Leu-13 expression in human B lymphoid cells. J Immunol 1993 150:736-747[Abstract]
  37. Deblandre GA, Marinx OP, Evans SS, Majjaj S, Leo O, Caput D, Huez GA, Wathelet MG, Expression cloning of an interferon-inducible 17-kDa membrane protein implicated in the control of cell growth. J Biol Chem 1995 270:23860-23866[Abstract/Free Full Text]
  38. Yang Y, Lee JH, Kim KY, Song HK, Kim JK, Yoon SR, Cho D, Song KS, Lee YH, Choi I, The interferon-inducible 9–27 gene modulates the susceptibility to natural killer cells and the invasiveness of gastric cancer cells. Cancer Lett 2005 221:191-200[CrossRef][Medline]
  39. Praefcke GJ, Kloep S, Benscheid U, Lilie H, Prakash B, Herrmann C, Identification of residues in the human guanylate-binding protein 1 critical for nucleotide binding and cooperative GTP hydrolysis. J Mol Biol 2004 344:257-269[CrossRef][Medline]
  40. Kumar S, Li Q, Dua A, Ying YK, Bagchi MK, Bagchi IC, Messenger ribonucleic acid encoding interferon-inducible guanylate binding protein 1 is induced in human endometrium within the putative window of implantation. J Clin Endocrinol Metab 2001 86:2420-2427[Abstract/Free Full Text]
  41. Cheng YS, Becker-Manley MF, Chow TP, Horan DC, Affinity purification of an interferon-induced human guanylate-binding protein and its characterization. J Biol Chem 1985 260:15834-15839[Abstract/Free Full Text]
  42. Cheng YS, Patterson CE, Staeheli P, Interferon-induced guanylate-binding proteins lack an N(T)KXD consensus motif and bind GMP in addition to GDP and GTP. Mol Cell Biol 1991 11:4717-4725[Abstract/Free Full Text]
  43. Schwemmle M, Staeheli P, The interferon-induced 67-kDa guanylate-binding protein (hGBP1) is a GTPase that converts GTP to GMP. J Biol Chem 1994 269:11299-11305[Abstract/Free Full Text]
  44. Parker N, Porter AC, Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12. BMC Genomics 2004 5:8[CrossRef][Medline]
  45. Pine R, Canova A, Schindler C, Tyrosine phosphorylated p91 binds to a single element in the ISGF2/IRF-1 promoter to mediate induction by IFN alpha and IFN gamma, and is likely to autoregulate the p91 gene. EMBO J 1994 13:158-167[Medline]
  46. Joyce MM, White FJ, Burghardt RC, Muniz JJ, Spencer TE, Bazer FW, Johnson GA, Interferon stimulated gene 15 conjugates to endometrial cytosolic proteins and is expressed at the uterine-placental interface throughout pregnancy in sheep. Endocrinology 2005 146:675-684[Abstract/Free Full Text]
  47. Kim KI, Zhang DE, ISG15, not just another ubiquitin-like protein. Biochem Biophys Res Commun 2003 307:431-434[CrossRef][Medline]
  48. Narasimhan J, Potter JL, Haas AL, Conjugation of the 15-kDa interferon-induced ubiquitin homolog is distinct from that of ubiquitin. J Biol Chem 1996 271:324-330[Abstract/Free Full Text]
  49. Hamerman JA, Hayashi F, Schroeder LA, Gygi SP, Haas AL, Hampson L, Coughlin P, Aebersold R, Aderem A, Serpin 2a is induced in activated macrophages and conjugates to a ubiquitin homolog. J Immunol 2002 168:2415-2423[Abstract/Free Full Text]
  50. Malakhov MP, Kim KI, Malakhova OA, Jacobs BS, Borden EC, Zhang DE, High-throughput immunoblotting. Ubiquitin-like protein ISG15 modifies key regulators of signal transduction. J Biol Chem 2003 278:16608-16613[Abstract/Free Full Text]
  51. Malakhova OA, Yan M, Malakhov MP, Yuan Y, Ritchie KJ, Kim KI, Peterson LF, Shuai K, Zhang DE, Protein ISGylation modulates the JAK-STAT signaling pathway. Genes Dev 2003 17:455-460[Abstract/Free Full Text]
  52. Takeyama K, Aguiar RC, Gu L, He C, Freeman GJ, Kutok JL, Aster JC, Shipp MA, The BAL-binding protein BBAP and related Deltex family members exhibit ubiquitin-protein isopeptide ligase activity. J Biol Chem 2003 278:21930-21937[Abstract/Free Full Text]
  53. Liston P, Fong WG, Kelly NL, Toji S, Miyazaki T, Conte D, Tamai K, Craig CG, McBurney MW, Korneluk RG, Identification of XAF1 as an antagonist of XIAP anti-Caspase activity. Nat Cell Biol 2001 3:128-133[CrossRef][Medline]
  54. MacFarlane M, Merrison W, Bratton SB, Cohen GM, Proteasome-mediated degradation of Smac during apoptosis: XIAP promotes Smac ubiquitination in vitro. J Biol Chem 2002 277:36611-36616[Abstract/Free Full Text]
  55. Ratnoff OD, Pensky J, Ogston D, Naff GB, The inhibition of plasmin, plasma kallikrein, plasma permeability factor, and the C'1r subcomponent of the first component of complement by serum C'1 esterase inhibitor. J Exp Med 1969 129:315-331[Abstract]
  56. Tekin S, Hansen PJ, Natural killer-like cells in the sheep: functional characterization and regulation by pregnancy-associated proteins. Exp Biol Med (Maywood) 2002 227:803-811[Abstract/Free Full Text]
  57. Stewart MD, Johnson GA, Gray CA, Burghardt RC, Schuler LA, Joyce MM, Bazer FW, Spencer TE, Prolactin receptor and uterine milk protein expression in the ovine endometrium during the estrous cycle and pregnancy. Biol Reprod 2000 62:1779-1789[Abstract/Free Full Text]
  58. Babic AM, Chen CC, Lau LF, Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin alphavbeta3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol Cell Biol 1999 19:2958-2966[Abstract/Free Full Text]
  59. Jedsadayanmata A, Chen CC, Kireeva ML, Lau LF, Lam SC, Activation-dependent adhesion of human platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is mediated through integrin alpha(IIb)beta(3). J Biol Chem 1999 274:24321-24327[Abstract/Free Full Text]
  60. Scallon BJ, Fung WJ, Tsang TC, Li S, Kado-Fong H, Huang KS, Kochan JP, Primary structure and functional activity of a phosphatidylinositol-glycan-specific phospholipase D. Science 1991 252:446-448[Abstract/Free Full Text]
  61. Couto JR, Taylor MR, Godwin SG, Ceriani RL, Peterson JA, Cloning and sequence analysis of human breast epithelial antigen BA46 reveals an RGD cell adhesion sequence presented on an epidermal growth factor-like domain. DNA Cell Biol 1996 15:281-286[Medline]
  62. Hvarregaard J, Andersen MH, Berglund L, Rasmussen JT, Petersen TE, Characterization of glycoprotein PAS-6/7 from membranes of bovine milk fat globules. Eur J Biochem 1996 240:628-636[Medline]
  63. Andersen MH, Graversen H, Fedosov SN, Petersen TE, Rasmussen JT, Functional analyses of two cellular binding domains of bovine lactadherin. Biochemistry 2000 39:6200-6206[CrossRef][Medline]
  64. Wathes DC, Wooding FB, An electron microscopic study of implantation in the cow. Am J Anat 1980 159:285-306[CrossRef][Medline]
  65. Spencer TE, Bazer FW, Conceptus signals for establishment and maintenance of pregnancy. Reprod Biol Endocrinol 2004 2:49-64[CrossRef][Medline]
  66. Djonov V, Hogger K, Sedlacek R, Laissue J, Draeger A, MMP-19: cellular localization of a novel metalloproteinase within normal breast tissue and mammary gland tumours. J Pathol 2001 195:147-155[CrossRef][Medline]
  67. Stetler-Stevenson WG, Krutzsch HC, Liotta LA, Tissue inhibitor of metalloproteinase (TIMP-2). A new member of the metalloproteinase inhibitor family. J Biol Chem 1989 264:17374-17378[Abstract/Free Full Text]
  68. Moussad EE, Rageh MA, Wilson AK, Geisert RD, Brigstock DR, Temporal and spatial expression of connective tissue growth factor (CCN2; CTGF) and transforming growth factor beta type 1 (TGF-beta1) at the utero-placental interface during early pregnancy in the pig. Mol Pathol 2002 55:186-192[Abstract/Free Full Text]
  69. Surveyor GA, Wilson AK, Brigstock DR, Localization of connective tissue growth factor during the period of embryo implantation in the mouse. Biol Reprod 1998 59:1207-1213[Abstract/Free Full Text]
  70. Uzumcu M, Homsi MF, Ball DK, Coskun S, Jaroudi K, Hollanders JM, Brigstock DR, Localization of connective tissue growth factor in human uterine tissues. Mol Hum Reprod 2000 6:1093-1098[Abstract/Free Full Text]
  71. Nielsen HL, Ronnov-Jessen L, Villadsen R, Petersen OW, Identification of EPSTI1, a novel gene induced by epithelial-stromal interaction in human breast cancer. Genomics 2002 79:703-710[CrossRef][Medline]
  72. Sadowski T, Dietrich S, Koschinsky F, Sedlacek R, Matrix metalloproteinase 19 regulates insulin-like growth factor-mediated proliferation, migration, and adhesion in human keratinocytes through proteolysis of insulin-like growth factor binding protein-3. Mol Biol Cell 2003 14:4569-4580[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Bauersachs, S. E. Ulbrich, V. Zakhartchenko, M. Minten, M. Reichenbach, H.-D. Reichenbach, H. Blum, T. E. Spencer, and E. Wolf
The endometrium responds differently to cloned versus fertilized embryos
PNAS, April 7, 2009; 106(14): 5681 - 5686.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
E. Gomez, A. Gutierrez-Adan, C. Diez, P. Bermejo-Alvarez, M. Munoz, A. Rodriguez, J. Otero, M. Alvarez-Viejo, D. Martin, S. Carrocera, et al.
Biological differences between in vitro produced bovine embryos and parthenotes
Reproduction, February 1, 2009; 137(2): 285 - 295.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
T. E Spencer, O. Sandra, and E. Wolf
Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches
Reproduction, February 1, 2008; 135(2): 165 - 179.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. Mitko, S. E Ulbrich, H. Wenigerkind, F. Sinowatz, H. Blum, E. Wolf, and S. Bauersachs
Dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle
Reproduction, February 1, 2008; 135(2): 225 - 240.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. Bauersachs, K. Mitko, H. Blum, and E. Wolf
Technical Note: Bovine Oviduct and Endometrium Array Version 1: A Tailored Tool for Studying Bovine Endometrium Biology and Pathophysiology
J Dairy Sci, September 1, 2007; 90(9): 4420 - 4423.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
Y. Chen, E. Antoniou, Z. Liu, L. B Hearne, and R M. Roberts
A microarray analysis for genes regulated by interferon-{tau} in ovine luminal epithelial cells
Reproduction, July 1, 2007; 134(1): 123 - 135.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Wuensch, F. A. Habermann, S. Kurosaka, R. Klose, V. Zakhartchenko, H.-D. Reichenbach, F. Sinowatz, K. J. McLaughlin, and E. Wolf
Quantitative Monitoring of Pluripotency Gene Activation after Somatic Cloning in Cattle
Biol Reprod, June 1, 2007; 76(6): 983 - 991.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
G. Song, F. W Bazer, and T. E Spencer
Pregnancy and interferon tau regulate RSAD2 and IFIH1 expression in the ovine uterus
Reproduction, January 1, 2007; 133(1): 285 - 295.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
A. El-Sayed, M. Hoelker, F. Rings, D. Salilew, D. Jennen, E. Tholen, M.-A. Sirard, K. Schellander, and D. Tesfaye
Large-scale transcriptional analysis of bovine embryo biopsies in relation to pregnancy success after transfer to recipients
Physiol Genomics, December 13, 2006; 28(1): 84 - 96.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
S. Bauersachs, S. E Ulbrich, K. Gross, S. E M Schmidt, H. H D Meyer, H. Wenigerkind, M. Vermehren, F. Sinowatz, H. Blum, and E. Wolf
Embryo-induced transcriptome changes in bovine endometrium reveal species-specific and common molecular markers of uterine receptivity.
Reproduction, August 1, 2006; 132(2): 319 - 331.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/2/253    most recent
biolreprod.105.046748v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.
Agricola
Right arrow Articles by Klein, C.
Right arrow Articles by Wolf, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS