Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print October 19, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.045047
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/2/331    most recent
biolreprod.105.045047v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.
Agricola
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.
BIOLOGY OF REPRODUCTION 74, 331–336 (2006)
DOI: 10.1095/biolreprod.105.045047
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

The Cell-Surface Isoform of Colony Stimulating Factor 1 (CSF1) Restores but Does Not Completely Normalize Fecundity in CSF1-Deficient Mice1

Shira Ovadia 4 5, Karl Insogna 3 6, and Gang-Qing Yao 2 3 5

Section of Comparative Medicine,5 Department of Internal Medicine,6 Yale University School of Medicine, New Haven, Connecticut 06520

ABSTRACT

The complete genetic absence of colony stimulating factor 1 (CSF1) in CSF1-deficient Csf1op/Csf1op mice leads to reproductive defects in males and females. Although the cell-surface or membrane-bound isoform of CSF1 (mCSF1) is biologically active in bone, little is known about its role in reproduction. Transgenic mice expressing mCSF1 under the control of the 2.4-kb rat collagen type I alpha promoter were developed [Tg(Col1a1-mCSF1)1Gqy] and bred onto a Csf1op/Csf1op background [Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy] to examine the effects of the mCSF1 isoform in bone in vivo. Surprisingly, when interbred, these mice were fertile. The Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy transgenic male mice have normal libido, sperm number and percent of motile sperm. In Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy females, puberty and estrus cycles are at expected age and duration. Further, females are able to carry pregnancies to term and nurse their offspring. Crosses of Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy males or females with their control littermates showed no significant differences in either number or viability of offspring. However, crossing Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy males with Csf1op; Tg(Col1a1-mCSF1)1Gqy females resulted in a decline in both the number and viability of offspring, suggesting that a subtle reproductive defect might persist in the transgenic animals that was only manifest when the animals were interbred. Although the gravid murine uterus expresses extremely high levels of CSF1 that are thought to be important for reproduction, uterine tissue levels of CSF1 remained low and unchanged during pregnancy in Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy mice. Low levels of CSF1 protein were detected in serum and in lung and uterine tissue in Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy mouse, which likely result from the known proteolytic shedding of mCSF1 from the cell surface. These data are consistent with the conclusion that mCSF1, when shed from the cell surface, can support reproduction and that high uterine tissue levels of CSF1 may not be required for mouse reproduction.

gene regulation, growth factors, pregnancy, sperm motility and transport, uterus

INTRODUCTION

Colony stimulating factor 1 (CSF1) is a growth factor that plays vital roles in regulating mononuclear phagocyte maturation and skeletal metabolism [1, 2]. It has also been suggested that CSF1 influences reproduction. It is expressed in endometrial epithelium, where expression is regulated synergistically by estradiol-17ß and progesterone [3]. In addition, the pregnant mouse uterus expresses high levels of CSF1 with concomitant expression of the CSF1 receptor in the placenta [4]. CSF1 also is expressed in follicular fluid, placenta, lactating mammary gland, and testis [511], and enhances preimplantation mouse embryo development in vitro [12].

Csf1op/Csf1op are CSF1-deficient mice (henceforth referred to as op/op) that develop osteopetrosis and fail to demonstrate tooth eruption [1315]. In addition to skeletal defects, mice homozygous for this mutation have an array of reproductive defects that lead to poor breeding performance. Crossing op/op female and male mice results in no viable offsping. Although op/op heterozygous mice (henceforth referred to as op/+) are as fertile as wild-type mice [13, 16], when op/op females are bred to op/+ males there is a 40% reduction in litter size (P < 0.001), and there is a 13% reduction in litter size when op/op males are bred to op/+ females (P < 0.05), as compared to litter sizes observed with an op/+, op/+ cross. [16]. Only 13% of op/op mothers are able to successfully nurse at least one pup to weaning, and most pups born to op/op mothers die shortly after birth [10]. Studies have found that op/op males have low testosterone biosynthesis, reduced libido, reduced sperm number, diminished circulating luteinizing hormone concentrations, and an impaired hypothalamic-pituitary feedback response to testosterone [1719]. Females have an extended estrus cycle, delayed puberty, low ovulation rate, reduced litter size, poor lactation [10], and disrupted positive and negative feedback loops in the hypothalamus and pituitary [3, 18]. The reproductive defects in op/op mice were partially corrected by the daily subcutaneous administration of human recombinant CSF1 early in the postnatal period [2022] and fully corrected by transgenic expression of murine Csf1 cDNA under the control of the Csf1 promoter [23].

Multiple Csf1 mRNA species (4.0, 3.0, 2.3, 1.9, and 1.6 kb) are transcribed from the Csf1 gene [5, 2427], that arise from alternative splicing in exon 6 and the alternative use of the 3' end of exons 9 or 10 [2426]. Two distinct CSF1 protein products are encoded by these transcripts: a cell-surface or membrane-bound form of CSF1 (mCSF1) [5, 28], and a soluble form (sCSF1) [29, 30]. The predominant mRNA species in most tissues is the 4.0-kb form that encodes sCSF1 [31]. During pregnancy, there is a 1000-fold increase in uterine CSF1, predominantly because of increased expression of a 2.3-kb mRNA that also encodes sCSF1 [3, 6]. In contrast, uterine mCSF1 remains low during pregnancy [32]. Whether the molecular forms of CSF1 differ in their physiologic effects on reproduction is unclear. Specifically, although levels of sCSF1 are markedly elevated in the pregnant mouse uterus, it is unclear whether sCSF1 plays a nonredundant role in reproduction.

To help define the role of mCSF1 in bone, we developed a transgenic mouse (Tg(Col1a1-mCSF1)1Gqy, hereafter referred to as mCSF1/+) in which targeted expression of human mCSF1 in osteoblasts was achieved using the 2.4-kb rat collagen type I alpha promoter [33]. We have reported that this osteoblast-restricted isoform transgene corrected the osteopetrosis seen in CSF1-deficient op/op mice and that these mice had normal incisor and molar tooth eruption [33]. The mice were produced initially by breeding mCSF1/+ mice with op/+, yielding mice with an op/+ mCSF1/+ genotype. These mice were bred to mice with an op/+ genotype to yield Csf1op/Csf1op; Tg(Col1a1-mCSF1)1Gqy (hereafter referred to as op/op mCSF1) mice. We anticipated that crosses between op/op mCSF1 and op/op mCSF1 mice would have greatly reduced reproductive efficiency because they lack sCSF1. However, they yielded viable offspring. This result suggested that mCSF1 has a significant role in reproduction. This report documents the reproductive capacity of transgenic mice in which the only source of CSF1 is the membrane-bound isoform.

MATERIALS AND METHODS

Animals

Generation and identification of op/op mCSF1 mice Mice expressing only mCSF1 under the control of a 2.4 kb rat collagen type I {alpha} promoter have been described previously [33]. Briefly, they were produced by breeding heterozygous transgenic mCSF1/+ mice with heterozygous osteopetrotic mutants op/+ mice (Jackson Laboratory), yielding mice heterozygous for the osteopetrotic mutation and the mCsf1 transgene. These mice were bred again to op/+ mice to yield mice homozygous for op/op and heterozygous for the mCSF1 transgene (op/op mCSF1/+ genotype). Identification of homozygous op/op or heterozygous op/+ mice and differentiation of them from wild-type mice was accomplished by PCR according to published methods [33, 34]. The primers used for genotyping were P1: 5'TGTGTCCCTTCCTCAGATTACA-3' and P2: 5'GGTCTCATCTATTATGTCTTG TACCAGCCAAAA-3'.

Assessment of Reproduction

Males Mature males (8 wk or older) were killed by CO2 inhalation. Spermatozoa were collected by dissecting the vas deferens and caudal epididymides. Small tissue fragments were immersed in 1 ml of warm (37°C) modified sperm washing medium containing 5.0 mg/ml of BSA (Irvine Scientific) under dimethylpolysiloxane oil (50 centistokes viscosity; Sigma), and incubated at 37°C for 30 min. The resulting suspension of released spermatozoa was centrifuged at 100 x g for 5 min, the supernatant was removed, and the pellet was diluted to 1 ml with warm sperm-washing media. After gentle agitation, 10 µl of diluted suspension was placed in a hemocytometer and the number of spermatozoa was counted. Percent viable sperm was assessed by staining with the LIVE/DEAD sperm viability kit (L-7011, Molecular Probes, Inc.) and counting 10 fields (400x) using a fluorescence microscope.

Females Age at first estrus was determined by daily evaluation for vaginal opening of weaned animals. Estrus intervals were assessed by vaginal cytology obtained daily for three estrus cycles. Samples were air-dried, stained with Diff-Quick (Dade Diagnostics of P.R. Inc.) and examined by light microscopy. Cytological criteria were: proestrus 80%–100% intact live epithelial cells; estrus 100% cornfield epithelia; metestrus ~50% cornfield epithelia and ~50% leukocytes; diestrus 80%–100% leukocytes [35, 36]. In addition, time-mated pregnant females were killed by CO2 inhalation at 10 days of gestation and the number of embryos counted in relation to maternal age. Litter size was recorded at birth and at weaning (21 days of age).

Breeding

Breeding pairs were as follows (female x male): a, op/+ x op/+; b, op/+ x op/op mCSF1; c, op/op mCSF1 x op/+; and d, op/op mCSF1 x op/op mCSF1. Breeding interval from initial pairing to first, second, and third litters was also calculated as a measure of fertility (libido and reproductive capacity).

All animal procedures were approved by the Yale University Institutional Animal Care and Use Committee, and animal care was in accordance with the United States National Institute of Health's Guide for the Care and Use of Laboratory Animals.

Detection of CSF1 in Tissue Extracts

Human and murine CSF1 levels were determined in serum, bone (femur), brain, lung, kidney, and gravid (Embryonic Day 10 [E10]) and nongravid uteri. Care was taken during dissection, collection, and storage (–70°C) to prevent contamination of placenta and embryonic tissue with uterine tissue. For extraction, 0.05–0.5 g of a given frozen tissue was homogenized in a Micro-Dismembranator II for 30 sec in liquid nitrogen. Homogenized tissue (50 mg wet weight), was suspended at 4°C in 1 ml of alpha-MEM (Gibco Laboratories) and Complete protease inhibitor cocktail (Roche Applied Science) and centrifuged at 800 x g for 10 min. at 4°C. The supernatant fluid was determined by immunoassay in duplicate in human CSF1 and/or murine CSF1 ELISAs (Quantikine or Quantikine M; R&D Systems). CSF1 concentrations were normalized to total protein in the supernatant. Total protein was determined using a commercial kit following the manufacturer's recommended protocol (Bio-Rad protein assay kit; Bio-Rad Laboratories). Samples were initially analyzed separately for both human and murine CSF1 to exclude cross-reactivity of human mCSF1 in the murine assay kit and endogenous murine CSF1 in the human assay kit.

Statistical Analyses

Data were analyzed by multifactorial ANOVA using Systat 9.0 software (Systat Software, Inc.) followed by Bonferroni post hoc testing for significant differences between all possible pair-wise combinations. Significant interactions are reported where appropriate.

RESULTS

Tissue Levels of CSF1 Protein in op/op mCSF1 and op/+ Mice

No CSF1 was detected in samples from op/+ mice tested by the human CSF1 kit. Similarly, no CSF1 was detected in samples from op/op mCSF1 mice tested by the murine CSF1 kit. These data indicate that there is no cross-reactivity between murine and human CSF1 in the respective immunoassays at the levels expressed in the tissues analyzed for this study.

The levels of human and murine CSF1 in different tissues from op/op mCSF1 and control op/+ mice are summarized in Table 1. As expected, human CSF1 was detected in bone but not in the kidney or brain of op/op mCSF1 mice, which is consistent with the restricted expression of this transgene in osteoblasts. Additionally, human CSF1 expression in bone from transgenic mice was higher (P = 0.007) than endogenous murine CSF1 in the bone of op/+ mice. Although human CSF1 was detected in the serum of op/op mCSF1 mice, levels were lower (P < 0.001) than in serum of op/+ mice. The low levels of human CSF1 in the serum of op/op mCSF1 mice is consistent with its demonstrated ability to be shed slowly from the cell membrane [28]. Low levels of human CSF1 protein were also detected in lung of op/op mCSF1 mice. Because no CSF1 transgene RNA was detected in lung [33], CSF1 in lung is likely caused by residual serum in this highly vascular tissue.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Tissue levels of CSF1 in transgenic and control mice.a

Male and Female Fecundity

The reproductive performance of op/op mCSF1 and op/+ mice was examined in four intercrosses. A detailed analysis of the first three litters resulting from these four crosses is summarized in Table 2. The four crosses are (female x male): a, op/+ x op/+; b, op/+ x op/op mCSF1; c, op/op mCSF1 x op/+; and d, op/op mCSF1 x op/op mCSF1. In the first litter the number of offspring was higher (P < 0.01) in matings a, b, and c compared to mating d. The number of offspring in the second and third litters were higher (P < 0.01) in matings a and b than in mating d. No differences in litter size were observed among matings in a, b, or c.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Reproductive efficiency of op/+, op/op mCSF1 matings

Offspring survival in the first litter was higher (P < 0.05) in mating b than in mating d. Survival rates were not different in the second litter and were higher (P < 0.05) in matings a and b than in mating d for the third litter.

The data from the first three litters are likely representative of long-term reproductive success in these animals, because we have followed some pairs of animal through six litters and have not observed any changes in reproductive performance (data not shown).

Reproductive Soundness

Males Sperm from 44 male mice (20 of op/+ and 24 of op/op mCSF1, 2–14 mo old) were collected and analyzed (Table 3). There were no differences in sperm number or motility between op/op mCSF1 and op/+ mice. Sperm from op/op mCSF1 mice were more viable (P < 0.05) than sperm from op/+ mice.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Sperm number, motility, and viability in male mice

Females No differences were found between op/+ and op/op mCSF1 in terms of age at vaginal opening, time to first estrus cycle, or intervals between the second and third estrus cycles (Table 4).


View this table:
[in this window]
[in a new window]
 
TABLE 4. Puberty and cycling intervals in female mice

The number of embryos recovered from op/+ in comparison to op/op mCSF1 dams at midgestation were not significantly different (Table 5). In these crosses the op/op mCSF1 and op/+ females were crossed with op/+ males.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Number of embryos at midgestation by genotype

Uterine CSF1 Expression in Pregnant and Nonpregnant op/op mCSF1 and op/+ Mice

Uterine CSF1 levels were 19.4-fold higher in pregnant compared with nonpregnant op/+ females (Table 6). Levels of Csf1 mRNA expression in gravid uteri were increased 35-fold as quantified by real-time PCR (data not shown), confirming that the uterus was the source of the CSF1. In contrast, uterine levels of CSF1 in op/op mCSF1 females were unaffected by pregnancy. Serum levels of CSF1 did not differ in pregnant and nonpregnant mice of either genotype.


View this table:
[in this window]
[in a new window]
 
TABLE 6. Serum and uterine tissue levels of CSF1 in pregnant (P) and nonpregnant (NP) mice.a

DISCUSSION

The results demonstrate that reproductive defects in op/op mice are rescued by a transgene expressing only mCSF1. The op/op mCSF1 transgenic males had normal libido, sperm number, and sperm motility. When bred to op/+ females, the males demonstrated fertility equivalent to that of op/+ males. In fact, op/op mCSF1 males, for reasons that are not clear, had a higher percentage of live sperm than their control littermates.

Reproductive soundness was also normal in op/op mCSF1 females. Puberty occurred at the expected age, estrus cycles were of normal duration, and dams carried pregnancies to term and nursed their offspring as successfully as op/+ females. The normal numbers of E10 embryos observed when op/op mCSF1 females were bred with op/+ males are consistent with these findings and support the conclusion that the intrauterine environment is supportive of fetal development.

Although the transgene rescued op/op mice, some abnormalities remained. Matings between op/op mCSF1 males and op/op mCSF females resulted in significantly smaller litter sizes than matings of either sex with heterozygous partners. We speculate that the significant decline in performance was caused by subtle reproductive deficiencies that were manifested only when the transgenic mice were interbred. Alternatively, this could have resulted from the effects of inbreeding (unrelated to the transgene) in the transgenic line, which was established from one founder mouse. Matings between op/op mCSF1 males and females also resulted in reduced survival of suckling pups, which was especially evident in the third litter. CSF1 is required for mammary development [9, 10, 37]. Because transgenic animals would not express CSF1 in mammary tissue, lactation may have been impaired in transgenic females.

Dai et al. [37] developed transgenic op/op mice in which mCsf1 cDNA expression was under the control of a promoter that contains the first intron and 3.13 kb of the 5' regulatory sequences of the CSF1 gene. Although the level of mCSF1 expression in these mice has not been reported [37], these investigators have used the same promoter to drive expression sCSF1 in op/op mice to levels that were frequently equivalent or higher than those found in op/+ mice [23]. If one assumes that expression of mCSF1 in their transgenic mice was at or above normal levels, it is not surprising that these investigators found no difference in litter size when the transgenic females were bred to op/+ males. Normal or higher levels of expression of mCSF1 in all relevant tissues would explain the difference between our findings and those of Dai et al. Nonetheless, our data support the concept that mCSF1 can play a functionally important role in reproduction.

It has been assumed that the reproductive defects in op/op mice reflect a requirement for CSF1 expression in multiple reproductive tissues and organs, in some cases at very high levels. Our data indicate that this is not the case, because reproductive efficiency was rescued despite low or absent extraskeletal tissue levels of mCSF1 in the op/op mCSF1. Further, the results suggest that the reproductive requirement for mCSF1 is modest and that the high levels observed in murine reproductive tissues represent considerable reserve. Perhaps the most striking example of this is our findings in uterine tissues. Despite the inability of op/op mCSF1 females to upregulate uterine CSF1 levels during pregnancy, they delivered normal numbers of offspring in their initial litters. This suggests that a pregnancy-associated rise in uterine CSF1 levels is not essential for reproduction. However, our data do not address the issue of whether a low permissive level of uterine CSF1 is required for successful reproduction.

It is unlikely that rescue of the skeletal defects per se would enhance reproductive function. Additionally, expression of mCSF1 was essentially restricted to bone. Therefore, rescue must involve indirect mechanisms or reproductive activity of mCSF1 released from bone. It is well-established that mCSF1 can be shed from the cell membrane through a slow and inefficient process [38], but that it is biologically active. For example, it supports osteoclast formation in vitro [39]. Low levels of circulating mCSF1 were detected in the serum of op/op mCSF1 transgenic mice and in uteri. These data are consistent with shedding of osteoblast-expressed mCSF1 to induce remote functional effects, and appear to be the first evidence of this property of mCSF1. It is also possible that shed mCSF1 upregulates sex steroid synthesis, thereby helping to ensure normal function of the hypothalamic pituitary gonadal axis. In addition, shed mCSF1, present in the vascular bed or taken up by target tissues, may promote homing of macrophages. Tissue macrophages have been posited to carry sex hormones to the reproductive organs [16, 34]. Finally, expression of mCSF1 in osteoblasts may support differentiation of macrophages in bone marrow.

In summary, op/op mice expressing mCSF1 in osteoblasts demonstrated near-normal reproductive function. As noted, mating op/op mCSF1 mice with each other resulted in somewhat reduced number and viability of offspring, suggesting that a subtle reproductive defect persisted in the transgenic animals that was magnified when the transgenic animals were interbred. Nonetheless, in the aggregate our data indicate that mCSF1 can function to support reproduction in mice. CSF1 was detected in serum, lung, and uterus consistent with the known shedding of mCSF1 from the cell surface in vitro. This is most likely the source of the CSF1 responsible for correcting the reproductive defects in these mice. These data suggest that high tissue levels of CSF1 may not be required in the uterus for successful reproduction in mice.

ACKNOWLEDGMENTS

Shira Ovadia was a clinical fellow in Laboratory Animal and Comparative Medicine Training Program in the Section of Comparative Medicine. The authors wish to thank Dr. Robert Jacoby for his careful reading of the manuscript and helpful comments, and Elizabeth Johnson for technical support.

FOOTNOTES

1 Supported by grants from the National Institutes of Health DK45228, DE12459 (to K.L.I.), and, in part, by the Yale Core Center for Musculoskeletal Disorders P30 AR46032. Back

2 Correspondence: Gang-Qing Yao, Section of Comparative Medicine, Yale University School of Medicine, P.O. Box 208016, New Haven, CT 06520-8016. FAX: 203 785 7499; gang-qing.yao{at}yale.edu Back

3 These authors contributed equally to this work. Back

4 Current address: National Institute of Biotechnology in the Negev, P.O.Box 653, Ben-Gurion University of the Negev, Beer-Sheva, Israel, 84105. Back

Received: 5 July 2005.

First decision: 29 July 2005.

Accepted: 14 October 2005.

REFERENCES

  1. Roth P, Stanley ER, The biology of CSF-1 and its receptor. Curr Top Microbiol Immunol 1992 181:141-167[Medline]
  2. Weir EC, Yao G.Q, Chen Y, Insogna K, Colony-stimulating factors and bone. In: Canalis E, (ed.). Skeletal Growth Factors. Philadelphia: Lippincott Williams & Wilkins 2001
  3. Pollard JW, Bartocci A, Arceci R, Orlofsky A, Ladner MB, Stanley ER, Apparent role of the macrophage growth factor, CSF-1, in placental development. Nature 1987 330:484-486[CrossRef][Medline]
  4. Arceci RJ, Pampfer S, Pollard JW, Expression of CSF-1/c-fms and SF/c-kit mRNA during preimplantation mouse development. Dev Biol 1992 151:1-8[CrossRef][Medline]
  5. Pampfer S, Tabibzadeh S, Chuan FC, Pollard JW, Expression of colony-stimulating factor-1 (CSF-1) messenger RNA in human endometrial glands during the menstrual cycle: molecular cloning of a novel transcript that predicts a cell surface form of CSF-1. Mol Endocrinol 1991 5:1931-1938[Abstract/Free Full Text]
  6. Arceci RJ, Shanahan F, Stanley ER, Pollard JW, Temporal expression and location of colony-stimulating factor 1 (CSF-1) and its receptor in the female reproductive tract are consistent with CSF-1-regulated placental development. Proc Natl Acad Sci U S A 1989 86:8818-8822[Abstract/Free Full Text]
  7. Witt BR, Pollard JW, Colony stimulating factor-1 in human follicular fluid. Fertil Steril 1997 68:259-264[CrossRef][Medline]
  8. Bartocci A, Pollard JW, Stanley ER, Regulation of colony-stimulating factor 1 during pregnancy. J Exp Med 1986 164:956-961[Abstract/Free Full Text]
  9. Sapi E, Flick MB, Rodov S, Carter D, Kacinski BM, Expression of CSF-I and CSF-I receptor by normal lactating mammary epithelial cells. J Soc Gynecol Investig 1998 5:94-101[CrossRef][Medline]
  10. Pollard JW, Hennighausen L, Colony stimulating factor 1 is required for mammary gland development during pregnancy. Proc Natl Acad Sci U S A 1994 91:9312-9316[Abstract/Free Full Text]
  11. Gerdprasert O, O'Bryan MK, Nikolic-Paterson DJ, Sebire K, de Kretser DM, Hedger MP, Expression of monocyte chemoattractant protein-1 and macrophage colony-stimulating factor in normal and inflamed rat testis. Mol Hum Reprod 2002 8:518-524[Abstract/Free Full Text]
  12. Pampfer S, Arceci RJ, Pollard JW, Role of colony stimulating factor-1 (CSF-1) and other lympho-hematopoietic growth factors in mouse pre-implantation development. Bioessays 1991 13:535-540[CrossRef][Medline]
  13. Marks SC, Jr. Lane PW, Osteopetrosis, a new recessive skeletal mutation on chromosome 12 of the mouse. J Hered 1976 67:11-18[Free Full Text]
  14. Wiktor-Jedrzejczak WW, Ahmed A, Szczylik C, Skelly RR, Hematological characterization of congenital osteopetrosis in op/op mouse. Possible mechanism for abnormal macrophage differentiation. J Exp Med 1982 156:1516-1527[Abstract/Free Full Text]
  15. Wiktor-Jedrzejczak W, Bartocci A, Ferrante AW, Jr. Ahmed-Ansari A, Sell KW, Pollard JW, Stanley ER, Total absence of colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (op/op) mouse. Proc Natl Acad Sci U S A 1990 87:4828-4832[Abstract/Free Full Text]
  16. Pollard JW, Hunt JS, Wiktor-Jedrzejczak W, Stanley ER, A pregnancy defect in the osteopetrotic (op/op) mouse demonstrates the requirement for CSF-1 in female fertility. Dev Biol 1991 148:273-283[CrossRef][Medline]
  17. Cohen PE, Chisholm O, Arceci RJ, Stanley ER, Pollard JW, Absence of colony-stimulating factor-1 in osteopetrotic (csfmop/csfmop) mice results in male fertility defects. Biol Reprod 1996 55:310-317[Abstract]
  18. Cohen PE, Nishimura K, Zhu L, Pollard JW, Macrophages: important accessory cells for reproductive function. J Leukoc Biol 1999 66:765-772[Abstract]
  19. Pollard JW, Dominguez MG, Mocci S, Cohen PE, Stanley ER, Effect of the colony-stimulating factor-1 null mutation, osteopetrotic (csfm(op)), on the distribution of macrophages in the male mouse reproductive tract. Biol Reprod 1997 56:1290-1300[Abstract]
  20. Wiktor-Jedrzejczak W, Colony stimulating factor 1 (CSF-1) and its in vivo role as delineated using osteopetrotic op/op mice. Postepy Biochem 1991 37:54-57[Medline]
  21. Sundquist KT, Cecchini MG, Marks SC, Jr, Colony-stimulating factor-1 injections improve but do not cure skeletal sclerosis in osteopetrotic (op) mice. Bone 1995 16:39[Medline]
  22. Araki M, Fukumatsu Y, Katabuchi H, Shultz LD, Takahashi K, Okamura H, Follicular development and ovulation in macrophage colony-stimulating factor-deficient mice homozygous for the osteopetrosis (op) mutation. Biol Reprod 1996 54:478-484[Abstract]
  23. Ryan GR, Dai XM, Dominguez MG, Tong W, Chuan F, Chisholm O, Russell RG, Pollard JW, Stanley ER, Rescue of the colony-stimulating factor 1 (CSF-1)-nullizygous mouse (Csf1(op)/Csf1(op)) phenotype with a CSF-1 transgene and identification of sites of local CSF-1 synthesis. Blood 2001 98:74-84[Abstract/Free Full Text]
  24. Ladner MB, Martin GA, Noble JA, Nikoloff DM, Tal R, Kawasaki ES, White TJ, Human CSF-1: gene structure and alternative splicing of mRNA precursors. EMBO J 1987 6:2693-2698[Medline]
  25. Kawasaki ES, Ladner MB, Wang AM, Van Arsdell J, Warren MK, Coyne MY, Schweickart VL, Lee MT, Wilson KJ, Boosman A, Stanley ER, Ralph P, et al Molecular cloning of a complementary DNA encoding human macrophage-specific colony-stimulating factor (CSF-1). Science 1985 230:291-296[Abstract/Free Full Text]
  26. Wong GG, Temple PA, Leary AC, Witek-Giannotti JS, Yang YC, Ciarletta AB, Chung M, Murtha P, Kriz R, Kaufman RJ, Ferenz CR, Sibley BS, et al Human CSF-1: molecular cloning and expression of 4-kb cDNA encoding the human urinary protein. Science 1987 235:1504-1508[Abstract/Free Full Text]
  27. Cerretti DP, Wignall J, Anderson D, Tushinski RJ, Gallis BM, Stya M, Gillis S, Urdal DL, Cosman D, Human macrophage-colony stimulating factor: alternative RNA and protein processing from a single gene. Mol Immunol 1988 25:761-770[CrossRef][Medline]
  28. Rettenmier CW, Roussel MF, Ashmun RA, Ralph P, Price K, Sherr CJ, Synthesis of membrane-bound colony-stimulating factor 1 (CSF-1) and downmodulation of CSF-1 receptors in NIH 3T3 cells transformed by cotransfection of the human CSF-1 and c-fms (CSF-1 receptor) genes. Mol Cell Biol 1987 7:2378-2387[Abstract/Free Full Text]
  29. Rettenmier CW, Biosynthesis of macrophage colony-stimulating factor (CSF-1): differential processing of CSF-1 precursors suggests alternative mechanisms for stimulating CSF-1 receptors. Curr Top Microbiol Immunol 1989 149:129-141[Medline]
  30. Rettenmier CW, Roussel MF, Differential processing of colony-stimulating factor 1 precursors encoded by two human cDNAs. Mol Cell Biol 1988 8:5026-5034[Abstract/Free Full Text]
  31. Price LK, Choi HU, Rosenberg L, Stanley ER, The predominant form of secreted colony stimulating factor-1 is a proteoglycan. J Biol Chem 1992 267:2190-2199[Abstract/Free Full Text]
  32. Pollard JW, Lin EY, Zhu L, Complexity in uterine macrophage responses to cytokines in mice. Biol Reprod 1998 58:1469-1475[Abstract/Free Full Text]
  33. Yao GQ, Wu JJ, Sun BH, Troiano N, Mitnick MA, Insogna K, The cell surface form of colony-stimulating factor-1 is biologically active in bone in vivo. Endocrinology 2003 144:3677-3682[Abstract/Free Full Text]
  34. Lieschke GJ, Stanley E, Grail D, Hodgson G, Sinickas V, Gall JA, Sinclair RA, Dunn AR, Mice lacking both macrophage- and granulocyte-macrophage colony-stimulating factor have macrophages and coexistent osteopetrosis and severe lung disease. Blood 1994 84:27-35[Abstract/Free Full Text]
  35. Cohen PE, Hardy MP, Pollard JW, Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice. Mol Endocrinol 1997 11:1636-1650[Abstract/Free Full Text]
  36. Bronson F, Dagg C, Snell G, Reproduction. In: Green E, (ed.). Biology of the laboratory mouse, vol. 1, 2nd ed. New York: Dover Publications Inc 1966 187-204
  37. Dai XM, Zong XH, Sylvestre V, Stanley ER, Incomplete restoration of colony-stimulating factor 1 (CSF-1) function in CSF-1-deficient Csf1op/Csf1op mice by transgenic expression of cell surface CSF-1. Blood 2004 103:1114-1123[Abstract/Free Full Text]
  38. Tuck DP, Cerretti DP, Hand A, Guha A, Sorba S, Dainiak N, Human macrophage colony-stimulating factor is expressed at and shed from the cell surface. Blood 1994 84:2182-2188[Abstract/Free Full Text]
  39. Yao GQ, Sun BH, Weir EC, Insogna KL, Cell-surface CSF-1 expression by osteoblasts supports osteoclastogenesis. J Bone Min Res 1999 14: (suppl 1) S242



This article has been cited by other articles:


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
G.-Q. Yao, J.-J. Wu, S. Ovadia, N. Troiano, B. H. Sun, and K. Insogna
Targeted overexpression of the two colony-stimulating factor-1 isoforms in osteoblasts differentially affects bone loss in ovariectomized mice
Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E714 - E720.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/2/331    most recent
biolreprod.105.045047v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.
Agricola
Right arrow Articles by Ovadia, S.
Right arrow Articles by Yao, G.-Q.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS