Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print November 23, 2005.
Biol Reprod 2005, 10.1095/biolreprod.105.045146
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/3/560    most recent
biolreprod.105.045146v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.
Agricola
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.
BIOLOGY OF REPRODUCTION 74, 560–568 (2006)
DOI: 10.1095/biolreprod.105.045146
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Influence of TRP53 Status on FAS Membrane Localization, CFLAR (c-FLIP) Ubiquitinylation, and Sensitivity of GC-2spd (ts) Cells to Undergo FAS-Mediated Apoptosis1

Yamini Chandrasekaran 3, Chad M. Mckee 4, Yang Ye 3, and John H. Richburg 2 3

College of Pharmacy,3 Division of Pharmacology and Toxicology Cell and Molecular Biology Graduate Program,4 The University of Texas at Austin, Austin, Texas 78712-0125

ABSTRACT

Previously we reported that testicular germ cells undergo FAS-mediated apoptosis after exposure of mice to the Sertoli cell toxicant mono-(2-ethylhexyl) phthalate (MEHP) and that this process is partially dependent on the TRP53 protein (p53). Recent reports have suggested that TRP53 may influence the ubiquitinylation and consequent proteosomal degradation of a negative regulator of FAS, CFLAR (L) (c-FLIP [L]), in human colon cancer cells. To further characterize the relationship between CFLAR and TRP53, we used the transformed germ cell line GC-2spd (ts), which harbors a temperature-sensitive Trp53 mutation that allows for TRP53 activation at 32°C. We report here that GC-2 cells expressed a 10-fold increase in basal cell membrane FAS levels and an increased sensitivity to FAS agonistic antibody (JO2)-triggered apoptosis only when they were maintained at the permissive TRP53 temperature. After JO2 exposure, CFLAR (L) protein levels were enhanced only at the nonpermissive TRP53 temperature (37°C) while real-time PCR results indicated an absence of Cflar(L) mRNA changes in GC-2 cells regardless of the temperature. Furthermore, transfection of GC-2 cells at 37°C with siRNA against Cflar resulted in reduction of CFLAR (L) protein levels and increased sensitivity to JO2-mediated apoptosis. The CFLAR (L) protein was also more strongly ubiquitinylated in response to JO2 treatment at the permissive TRP53 temperature. Taken together, these data suggest that the TRP53 protein influences the sensitivity of GC-2 cells to undergo FAS-mediated apoptosis by modulating the expression of FAS on their cell membranes and subsequently influencing the degradation of the antiapoptotic protein CFLAR (L).

apoptosis, CFLAR (c-FLIP), FAS, GC-2 cells, signal transduction, testis, toxicology, TRP53, ubiquitinylation

INTRODUCTION

Receptor-initiated apoptosis occurs by the binding of ligands belonging to the tumor necrosis factor (TNF) superfamily of proteins to their cognate death receptors present on the cell membrane [1]. The FAS receptor/FAS ligand (FAS/FASL) apoptosis signaling pathway has been widely studied and is well characterized (for review, see [2]). FAS, when activated by FASL, initiates a cascade of intracellular signals starting with the cleavage of the zymogen procaspase 8 to yield the active proteolytic enzyme caspase 8 [3]. Caspase 8 then activates other cellular caspases that are responsible for the characteristic biochemical and morphological processes of apoptosis [4]. The initiation of apoptosis does not, however, always culminate in cell death. Various inhibitors of the apoptotic process, including proteins of the inhibitor of apoptosis (IAP) family and cellular-FLICE inhibitory protein (c-FLIP; in mouse, CFLAR) are known to hinder the apoptotic cascade at various levels [5, 6]. CFLAR is an inhibitor of the death receptor activated pathway that acts by binding the adaptor protein FADD (FAS-associated death domain protein) [7]. The FADD protein binds to FASL-activated FAS (both ligands and receptors binding as trimers) and procaspase 8 to make up the complex called the death-inducing signaling complex (DISC) [8, 9]. At the DISC, the (S) and (R) forms of CFLAR completely inhibit caspase 8 cleavage, while the (L) form appears to allow for partial processing of caspase 8 [6, 10]. However, the role of CFLAR (L) in caspase 8 inhibition remains controversial, as it has been described both as a proapoptotic or antiapoptotic modulator by different groups. It appears that the level of expression of CFLAR (L) predisposes its ability to act as a proapoptotic or antiapoptotic protein [1113].

Mono-(2-ethylhexyl) phthalate (MEHP) is the active toxic metabolite of the plasticizer di-(2-ethylhexyl) phthalate (DEHP) [14] that is found widely dispersed in the environment and causes Sertoli cell injury [15]. We have previously demonstrated a significant role for the FAS death receptor signaling pathway in triggering germ cell apoptosis after MEHP exposure of mice and rats [1619]. Additionally, recent studies in our laboratory using Trp53+/+ and Trp53–/– mice have indicated a role for the TRP53 protein in modifying the ability of FAS to be activated in germ cells in response to MEHP [20]. The absence of the TRP53 protein is strongly correlated with increasing levels of CFLAR (L) protein after exposure to MEHP, an absence of increased Cflar (L) mRNA levels, and perhaps modest decreases of FAS on the germ cell plasma membrane [20]. The TRP53 protein has also been reported to influence the degradation of the CFLAR protein via the process of ubiquitinylation in colon cancer cells by Fukazawa et al. [21]. Ubiquitinylation is the process by which intracellular proteins in eukaryotes are targeted for degradation [22]. Proteins conjugated with four or more ubiquitin molecules allow for their recognition and subsequent cleavage by the proteasome [23]. Therefore, we hypothesized that the FAS-activated apoptotic pathway in germ cells could be influenced by the modification of protein levels of CFLAR (L), perhaps by ubiquitinylation in a TRP53-dependant manner. In the present work, we use the transformed germ cell line GC-2spd (ts), which has a temperature-sensitive expression of TRP53, to further characterize the involvement of TRP53 in the sensitivity of germ cells to FAS-mediated apoptosis.

Germ cell-2 spermatid temperature-sensitive cells (GC-2spd [ts]) were originally created by Hofmann et al. to study the process of germ cell differentiation [24]. Preleptotene spermatocytes from 6-wk-old BALB/c mice were transformed into GC-2 cells using the SV40 virus's large T antigen and cotransfecting them with a plasmid carrying a Trp53 mutant gene. The mutant TRP53 protein (point mutation at Val-135) is fully active at 32°C, but completely inactive at 39°C, and only partially active at 37°C due to the improper folding of the protein that inhibits its nuclear localization. Therefore, by modulating the temperature at which GC-2 cells are grown, we could functionally create Trp53+/+ or Trp53–/– cells. Furthermore, this cell line is an appropriate in vitro model for our purposes because these cells were derived from spermatocytes, which are the germ cell type most sensitive to apoptosis after toxicant-induced Sertoli cell injury.

It has been shown that the expression of functional FASL is important for mediating germ cell apoptosis after MEHP-mediated Sertoli cell injury [19, 25]. Because germ cells are not the direct targets of MEHP [26], in the present work using cells in vitro, we employ the JO2 (anti-Fas) antibody to mimic the contribution of Sertoli cell FasL to elicit GC-2 cell apoptosis. We report here a TRP53-dependent increase in membrane FAS expression in GC-2 cells maintained at the TRP53 permissive temperature of 32°C and increased sensitivity to JO2-induced apoptosis only at this temperature. At the nonpermissive TRP53 temperature, GC-2 cells expressed higher levels of CFLAR (L) protein in response to JO2. By decreasing the amounts of CFLAR via an siRNA approach, we were able to resensitize these cells to JO2-induced apoptosis. We also demonstrated a robust ubiquitinylation of CFLAR (L) at the TRP53 permissive temperature implying an active degradation mechanism for CFLAR within these cells. These findings demonstrate that the GC-2 system can be used to model death receptor-activated apoptosis.

MATERIALS AND METHODS

Cell Culture

Germ cell-2 spermatid (temperature sensitive) cells (GC-2spd [ts] or GC-2) cells were obtained from the American Type Culture Collection (Rockville, MD). They were cultured at 37°C in a 5% CO2 atmosphere, in Dulbecco modified Eagles media (DMEM; Life Technologies, Carlsbad, CA) containing 4.5 g/L glucose, L-glutamine, 110 mg/L sodium pyruvate, pyridoxine hydrochloride, and supplemented with 10% fetal bovine serum and 100 U/ml penicillin-streptomycin. These cells express a temperature-sensitive TRP53 mutant protein (TRP53Val-135), which completely localizes to the nucleus only at the lower temperature of 32°C. In all experiments, TRP53 was activated by transferring cells cultured for 24 h at 37°C to an incubator maintained at 32°C for a further 24 h.

Treatments

GC-2 cells that had been in culture for 48 h (grown at either temperature) were exposed to various treatments including JO2 (anti mouse-FAS antibody, 554254; Pharmingen, San Diego, CA), hamster IgG (Isotype control for JO2, 553961; Pharmingen), MEHP (TCI America, Portland, OR), or DMSO (Sigma Aldrich, San Diego, CA) for the indicated time periods. The concentrations used for JO2 (5 µg/ml) and MEHP (200 µM) treatments were based on previous studies in primary cell cultures from testicular cells [16, 17].

Apoptosis Measurement in GC-2 Cells by Flow Cytometry

The Annexin V-Propidium Iodide (PI) assay was used to identify apoptotic cells via Annexin V's ability to bind to externalized phosphotidylserine molecules [27]. PI is expelled from live (Annexin-negative cells) and early apoptotic cells (Annexin V-positive cells) that maintain their cell membrane integrity, while being retained by dead cells or cells undergoing late apoptosis/secondary necrosis (both Annexin V- and PI-positive cells). Cell death is qualified based on their apoptotic characteristics using a flow cytometer. Cells in culture, after appropriate treatment(s), were collected by trypsinization (using a 0.25% solution of trypsin with 0.03% EDTA) followed by centrifugation at 400 x g for 6 min. They were resuspended in fresh media for about 30 min to neutralize the effects of trypsin. The cells were then pelleted by centrifugation at 400 x g and the cell pellets were washed and resuspended in binding buffer as per the manufacturer's instructions (ApoAlert Annexin-V FITC apoptosis kit; Clonetech, San Diego, CA). Approximately 105–106 cells/sample were incubated with 5 µl of Annexin-V conjugated with fluorescein isothiocyanate (FITC) for 5–10 min. The cells were then incubated with 10 µl of PI for 2–5 min. Flow cytometric analysis of these cells was carried out on a Coulter Epics XL cytometer.

Flow Cytometric Analysis of Cell Surface FAS Receptor Expression on GC-2 Cells

The FAS-tagging procedures were performed according to the method described previously by Jin et al. [28] with modifications. GC-2 cells maintained at either 37°C or 32°C were rinsed with phosphate buffered saline (PBS) and were detached from culture plates using a trypsin solution. Cells were resuspended in DMEM media and were centrifuged at 4°C at 400 x g for 5 min followed by a wash with PBS supplemented with 2% fetal bovine serum (FBS). The cell pellets were then resuspended in 50 µl of PBS (with 2% FBS) containing 0.02 µg/µl of the primary antibody against FAS (JO2; Pharmingen) or the isotype control (hamster IgG; Pharmingen). These cells were incubated with the primary antibody at 4°C for 1 h followed by a wash with PBS. They were then incubated with a secondary antibody (anti-hamster IgG) conjugated to Alexa fluor 488 (A-21110; Molecular Probes, Eugene, OR) at 0.02 mg/ml for 1 h at 4°C, in the dark. After washing the cells with PBS, they were resuspended in PBS and flow cytometric analysis of these cells was then carried out on the Coulter Epics XL cytometer.

Immunocytochemistry

Localization of FAS or TRP53 was examined in acetone:methanol (1:1)-fixed, Triton X-100 permeabilized, GC-2 cells grown on chamber slides (154526; Lab Tek, Hatfield, PA) with or without a 3-h JO2 treatment, using rabbit (anti-FAS, sc-716) or goat (anti-P53, sc-1312) polyclonal antibodies purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The primary antibodies were detected using Alexa fluor 488-conjugated secondary antibodies from Molecular Probes. Images were viewed using a Nikon E800 microscope, captured with a Nikon Cool-SNAP digital camera, and processed using MetaMorph Imaging System software (v 6). Assay controls included incubation of the cells without primary antibody or by substituting the primary antibody with rabbit/goat IgG at the same dilution as primary antibody.

Immunoprecipitation

GC-2 cells were treated with JO2 for a period of 3 or 6 h before being collected for analysis. Cells were lysed using a RIPA lysis buffer containing 150 mM NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 8.0), and 1 mM PMSF. Lysates were precleared with 50 µl (50% slurry) of protein-G sepharose beads (Amersham Pharmacia Biosciences, Piscataway, NJ) in 500 µl of the lysis buffer for 2 h. The supernatant was retained following clearing and was incubated with 2.5 µg of a rat monoclonal anti-c-FLIP antibody (ab16078; AbCam, Cambridge, MA) for an hour at 4°C. Following this incubation, 50 µl of sepharose was added to the supernatant and the incubation continued for a further 2 h. The captured antibody-protein-G complexes were then washed three times with lysis buffer and once with PBS. After the addition of the SDS running buffer, protein G was removed from the complex by boiling for 5 min, after which the complexes were loaded onto a 10–12% Bis-Tris gel and separated by electrophoresis. The proteins were transferred to a nitrocellulose membrane and subsequently detected with the c-FLIP rat monoclonal antibody or a rabbit polyclonal antibody against ubiquitin (SPA-200; Stressgen, Victoria, BC).

Real-Time-PCR Analysis and Semiquantitative RT-PCR Analysis

Total RNA was isolated from GC-2 cells using the QIAGEN (Valencia, CA) RNeasy RNA isolation kit. First-strand complementary cDNA was made using 1–2 µg total RNA in the presence of Superscript II reverse transcriptase and oligo-dT primer (both from Life Technologies, Carlsbad, CA). PCR reaction was performed using the semiquantitative method or real-time-PCR method as indicated. PCR products of Cflar (L) (297 bp), Fas (469 bp) and ß-actin/Actb (in mouse; 387 bp) were amplified using the following primers: Cflar (L), 5' aatgtggactctaagcccctgcaacc 3' and 5' cgtaggagccaggatgagtttcttcc 3'; Fas, 5' catgccaacctggtaaaaaaaaagttgagg 3' and 5' attggtatggtttcacgactggaggttcta 3'; and Actb, 5' aggcatcctgaccctgaagtac 3' and 5' tcttcatgaggtagtctgtacg 3' for the semiquantitative PCR reactions. Conditions for the coamplification of Cflar (L) and Actb were 92°C for 1 min, 58°C for 1 min, and 72°C for 40 sec for 26 cycles; and for Fas and Actb were 92°C for 1 min, 59°C for 1 min, and 72°C for 35 sec for 26 cycles in 1.5 mM MgCl2. The primers for the real time-PCR reactions for Cflar (L) were 5' aaccccagaccgttggtgt 3' and 5' cgccaagctctgctcca 3'; and for Actb were 5' ccagcagatgtggatcagca 3' and 5' cttgcggtgcacgatgg 3'. Primers were designed with the aid of Primer Express, generating a 64-bp product for both Actb and Cflar. Real-time was performed on a Stratagene Mx3000P thermocycler using the Brilliant SYBR green PCR master mix (600548; Stratagene, La Jolla, CA). The PCR conditions included a 10-min, 95°C activating cycle, followed by 45 amplification cycles of 95°C for 30 sec, 60°C for 1 min, and 72°C for 30 sec. To control against mRNA variation between samples, Actb controls were used for each sample. A baseline calibrator was run for each cDNA set used and individual samples were run in duplicate. As the expression levels of each sample were normalized to a single calibrator sample, the numerical values from the samples at either temperature can be directly compared.

The siRNA Transfection Protocol

Small interfering RNA or siRNA technology is used to cause sequence-specific degradation of mRNA (of a desired gene), thereby resulting in gene silencing. We obtained siRNA against mouse c-FLIP (S/L) from Santa Cruz Biotechnology (sc-35389) to knock down the protein expression of CFLAR (L) in GC-2 cells. GC-2 cells were plated in six-well culture plates in DMEM media containing serum, but lacking antibiotics. The cells were allowed to grow to 40–50% confluence before being transfected with siRNA against Cflar or with a control siRNA that was fluorescein-labeled. The siRNA was incubated in transfection medium along with the transfection reagent (both provided by Santa Cruz for use in siRNA transfection protocols) at room temperature for 25 min before being added to culture wells. The appropriate quantities of each reagent used were based on the recommendations of the company. The cells were incubated with the siRNA mixture for a period of 24–48 h and then subjected to mRNA or protein analysis, as discussed in the results. In addition, GC-2 cells were exposed to the siRNA mixture for 48 h before being subjected to JO2 treatment for the time periods indicated in the results.

Western Blot Analysis

GC-2 cells were evaluated for membrane or total cellular protein levels of FAS, CFLAR, or P21/CDKN1A (in mouse) by Western blot analysis. Western blots were performed as previously described [19] using the primary antibodies against c-FLIP (06–697; Upstate Cell Signaling Systems, Charlottesville, VA), FAS (sc-716; Santa Cruz Biotechnology), and P21 (sc-756). Horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) were used to detect primary antibodies. Signals were detected by the use of an ECL kit (Amersham Pharmacia Biosciences). Images were collected by a Kodak DC-290 digital camera and densitometric analysis carried out using Kodak 1D Image Analysis Software (Kodak Digital Sciences, Rochester, NY). Each protein was analyzed in a minimum of three GC-2 sample sets, and representative blots have been presented. Equal loading was verified by either comparing expression levels of actin/ACTB (in mouse) or when analyzing membrane protein levels, by staining the blots with amido-black.

Statistics

Significance between groups was evaluated using parametric single-factor analysis of variance with Fisher's protected least significance differences test comparison with a significance value of P < 0.05 using Statview software (SAS Institute Inc., Cary, NC).

RESULTS

Expression Profile of Various Apoptotic Proteins in GC-2 Cells Based on TRP53 Activation Status

Immunocytochemistry (ICC) was performed to determine the cellular localization of TRP53 at different temperatures. As shown in Figure 1A (I, ii), TRP53 localized entirely in the nucleus of cells maintained at the permissive temperature of 32°C (ii), while being expressed in both cytosolic and nuclear compartments in cells maintained at 37°C (i). These results are similar to those demonstrated previously [24]. FAS protein expression in GC-2 cells was also analyzed by ICC and by Western blot analysis of membrane fractions of these cells. FAS was detected by ICC in cells grown at both temperatures, with cells at 32°C expressing abundant amounts of FAS (Fig. 1A, iii, iv). Cells at both temperatures showed areas of intense FAS immunolocalization in response to exposure to JO2 (Fig. 1A, v, vi). The FAS membrane expression profile as determined by Western blots was equally different between the two cell types, with an 8–10 fold increase in the membrane levels of FAS in cells at 32°C versus those grown at 37°C (Fig. 1C, i). Quantitation of FAS receptor expression on the cell surface of GC-2 cells cultured at 32 or 37°C, by flow cytometry, indicated that about 65% cells maintained at 32°C were positive for the FAS receptor as compared with 7% of the cells maintained at 37°C (Fig. 1B, i–v). Additionally, analyses of basal Fas mRNA levels in cells cultured for 48 h at both 37 and 32°C were performed using semiquantitative RT-PCR. GC-2 cells at the permissive TRP53 temperature expressed nearly 3-fold to 4-fold more Fas mRNA than cells at the nonpermissive temperature (Fig. 1C, ii). Furthermore, the activation of TRP53 at 32°C, and not at 3°C, was demonstrated by the levels of the TRP53 transcription product P21/CDKN1A. Cells grown at 32°C, but not at 37°C, showed abundant expression of the CDKN1A protein (Fig. 1C, vi). Both CFLAR (L) and (S) were found to be expressed in GC-2 cells at both temperatures and at comparable levels (Fig. 1C, iv, v).


Figure 1
View larger version (45K):
[in this window]
[in a new window]
 
FIG. 1. Expression profile of apoptotic proteins in GC-2 cells. A) Immunocytochemistry: representative images of TRP53- (i, ii) and FAS- (iii–vi) stained GC-2 cells at both the nonpermissive (37°C) (i, iii, v) and permissive (32°C) (ii, iv, vi) TRP53 temperatures. GC-2 cells were either treated with JO2 (5 µg/ml) (v, vi) or untreated (iii, iv) before being immunostained for FAS. Cells were immunostained with primary antibodies against TRP53 or FAS and secondary antibodies conjugated to FITC. Bars = 30 µm (i–vi). B) Flow cytometry: representative graphs (i–iv) of membrane FAS positive (ii, iv) or IgG positive (i, iii) GC-2 cells at 37°C (i, ii) or at 32°C (iii, iv) as analyzed by flow cytometry and a graphical representation (v) of the results from three independent experiments. Values represent mean ± SEM. Asterisk denotes significant differences (P < 0.05) in the number of Fas membrane-positive cells at 37°C versus 32°C. C) Representative Western blots for FAS (in membrane fraction) (i), CFLAR (L) and (S) (iv, v, respectively), CDKN1A (vi), and ACTB (vii) loading control are shown here from cells grown at both the nonpermissive and permissive TRP53 temperatures. Representative gels for Fas and Actb mRNA levels in cells maintained at both 37°C and 32°C (ii, iii)

GC-2 Cells Are Insensitive to MEHP Treatment, While Sensitivity of GC-2 Cells to Anti-FAS (JO2) Treatment Is Dependent on TRP53 Activation

GC-2 cells cultured at 37 or 32°C were exposed to 200 µM MEHP for up to 24 h to confirm that MEHP does not act directly on germ cells and instigate their demise. Analysis of the incidence of cell apoptosis by flow cytometry using the Annexin V-PI assay revealed no increases in cell death of GC-2 cells after exposure to MEHP or DMSO vehicle control (Fig. 2, A and B). The results were obtained from three independent groups of experiments.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of apoptosis of GC-2 cells by Annexin-PI assay after exposure to MEHP or JO2. A and B) Graphical representation of apoptotic GC-2 cells at the nonpermissive (A) and at the permissive (B) TRP53 temperature, after exposure to MEHP (200 µM), DMSO, or matched time-point controls. Values represent the mean ± SEM. No significant changes are observed. C and D) Graphical representation of the percentage of GC-2 cells undergoing apoptosis at the nonpermissive (C) and at the permissive (D) TRP53 temperature, after exposure to JO2 (5 µg/ml), Hamster IgG (5 µg/ml), or matched time-point controls. Values represent the mean ± SEM. Asterisk denotes significant differences (P < 0.05) in the apoptotic index between control cells and cells treated with JO2 (both at 32°C) at matched time points

Earlier results indicated that transferring GC-2 cells to a lower temperature not only activated TRP53 but also caused a substantial increase in FAS membrane levels in these cells (Fig. 1B, iii and iv; C, i). Flow cytometric analysis of Annexin V-PI-stained cells indicates that GC-2 cells at the TRP53 permissive temperature display a near threefold increase in cell death (42% early and late apoptotic cells compared with 15% positive stain for control cells) by 24 h after exposure (Fig. 2, C and D). Cells grown at the nonpermissive TRP53 temperature were not killed upon exposure to JO2. Cells grown at either temperature were also not responsive to the presence of hamster IgG, an isotype control for the JO2 antibody.

TRP53 Status of GC-2 Cells Determines the Protein Expression Levels of CFLAR (L) in Response to Anti-FAS Treatment, but Not mRNA Levels

Western blot analysis of CFLAR (L) levels in GC-2 cells treated with JO2 showed that CFLAR (L) levels were elevated threefold in GC-2 cells grown at 37°C at both 3 and 6 h after exposure, while they remained below control levels in cells at 32°C (Fig. 3A). Real-time PCR assessment of Cflar (L) transcription in response to JO2 addition revealed that cells grown at both temperatures did not demonstrate any significant changes in their Cflar (L) mRNA levels at any time point after JO2 treatment (Fig. 3B, i and ii). Direct comparison of the baseline levels of Cflar (L) mRNA in cells maintained at either 32 and 37°C indicated that, at 32°C, GC-2 cells expressed approximately 0.6-fold more Cflar (L) mRNA as compared with cells at 37°C.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. Western blot analysis of CFLAR (L) protein levels and real-time PCR analysis of mRNA levels in response to JO2 treatment. A) Western blots: representative blots from three samples for each time point are provided; CFLAR (L) (~55 kDa) bands and ACTB (~43 kDa) are shown here for cells grown at both 37°C and 32°C temperatures after JO2 (5 µg/ml) treatment, with their matched time controls. C, Controls; J, JO2 treated cells. Indicated above each treated sample are the net intensity of expression as a percent of untreated matched time control's intensity and normalized to ACTB. B) Real-time PCR results: a graphical representation of relative expression levels (relative to the same calibrator) of Cflar (L) mRNA with or without JO2 treatment at nonpermissive (i) and permissive (ii) TRP53 temperatures. Values represent the mean ± SEM. No significant changes are observed

Transfection of GC-2 Cells with siRNA Against Cflar (S/L) Leads to Reduced Cflar (L) mRNA Levels, Decreased CFLAR (L) Protein Expression, and Increased Sensitivity to JO2-Induced Apoptosis

Levels of Cflar (L) mRNA were analyzed using semiquantitative RT-PCR at 24, 30, and 48 h after Cflar siRNA transfection in cells grown at 37°C. A reduction in mRNA levels by 50–60% was observed at the 24-h time point (Fig. 4A). However, the reduction was not maintained beyond this time point, with mRNA levels returning to baseline levels by 48 h. Comparisons of Cflar (L) mRNA levels were made against control siRNA transfected cells, as well as with cells that had not undergone transfection. At 48 h after transfection, we were able to demonstrate a significant reduction in CFLAR (L) protein levels by Western blot analysis (60–80% reduction) in siRNA transfected cells compared with corresponding controls (Fig. 4B). Addition of JO2 to GC-2 cells that had been transfected with Cflar siRNA for 48 h and maintained at 37°C caused a near fourfold increase in apoptosis as compared with matched time controls at both 6 and 12 h after exposure (Fig. 4C).


Figure 4
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. Analysis of Cflar (L) mRNA and protein levels and apoptotic levels in response to JO2 after knockdown of CFLAR (L) by siRNA. A) Representative gels for Cflar (L) mRNA levels from GC-2 cells at the nonpermissive TRP53 temperature exposed to Cflar siRNA for 24, 30, and 48 h. Actb is used as an internal control. C, Controls; CS, control siRNA transfected cells; F, Cflar siRNA transfected cells. B) Representative Western blots are provided; bands for CFLAR (L) (~55 kDa) and actB (~43 kDa) are shown here for cells grown at the nonpermissive TRP53 temperature, transfected with control siRNA (CS), Cflar siRNA (F), or matched time controls (C). C) Flow cytometry: a graphical representation of the percentage of GC-2 cells with or without Cflar siRNA transfection and exposed to JO2 (5 µg/ml) and undergoing apoptosis, or their matched time-point controls. Values represent the mean ± SEM. Asterisk denotes significant differences (P < 0.05) in the apoptotic index between control Cflar siRNA transfected cells and siRNA transfected cells treated with JO2 at matched time points

Ubiquitinylation of CFLAR (L) in GC-2 Cells Is Increased when TRP53 Is Active and after Exposure to JO2

To determine if CFLAR undergoes posttranslational modification by ubiquitin, CFLAR (L) was immunoprecipitated from lysates of GC-2 cells following exposure to JO2. The complexes collected through this procedure upon being analyzed by Western blot analysis showed that cells at the TRP53 permissive temperature had more extensive ubiquitin-tagged CFLAR (L) than cells at the nonpermissive temperature (Fig. 5). Polyubiquitinylated forms of CFLAR were revealed as discrete bands with molecular weights of 83–98 kDa on the Western blot that corresponded to the predicted mass of CFLAR (L) plus ubiquitin (Fig. 5A). Polyubiquitinylated levels of CFLAR were low in GC-2 cells grown at the TRP53 nonpermissive temperature but were at readily detectable levels after JO2 addition (Fig. 5A, lanes 1–3). Cells cultured at the TRP53 permissive temperature exhibited a higher basal level of ubiquitinylation, which also increased 3 h after JO2 treatment (Fig. 5A, lanes 4–6). Interestingly, at 6 h after JO2 exposure, the levels of the polyubiquitin-labeled CFLAR complex had already begun to decline in these cells. This reduction is likely through posttranscriptional targeting to the proteasome. Immunoprecipitated complexes were also probed using the anti-c-FLIP rat monoclonal antibody. CFLAR (L) was similarly expressed in both cell types in the absence of JO2 treatment. With the addition of JO2, three or more protein bands approximately 8.5 kDa apart in addition to the naïve CFLAR protein band were generated, corresponding to the sizes expected for ubiquitin-tagged CFLAR protein (Fig. 5B).


Figure 5
View larger version (52K):
[in this window]
[in a new window]
 
FIG. 5. Immunoprecipitation analysis of CFLAR (L) ubiquitinylation in GC-2 cells exposed to JO2. A) Analysis of ubiquitin: representative blots from three samples for each time point are provided; protein complexes bound to CFLAR were probed for ubiquitin tag in cells grown at both 37 and 32°C and exposed to JO2 (5 µg/ml). Lanes 1–3 represent samples at the nonpermissive temperature treated with JO2, while lanes 4–6 represent samples from cells at the permissive TRP53 temperature also exposed to JO2 for indicated time periods. B) Analysis of CFLAR (L): representative blots from three samples for each sample are provided; lysates from the pull-down assay were probed for CFLAR (L) at 6 h after JO2 exposure. C, Controls; J, JO2 treated samples; IP, antibody used for the immunoprecipitation; WB, antibody used for the Western blot

DISCUSSION

In general, depending on the physical injury or chemical toxicant that the testis is exposed to, germ cell apoptosis is initiated either by the activation of the death receptor pathway or via activation of the stress-response pathway involving the mitochondrial release of cytochrome C [16, 17, 29, 30]. Sertoli cell injury instigated by the active phthalate monoester, MEHP, results in the death of germ cells through the paracrine interaction of Sertoli cell-produced FASL with FAS expressed on germ cells [16, 18]. Our previous work in the testis has indicated a role for TRP53 in FAS receptor membrane localization, in a transcription-independent manner, in response to MEHP [20]. In addition, we have also been able to show that the activation of the FAS pathway as indicated by procaspase 8 processing in testicular germ cells was abrogated in mice lacking the expression of TRP53, a condition that may be directly linked to the increased expression of CFLAR (L). These findings in vivo led us to hypothesize that the CFLAR (L) protein is modified in a TRP53-dependent manner in germ cells after FAS activation. The TRP53 protein is a transcription factor that, in many cell types, causes the upregulation in levels of proapoptotic proteins, such as bax, PUMA, NOXA, FAS, and DR5 [3134]. Therefore, the aim of the present in vitro work with GC-2 cells was to functionally characterize the relationships between FAS, TRP53, and CFLAR in germ cell apoptosis.

GC-2 cells were originally created to provide an in vitro model of germ cell differentiation [24]. GC-2 cells were created from spermatocytes that had been immortalized with the SV40 virus's large T antigen and cotransformed with a mutant Trp53 gene. The TRP53 protein is properly folded, allowing for its nuclear localization at the lower temperatures in GC-2 cells, where it binds the large T antigen and suppresses its proliferative ability. This enables the cells to undergo differentiation. However, 2 years after establishing the GC-2 cell line, the authors were unable to detect markers for the various differentiated germ cell types in cells grown at the TRP53 permissive temperature (32°C) [35]. The cells were therefore deemed unsuitable for further studies. However, here we show that these transformed cells serve as a suitable model to study apoptosis, due to their differential TRP53 activity based on the temperature at which they are maintained. Moreover, GC-2 cells were found to express FAS and CFLAR (L), as shown by Western blot analyses, ICC, or flow cytometry (Fig. 1, A–C), and responded to FAS activation in the same way as the testicular germ cells from Trp53+/+ and Trp53–/– mice in our previous in vivo studies [20].

GC-2 cells maintained at 37°C were deemed the Trp53–/– cells based on a lack of CDKN1A expression in these cells, as demonstrated in Fig. 1C (vi). These cells were created from spermatocytes, the germ cell subtype most sensitive to MEHP-induced apoptosis [18]. However, MEHP does not act directly on germ cells to mediate their apoptotic demise. Rather, MEHP-induced germ cell apoptosis occurs indirectly via Sertoli cell-expressed FASL activating germ cell FAS receptors. Therefore, as expected, we were unable to observe increases in the incidence of apoptotic GC-2 cells following exposure to MEHP at either the TRP53 permissive or nonpermissive temperatures (Fig. 2, A and B). In the present study, we used the FAS agonistic antibody JO2, to mimic in vitro the elucidation of FASL by Sertoli cells and the activation of FAS-dependent germ cell apoptosis. The JO2 antibody has been shown to efficiently trigger apoptosis in murine cells expressing the FAS receptor [36]. GC-2 cells were found to express nearly 10-fold more FAS protein on the cell membrane at the TRP53 permissive temperature compared with the cells at the nonpermissive temperature (Fig. 1, B and C), and this could easily account for the sensitivity of GC-2 cells maintained at 32°C to JO2-induced apoptosis (Fig. 2D).

In our studies with mice, we had observed an increase in CFLAR (L) protein levels after MEHP exposure without any changes in the rates of its transcription and only in the Trp53 gene-deficient mice. Thus, activation of FAS appeared to be a requisite for the retention or stabilization of CFLAR (L) in these germ cells [20]. Similar to the in vivo data, we found that GC-2 cells maintained at the TRP53 nonpermissive temperature had increased levels of the CFLAR (L) protein only after exposure to the JO2 antibody (Fig. 3A). Upon examination of CFLAR (L) protein expression in GC-2 cells treated with JO2, we were able to detect approximately threefold increases in CFLAR (L) after 3 and 6 h of JO2 exposure (Fig. 3A) only in cells lacking active TRP53. On the other hand, in cells at the permissive TRP53 temperature, CFLAR (L) protein levels were decreased by nearly 25–50% of the control values after JO2 treatment (Fig. 3A). The observed increase of CFLAR in cells maintained at 37°C cells could not be accounted for by changes in its transcription as demonstrated by real-time PCR analysis (Fig. 3B, i). Taken together, these observations suggest that in vitro increases in CFLAR levels in the absence of TRP53 are due to an alteration in the stability and/or degradation of the protein as well.

The influence of the cellular TRP53 status to modulate CFLAR ubiquitinylation in colon cancer cells has been recently reported [21]. To examine if CFLAR (L) was being degraded posttranscriptionally in a TRP53-dependent manner, we performed immunoprecipitation (IP) experiments to detect ubiquitinylation of CFLAR (L) in GC-2 cells after JO2 exposure. In cells at the nonpermissive TRP53 temperature, ubiquitin bound protein complexes isolated by the anti-FLIP antibody and identified by an ubiquitin recognizing antibody could only be detected after JO2 treatment (Fig. 5A, lanes 1–3), indicating that CFLAR was being tagged for degradation in these cells only after FAS activation. Interestingly, in TRP53 permissive cells, high expression levels of ubiquitinylated complexes could be detected in untreated control cells; with further increases in ubiquitinylation occurring 3 h after JO2 exposure (Fig. 5A, lanes 4 and 5). A comparison of the levels of these polyubiquitin complexes revealed that the CFLAR protein in the cells at the TRP53 permissive temperature were more robustly ubiquitinylated than those at the nonpermissive temperature. The CFLAR protein was therefore being more actively targeted to the proteasome for degradation in cells maintained at the TRP53 permissive 32°C. However, when the immunoprecipitated complexes were probed with an antibody against CFLAR, the intensity of the bands of CFLAR (L) protein complexed to ubiquitin from both cell types appeared similar (Fig. 5B, lanes 1 and 4). The apparent similarity in CFLAR levels between the samples can be accounted for by the differences in cell density of GC-2 cells grown at the two temperatures (more confluent at 37°C) and hence the greater relative number of CFLAR molecules isolated during the IP assay from cells at 37°C.

To test if the retention of CFLAR (L) was responsible for the insensitivity of GC-2 cells maintained at 37°C to JO2, we transiently reduced CFLAR protein expression by transfecting these cells with siRNA against Cflar. Cells transfected with Cflar siRNA for 48 h displayed a 60–80% reduction in the protein levels of CFLAR (L) (Fig. 4B), and this resulted in sensitizing the cells to JO2-induced FAS activation (Fig. 4C). A near fourfold increase in GC-2 apoptosis was observed as a result of the siRNA-induced CFLAR protein reduction (Fig. 4C). These results affirm a role for CFLAR (L) in attenuating FAS-activated apoptosis in germ cells. However, the increases in apoptotic levels from nearly 7% to 8% in control Cflar siRNA transfected cells to about 20% in siRNA-transfected cells exposed to JO2, though significantly different, are minimal. These results can be explained by the measured low FAS membrane expression levels (Fig. 1B) in cells grown at the nonpermissive TRP53 temperature. Therefore, the combination of reduced membrane FAS levels and increased CFLAR (L) expression in GC-2 cells after JO2 exposure likely account for the decreased sensitivity of these cells to apoptosis.

An important insight gained by these experiments is the indication that the TRP53 status of the cell may have a strong influence over the extent of CFLAR (L) protein degradation within distinct germ cell subtypes. However, it should be noted that the ubiquitinylation of CFLAR (L), as evident from the results in Figure 5, occurred in the GC-2 cells irrespective of their TRP53 status and only when FAS was activated (i.e., after JO2 treatment). Thus, the degradation of CFLAR (L) seems to be coupled to the activation of FAS. We also show that the activation of TRP53 in GC-2 cells directly corresponds to increased mRNA and hence the increased protein expression levels of FAS on the germ cell membrane (Fig. 1, A–C). The binding of FASL (or the anti-FAS antibody) to FAS on the membrane of these cells determines the amount of DISC formed, and therefore, DISC formation is likely more robust in TRP53 permissive GC-2 cells with their greater concentrations of FAS. The protein CFLAR (L) is typically recruited to the formed DISC complex. To negate CFLAR's inhibitory influence and ensure that the cell undergoes apoptosis, the cell may mediate degradation of CFLAR at this point of its recruitment. In our in vivo model, the expression levels of membrane FAS in testicular cells of Trp53–/– versus Trp53+/+ mice were not significantly different except at the 12-h time point after MEHP exposure. Thus, in vivo, the increased expression of CFLAR (L) protein in the Trp53–/– mice between 1 and 12 h after MEHP exposure correlated to an absence of their degradation as influenced by the TRP53 status of the cell and perhaps not due to relative differences in the ability of these cells to form a DISC complex. An analysis of DISC formation in germ cells of Trp53+/+ and Trp53–/– mice exposed to MEHP would therefore be important to clarify whether TRP53 status influences the relative amount of DISC formed, and hence CFLAR (L) degradation. In GC-2 cells, however, the activity of the TRP53 protein does influence the expression levels of membrane FAS and hence the extent of CFLAR retention.

In our previously published in vivo work, we weren't able to correlate the differences in apoptosis between Trp53+/+ and Trp53–/– mice to TRP53-dependent alterations of membrane FAS expression. The use of total testicular lysates for membrane FAS analysis likely did not allow for an observation of changes in FAS that may have occurred on only two cell types, the MEHP-effected spermatocytes and round spermatids. Nevertheless, we were able to demonstrate that TRP53 influenced the stability/retention of the CFLAR (L) protein after MEHP exposure, which was confirmed by the ubiquitinylation studies carried out in our present work with GC-2 cells. Our results from both our in vivo and in vitro studies, when taken together, indicate that TRP53 in germ cells, activated by MEHP-induced Sertoli cell injury, promotes FAS-activated germ cell apoptosis by instigating the degradation of CFLAR (L) protein via its ubiquitinylation. A model indicating the nature of FAS regulation in germ cells is provided in Figure 6 based on the results from both our in vivo [20] and in vitro studies.


Figure 6
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 6. Proposed model to account for TRP53's modulation of the sensitivity of germ cells to undergo FAS-mediated apoptosis. TRP53 may influence the responsiveness of germ cells to FAS-induced apoptosis by either 1) instigating the increased transcription and production of FAS and/or by modulating its intracellular trafficking to the plasma membrane or 2) influencing the ubiquitinylation and resulting stability/turnover of the FAS regulatory protein CFLAR (L)

The differential activation of TRP53 between various germ cell subtypes may explain the sensitivity of primary spermatocytes and round spermatids to MEHP-induced apoptosis as compared with other germ cell subtypes. Future investigations will be aimed at further characterizing the mechanism(s) that account for the sensitivity of these specific cell types to undergo apoptosis. The answer may be related to the cell-type specific expression of CFLAR (L) and its modification in response to FAS activation. The continuous expression of the TRP53 protein in spermatocytes and its ability to influence the stability of CFLAR may be the key to this mechanism, as the half life of TRP53 in most other cells is typically only 30 min [37]. Spermatocytes may therefore be more sensitive to the paracrine activation of FAS by Sertoli cell FASL, due to the ability of the constitutively expressed TRP53 in the spermatocytes to be activated after the withdrawal of physical or hormonal support by Sertoli cells after toxicant-induced injury.

ACKNOWLEDGMENTS

We gratefully recognize the assistance of Deena Walker with the real-time PCR method and Dr. Shawn B. Bratton for his thoughtful insights.

FOOTNOTES

2 Correspondence: John H. Richburg, The University of Texas at Austin, College of Pharmacy, PHR 5.218D, 1 University Station, A1915, Austin, TX 78712-0125. FAX: 512 471 5002; john_richburg{at}mail.utexas.edu Back

1 Supported, in part, by grants from the National Institute of Environmental Health Sciences/NIH (ES09145), NIEHS toxicology training grant (for C.M., T32 ES007247), and NIEHS Center Grant (P30 ES07784). Assistance was provided to Y.C. and Y.Y. by the University of Texas at Austin's Center for Molecular and Cellular Toxicology. Back

Received: 30 June 2005.

First decision: 3 August 2005.

Accepted: 23 November 2005.

REFERENCES

  1. Ashkenazi A, Dixit VM, Apoptosis control by death and decoy receptors. Curr Opin Cell Biol 1999 11:255-260[CrossRef][Medline]
  2. Peter ME, Krammer PH, The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ 2003 10:26-35[CrossRef][Medline]
  3. Medema J, Scaffidi C, Kischkel F, Shevchenko A, Mann M, Krammer P, Peter M, FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). EMBO J 1997 16:2794-2804[CrossRef][Medline]
  4. Hengartner MO, The biochemistry of apoptosis. Nature 2000 407:770-776[CrossRef][Medline]
  5. Liston P, Fong WG, Korneluk RG, The inhibitors of apoptosis: there is more to life than Bcl2. Oncogene 2003 22:8568-8580[CrossRef][Medline]
  6. Krueger A, Schmitz I, Baumann S, Krammer PH, Kirchhoff S, Cellular FLICE-inhibitory protein splice variants inhibit different steps of caspase-8 activation at the CD95 death-inducing signaling complex. J Biol Chem 2001 276:20633-20640[Abstract/Free Full Text]
  7. Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, Bodmer JL, Schroter M, Burns K, Mattmann C, Rimoldi D, French LE, et al Inhibition of death receptor signals by cellular FLIP. Nature 1997 388:190-195[CrossRef][Medline]
  8. Chinnaiyan AM, O'Rourke K, Tewari M, Dixit VM, FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 1995 81:505-512[CrossRef][Medline]
  9. Kischkel FC, Hellbardt S, Behrmann I, Germer M, Pawlita M, Krammer PH, Peter ME, Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. Embo J 1995 14:5579-5588[Medline]
  10. Golks A, Brenner D, Fritsch C, Krammer PH, Lavrik IN, c-FLIPR, a new regulator of death receptor-induced apoptosis. J Biol Chem 2005 280:14507-14513[Abstract/Free Full Text]
  11. Chang DWXZ, Pan Y, Algeciras-Schimnich A, Barnhart BC, Yaish-Ohad S, Peter ME, Yang X, c-FLIPL is a dual function regulator for caspase-8 activation and CD95-mediated apoptosis. EMBO J 2002 21:3704-3714[CrossRef][Medline]
  12. Boatright KM, Deis C, Denault JB, Sutherlin DP, Salvesen GS, Activation of caspases-8 and-10 by FLIP(L). Biochem J 2004 382:651-657[CrossRef][Medline]
  13. Micheau O, Thome M, Schneider P, Holler N, Tschopp J, Nicholson DW, Briand C, Grutter MG, The long form of FLIP is an activator of caspase-8 at the Fas death-inducing signaling complex. J Biol Chem 2002 277:45162-45171[Abstract/Free Full Text]
  14. Sjoberg P, Bondesson U, Gray TGB, Ploen L, Effects of di(2-ethylhexyl) phthalate and five of its metabolites on rat testes in vivo and in vitro. Acta Pharmacol Toxicol 1986 58:225-233[Medline]
  15. Kavlock R, Boekelheide K, Chapin R, Cunningham M, Faustman E, Foster P, Golub M, Henderson R, Hinberg I, Little R, Seed J, Shea K, et al NTP Center for the Evaluation of Risks to Human Reproduction: phthalates expert panel report on the reproductive and developmental toxicity of di(2-ethylhexyl) phthalate. Reprod Toxicol 2002 16:529-653[CrossRef][Medline]
  16. Lee J, Richburg JH, Younkin SC, Boekelheide K, The Fas system is a key regulator of germ cell apoptosis in the testis. Endocrinology 1997 138:2081-2088[Abstract/Free Full Text]
  17. Lee J, Richburg JH, Shipp EB, Meistrich ML, Boekelheide K, The Fas system, a regulator of testicular germ cell apoptosis, is differentially up-regulated in Sertoli cell versus germ cell injury of the testis. Endocrinology 1999 140:852-858[Abstract/Free Full Text]
  18. Richburg JH, Nanez A, Gao H, Participation of the Fas-signaling system in the initiation of germ cell apoptosis in young rat testes after exposure to mono-(2-ethylhexyl) phthalate. Toxicol Appl Pharmacol 1999 160:271-278[CrossRef][Medline]
  19. Giammona CJ, Sawhney P, Chandrasekaran Y, Richburg JH, Death receptor response in rodent testis after mono-(2-ethylhexyl) phthalate exposure. Toxicol Appl Pharmacol 2002 185:119-127[CrossRef][Medline]
  20. Chandrasekaran Y, Richburg JH, The p53 protein influences the sensitivity of testicular germ cells to mono-(2-ethylhexyl) phthalate-induced apoptosis by increasing the membrane levels of Fas and DR5 and decreasing the intracellular amount of c-FLIP. Biol Reprod 2005 72:206-213[Abstract/Free Full Text]
  21. Fukazawa T, Fujiwara T, Uno F, Teraishi F, Kadowaki Y, Itoshima T, Takata Y, Kagawa S, Roth JA, Tschopp J, Tanaka N, Accelerated degradation of cellular FLIP protein through the ubiquitin-proteasome pathway in p53-mediated apoptosis of human cancer cells. Oncogene 2001 20:5225-5231[CrossRef][Medline]
  22. Ciechanover A, Orian A, Schwartz AL, The ubiquitin-mediated proteolytic pathway: mode of action and clinical implications. J Cell Biochem 2000 77:40-51[CrossRef][Medline]
  23. Jan-Michael Peters J, Robin Harris ADF, Ubiquitin and the Biology of the Cell New York Plenum Press 1998
  24. Hofmann M-C, Hess RA, Goldberg E, Millán JL, Immortalized germ cells undergo meiosis in vitro. Proc Natl Acad Sci U S A 1994 91:5533-5537[Abstract/Free Full Text]
  25. Richburg JH, Nanez A, Williams LR, Embree ME, Boekelheide K, Sensitivity of testicular germ cells to toxicant-induced apoptosis in gld mice that express a nonfunctional form of Fas ligand. Endocrinology 2000 141:787-793[Abstract/Free Full Text]
  26. Gray TJB, Gangolli SD, Aspects of the testicular toxicity of phthalate esters. Env Health Persp 1986 65:229-235[Medline]
  27. Van Engeland M, Nieland LJ, Ramaekers FC, Schutte B, Reutelingsperger CP, Annexin V-affinity assay: a review on an apoptosis detection system based on phosphatidylserine exposure. Cytometry 1998 31:1-9[CrossRef][Medline]
  28. Jin Z, McDonald ER, 3rd, Dicker DT, El-Deiry WS, Deficient tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) death receptor transport to the cell surface in human colon cancer cells selected for resistance to TRAIL-induced apoptosis. J Biol Chem 2004 279:35829-35839[Abstract/Free Full Text]
  29. Embree-Ku M, Venturini D, Boekelheide K, Fas is involved in the p53-dependent apoptotic response to ionizing radiation in mouse testis. Biol Reprod 2002 66:1456-1461[Abstract/Free Full Text]
  30. Vera Y, Diaz-Romero M, Rodriguez S, Lue Y, Wang C, Swerdloff RS, Sinha Hikim AP, Mitochondria-dependent pathway is involved in heat-induced male germ cell death: lessons from mutant mice. Biol Reprod 2004 70:1534-1540[Abstract/Free Full Text]
  31. Miyashita T, Reed JC, Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995 80:293-299[CrossRef][Medline]
  32. Villunger A, Michalak EM, Coultas L, Mullauer F, Bock G, Ausserlechner MJ, Adams JM, Strasser A, p53- and drug-induced apoptotic responses mediated by BH3-only proteins puma and noxa. Science 2003 302:1036-1038[Abstract/Free Full Text]
  33. Munsch D, Watanabe-Fukunaga R, Bourdon JC, Nagata S, May E, Yonish-Rouach E, Reisdorf P, Human and mouse Fas(APO-1/CD95) death receptor genes each contain a p53-responsive element that is activated by p53 mutants unable to induce apoptosis. J Biochem 2000 275:3867-3872
  34. Takimoto R, El-Deiry WS, Wild-type p53 transactivates the KILLER/DR5 gene through an intronic sequence-specific DNA-binding site. Oncogene 2000 19:1735-1743[CrossRef][Medline]
  35. Wolkowicz MJ, Coonrod SM, Reddi PP, Millan JL, Hofmann M, Herr JC, Refinement of the differentiated phenotype of the spermatogenic cell line GC-2spd (ts). Biol Reprod 1996 55:923-932[Abstract]
  36. Ogasawara J, Watanabe-Fukunaga R, Adachi M, Matsuzawa A, Kasugai T, Kitamura Y, Itoh N, Suda T, Nagata S, Lethal effect of the anti-Fas antibody in mice. Nature 1993 364:806-809[CrossRef][Medline]
  37. Schwartz D, Goldfinger N, Rotter V, Expression of p53 protein in spermatogenesis is confined to the tetraploid pachytene primary spermatocytes. Oncogene 1993 8:1487-1494[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
M. R. Abedini, E. J. Muller, J. Brun, R. Bergeron, D. A. Gray, and B. K. Tsang
Cisplatin Induces p53-Dependent FLICE-Like Inhibitory Protein Ubiquitination in Ovarian Cancer Cells
Cancer Res., June 15, 2008; 68(12): 4511 - 4517.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
T. M. Onorato, P. W. Brown, and P. L. Morris
Mono-(2-ethylhexyl) Phthalate Increases Spermatocyte Mitochondrial Peroxiredoxin 3 and Cyclooxygenase 2
J Androl, May 1, 2008; 29(3): 293 - 303.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P.-L. Yao, Y.-C. Lin, P. Sawhney, and J. H. Richburg
Transcriptional Regulation of FasL Expression and Participation of sTNF-{alpha} in Response to Sertoli Cell Injury
J. Biol. Chem., February 23, 2007; 282(8): 5420 - 5431.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/3/560    most recent
biolreprod.105.045146v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.
Agricola
Right arrow Articles by Chandrasekaran, Y.
Right arrow Articles by Richburg, J. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS