Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print January 18, 2006.
Biol Reprod 2006, 10.1095/biolreprod.105.048629
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/5/824    most recent
biolreprod.105.048629v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.
Agricola
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.
BIOLOGY OF REPRODUCTION 74, 824–831 (2006)
DOI: 10.1095/biolreprod.105.048629
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Innate Immunity at the Mucosal Surface: Role of Toll-Like Receptor 3 and Toll-Like Receptor 9 in Cervical Epithelial Cell Responses to Microbial Pathogens1

Jorunn M. Andersen , Dina Al-Khairy , and Robin R. Ingalls 2 

Section of Infectious Diseases, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts 02118

ABSTRACT

Toll-like receptors (TLRs) are a family of pattern recognition receptors that recognize distinct molecular patterns shared by a broad range of pathogens, including nucleic acids. TLR9, for example, recognizes unmethylated deoxycytidyl-phosphate-deoxyguanosine (CpG) dinucleotides that are common in bacterial and some viral nucleic acids, whereas TLR3 recognizes double-stranded RNA and TLR7/TLR8 recognize single-stranded RNA, which would be found during viral replication. We were interested in whether TLR3, TLR9, and the related TLR9 family members TLR7/TLR8 might play a role in antiviral immune defense at the mucosal epithelial surface of the lower female reproductive tract. We studied cervical epithelial cells and found that they expressed mRNA for TLR3, TLR9, and TLR7, but had only a weak signal for TLR8. For TLR3 and TLR9, protein expression was confirmed to be intracellular. When epithelial cells were incubated with polyinosine-polycytidylic acid and CpG oligodinucleotides, we observed dose-dependent upregulation of interleukin-8 secretion. However, cells failed to respond to a variety of TLR7/TLR8 ligands. Polyinosine-polycytidylic acid also induced production of interferon-beta and chemokine C-C motif ligand 5, whereas CpG DNA did not. Cell activation by synthetic oligodinucleotides occurred only in response to the B class sequences, and required the presence of human-specific CpG motifs. In addition, responses to CpG oligodinucleotides could be inhibited by chloroquine, demonstrating the requirement for endosomal maturation. These data demonstrate that mucosal epithelial cells express functional TLR3 and TLR9, and suggest that these receptors play a role in regulating the proinflammatory cytokine and antiviral environment of the lower female reproductive tract during infection with viral and bacterial pathogens.

cervix, immunology, signal transduction

INTRODUCTION

The recognition of invading microorganisms is paramount to the survival of the host, and the innate immune system has evolved as the first line of defense in the immune response. At the mucosal surface, where the host physically interacts with a nonsterile environment, the ability to detect and contain invading pathogens is regularly tested. The lower female reproductive tract is one example of a mucosal environment that is rich in commensal flora while at the same time subject to invasion by a variety of viral, bacterial, and parasitic pathogens. The innate immune defenses at this site include the presence of immunologically active soluble mediators, such as complement and antimicrobial peptides, as well as the physical barrier provided by the polarized epithelium itself. In addition, the epithelial cells at the mucosal surface express several members of the Toll-like receptor (TLR) family, receptors that are central to innate immune defenses ([1] and reviewed in [15]).

The human TLR family consists of at least 10 distinct receptors and has been linked to the activation of nuclear factor-kappa B (NFKB) [1, 6], a transcription factor that is involved in the expression of many proinflammatory cytokines, chemokines, costimulatory proteins, and adhesion molecules. The principal ligands that are recognized by the TLRs are conserved molecular patterns shared by a broad range of pathogens. For instance, TLR4 has been identified as the principal signal transducer in the recognition of lipopolysaccharide [68], whereas TLR2 confers responsiveness to bacterial lipoproteins and lipopeptides [912], as well as lipoarabinomannan [13], lipoteichoic acid [14], and bacterial porin [15, 16]. Within the TLR family, TLRs 7, 8, and 9 appear to be "phylogenetic neighbors" [17]. TLR9 recognizes unmethylated deoxycytidyl-phosphate-deoxyguanosine (CpG) dinucleotides that are common in bacterial and some viral nucleic acids [18, 19], and there appear to be some interesting species-specific differences between human and mouse TLR9 in terms of the preferred nucleotide recognition sequence [19]. TLR7 and TLR8 were first shown to sense small antiviral compounds known as imidazoquinolines [20, 21]. These guanosine-based antiviral drugs suggested that the natural ligands for TLR7 and TLR8 would be viral nucleic acids, and recently it was reported that mouse TLR7 and human TLR8 (but not human TLR7) could recognize synthetic GU-rich single-stranded RNA (ssRNA) [22, 23]. TLR3 does not appear to be genetically related to the TLR9 family, but shares the ability to recognize nucleic acids, specifically double-stranded RNA (dsRNA) [24]. The expression pattern of TLR3 and the TLR9 family members (which also include TLR7 and TLR8) differs from that of the other TLR family members in that they are expressed within endosomes, and appear to be targeted there by structural features of their cytoplasmic domains [25, 26].

We were interested in the role TLR3 and TLR9 family members might play in the lower female reproductive tract with regard to the detection of and response to sexually transmitted infections. In this paper we investigate the expression and function of TLR3, TLR9, and TLR7/TLR8 in cervical epithelial cells, specifically examining the ability of these cells to respond to nucleic acid preparations.

MATERIALS AND METHODS

Reagents

PBS and Trypsin-Versene Mixture (trypsin-EDTA) were obtained from Bio-Whittaker. Recombinant human interleukin (IL)1-beta (IL1B), tumor necrosis factor-alpha (TNF), and interferon-gamma (IFNG) were purchased from R&D Systems. Synthetic lipopeptide Pam3-Cys-Lip was purchased from EMC Microcollections. The structure of this triacylated lipopeptides is based on the structure of the gonococcal lipoprotein H.8/Lip, and has been described elsewhere [27]. Oligodinucleotides (ODNs) were purchased from Coley Pharmaceutical Group. The ODN sequences were as follows (shown 5' to 3'; small letters represent a phosphorothioate linkage 3' of the base, capital letters represent phosphodiester linkage 3' of the base, and bold letters are the CpG dinucleotides): ODN 2006 (class B, human), tcgtcgttttgtcgttttgtcgtt; ODN 2336 (class A, human), gggGACGACGTCGTGgggggg; and 1826 (class B, mouse), tccatcacgttcctgacgtt. ODN 2006 with a fluorescein dye modification at the 3' end was purchased from MWG. Polyinosine-polycytidylic acid (poly[I:C]) was purchased from Amersham Biosciences. R-848 was purchased from GL Synthesis, single-stranded (ss) PolyU and ssRNA40 from Invivogen. Chloroquine was purchased from Sigma.

Cell Culture

The human papillomavirus 16/E6E7 immortalized endocervical (End1/E6E7), ectocervical (Ect1/E6E7), and vaginal (Vk2/E6E7) epithelial cell lines were a gift from Dr. Raina Fichorova (Brigham and Women's Hospital, Harvard Medical School, Boston, MA) and are described elsewhere [28]. Primary ectocervical epithelial cells (CrEC) derived from tissue donated by a 43-yr-old woman were purchased from Cambrex Bioproducts. Because no identifiable information is available for this sample, it is not considered human subjects research. Cervical epithelial cells were grown in keratinocyte serum-free medium (KSFM; Life Technologies) supplemented with the provided 50 µg/ml bovine pituitary extract, 0.1 ng/ml recombinant epidermal growth factor, and 0.4 mM CaCl2 (KSFM growth medium). Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2.

Isolation of Peripheral Blood Mononuclear Cells

Whole blood was obtained from a healthy volunteer using aseptic technique into a heparinized syringe (50 U heparin/ml blood). Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized blood using Lymphoprep (Axis-Shield) according to the manufacturer's instructions. Cells were washed three times with PBS, resuspended in RPMI 1640 (Gibco/Invitrogen) supplemented with 10% FBS (Hyclone), and used immediately. All blood draws were collected following informed consent from the donor, with approval from the Institutional Review Board.

RT-PCR Analysis

Total RNA was isolated from cells using the RNeasy kit (Qiagen). Contaminating DNA was removed by treating cells with DNA-free DNase (Ambion). RT and PCR reactions were performed in one step using the One-Step RT-PCR (Invitrogen). The PCR reactions were carried out for 35 cycles at an annealing temperature of 55°C in a Perkin Elmer Gene Amp 2400 PCR machine (Perkin Elmer Analytical Instruments). Primer pairs for TLRs 1–10 are listed in Table I. Interferon-beta (IFNB) PCR was carried out using the Dual-Quantitative RT-PCR Kit according to the manufacturer's instructions (Maxim Biotech).

Antibody Staining and Flow Cytometry

Purified and fluorochrome-conjugated monoclonal antibodies against human TLR3 and TLR9, along with their isotype controls, were purchased from eBioscience. For flow cytometric analysis of protein expression, cells growing in tissue culture were harvested with Trypsin-Versene, and incubated for 30 min on ice with phycoerythrin-conjugated anti-TLR3 or anti-TLR9 antibody, or control IgG, at a concentration of 20 µg/ml diluted in PBS with 1% FBS. For intracellular staining, cells were first treated with Fixation Buffer (4% paraformaldehyde) followed by Permeabilization Buffer (0.1% saponin), according to the manufacturer's protocol (eBioscience). Antibody was diluted in the Permeabilization Buffer with PBS/1% FBS (50:50). After labeling, the cells were washed, resuspended in PBS/1% FBS, and analyzed by flow cytometry using a fluorescence activated cell sorter (FACScan) microfluorimeter (Becton Dickinson). A total of 10000 events were counted for each condition.

Assays for Chemokine Secretion

Cells were plated in 96-well tissue culture dishes at a density of 5 x 104/well. PBMCs were used immediately, whereas epithelial cells were allowed to rest for 24 h before stimulation. Cells were treated with various stimuli in a reaction volume of 100 µl. After overnight incubation at 37°C, the culture supernatants were removed and assayed for interleukin 8 (IL8) and chemokine C-C motif ligand 5 (CCL5; also known as RANTES) using a DuoSet ELISA kit from R&D Systems. Optical density was measured using a Bio-Kinetics microplate reader (Bio-Tek Instruments). All data points were assayed in triplicate, and reported as the mean ± SD. Significance (P value) was calculated using an unpaired t-test.

RESULTS

Cervical Epithelial Cells Express TLR3 and TLR9

We previously reported that immortalized epithelial cells from the lower female reproductive tract express mRNA for TLR1, TLR2, TLR3, TLR5, and TLR6, but lack mRNA expression of TLR4 and the associated molecule MD2 (also known as LY96) [29]. We confirmed these results and further tested for the remaining TLRs by RT-PCR. As shown in Figure 1, we found that the immortalized endocervical epithelial cell line, End1/E6E7, expressed mRNA for all 10 human TLRs, with the exception of TLR4 and possibly TLR8, which gave only a weak signal. Similar results were found in the ectocervical and vaginal cell lines (data not shown).


Figure 1
View larger version (41K):
[in this window]
[in a new window]
 
FIG. 1. Expression of TLRs in cervical epithelial cells. RNA was prepared from End1/E6E7 and assayed by RT-PCR for expression of TLRs 1–10 as described in the text and in Table 1. Similar results were found for Ect1/E6E7 and Vk2/E6E7 (data not shown).

To confirm the PCR result demonstrating expression of TLR3 and TLR9 messenger RNA, we examined the cells for expression of protein using available monoclonal antibodies. Both TLR3 and TLR9 are reported to be localized intracellularly, within endosomes [25, 26, 30]. We initially looked for surface expression of TLR3 and TLR9 by staining live cells and analyzing fluorescence using flow cytometry. As shown in Figure 2, we found little or no surface expression of either TLR3 (Fig. 2a) or TLR9 (Fig. 2b) by this method. Staining was repeated using cells that had been subjected to fixation and permeabilization as described in Materials and Methods. In this case, we found a significant shift in the cell fluorescence with both the TLR3- and TLR9-specific antibodies, demonstrating that TLR3 and TLR9 expression is primarily intracellular in cervical epithelium. To prove that TLR3 and TLR9 expression was specific for cervical epithelium and not a consequence of the HPV/E6E7 immortalization process, we confirmed the FACS data using primary ectocervical epithelial cells.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2. Cervical epithelial cells express intracellular TLR3 and TLR9. Shown above are FACS histograms for TLR3 (a) and TLR9 (b) in End1/E6E7, Ect1/E6E7, and CrEC cervical epithelial cells. Cells were stained with antibody to TLR3 or TLR9 as described in the text. For both a and b, the column on the left represents live cells, whereas the column on the right represents fixed and permeabilized cells. In each case, the specific antibody staining (thick black line) is compared to control mouse IgG (gray filled histogram). The vertical axis represents the relative cell number, and the horizontal axis represents the intensity of fluorescence staining for the antibody. These histograms are representative of at least three separate experiments.

Cervical Epithelial Cells Respond to TLR3 and TLR9 Ligands but Not TLR7/TLR8 Ligands

To examine the function of TLR3, TLR9, and the TLR9 family members TLR7 and TLR8 in cervical epithelial cells, we tested the ability of various nucleic acid preparations to upregulate the secretion of IL8. Cells were stimulated with CpG ODN 2006, poly[I:C], and R-848, which have been described as ligands for TLR9, TLR3, and TLR7/TLR8, respectively. As a control, we used the TLR2 ligand Pam3-Cys-Lip, which we have previously reported to be a potent activator of this cell line [27, 29]. As shown in Figure 3a, we found dose-dependent upregulation of IL8 secretion over baseline in response to both poly[I:C] and CpG, as well as the control lipopeptide Pam3Cys-Lip. In contrast, the cells failed to respond to R-848 at the doses tested, although PBMCs stimulated in parallel were strongly activated (data not shown). We further tested the ability of the End1/E6E7 cell line to respond to TLR7/TLR8 ligands by examining a broader dose range of R-848 (1–10 µg/ml) as well as the single stranded RNA preparations ssPolyU and ssRNA40 (1–7.5 µg/ml). However, these ligands, at these doses, also failed to activate the cells to secrete IL8 (data not shown).


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Cervical epithelial cells secrete IL8 in response to TLR3 and TLR9 ligands. Cells were plated in 96-well dishes and stimulated overnight with the indicated ligands, as described in the text. Supernatant was then collected and assayed for IL8 by ELISA. a) End1/E6E7 cells were stimulated with CpG ODN 2006 at 5 or 10 µM; poly[I:C] at 25 or 100 µg/ml; R848 at 100 or 200 ng/ml; or Pam3-Cys-Lip at 50 ng/ml. b) CrEC cells were stimulated with CpG ODN 2006 at 10 or 50 µg/ml; poly[I:C] at 25 or 50 µg/ml; R848 at 50 or 100 ng/ml; or TNF-{alpha} at 50 ng/ml. Data are reported as the mean ± SD of triplicate wells. Shown above are representatives of at least three independent experiments. Significance is as follows: *P = 0.001; **P = 0.0001 (stimulated vs. unstimulated).

To show that the response to nucleic acids was not an artifact of the HPV/E6E7 immortalization process, primary cervical epithelial cells were tested for their responsiveness to the TLR3, TLR9, and TLR7/8 ligands. As we found for the cell line, the primary cells responded to the CpG ODNs and the poly[I:C] with an increase in IL8 secretion over baseline, whereas they remained unresponsive to the R-848 (Fig. 3b). It is interesting to note that, in comparison to the immortalized cell line, the primary cells had a much higher basal secretion of IL8 while maintaining a 5- to 10-fold increase in cytokine production in response to the stimuli tested.

Finally, we wanted to examine the induction of IFN-related signals in response to the nucleic acid preparations. First we examined the upregulation of IFNB in the End1/E6E7 cell line by RT-PCR. As shown in Figure 4, poly[I:C] upregulated IFNB whereas CpG did not. In addition, we examined upregulation of the chemokine CCL5 in response to these TLR ligands. Although the immortalized epithelial cells failed to secrete CCL5 in response to any stimuli, the primary cells did secrete CCL5 in response to poly[I:C] but not CpG (Fig. 5).


Figure 4
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 4. End1/E6E7 cells upregulate IFNB in response to poly[I:C] but not CpG. Cells were plated in 6-well dishes and stimulated with CpG ODN 2006 at 50 µg/ml or poly[I:C] at 25 µg/ml. After 5 h of incubation, total RNA was extracted from the cells, and cDNA was prepared and subjected to dual PCR for IFNB and the housekeeping gene glyceraldehyde phosphate dehydrogenase (GAPDH), as described in the text. The upper band represents GAPDH (563 bp), and the lower band represents IFNB (347 bp). U represents unstimulated cells, and G and I represent the GAPDH and IFNB controls, respectively, that were provided by the manufacturer. Shown above is a representative of two independent experiments.


Figure 5
View larger version (8K):
[in this window]
[in a new window]
 
FIG. 5. CrEC cells secrete CCL5 in response to poly[I:C] but not CpG. Cells were plated in 96-well dishes and stimulated overnight with CpG ODN 2006 at 50 µg/ml, poly[I:C] at 25 µg/ml, or TNF at 50 ng/ml. Supernatant was then collected and assayed for CCL5 by ELISA. Data are reported as the mean ± SD of triplicate wells. Shown above is a representative of two independent experiments. Significance is as follows: *P = 0.003; **P = 0.0001 (stimulated vs. unstimulated).

Cervical Epithelial Cells Respond to B Class but Not A Class CpG ODN

Based on the structure and the types of immune responses induced, ODNs can be classified as type A (also known as type D) or type B (also known as type K). Type A ODNs have chimeric backbones with a core phosphodiester (PO) link between the CpG, which is flanked by phosphorothioate-linked sequences. These ODNs are very potent inducers of IFNA from plasmacytoid dendritic cells and IFNG from NK cells, but have little or no effect on B cells. Type B ODNs have a complete PO backbone, and have a variety of B cell effects, including proliferation, IL6 secretion, and upregulation of activation markers, but they have no effect on IFNA and IFNG (reviewed in [31]).

To further examine the responses of cervical epithelial cells to the nucleic acid preparations, we compared the activity of the A class and B class ODNs. Cells were stimulated with CpG ODN 2006 (a B class ODN) or 2336 (an A class ODN), and assayed for the upregulation of IL8 secretion. As shown in Figure 6, cells responded only to ODN 2006, the B class ODN. One interesting aspect of TLR9 signaling is that there appear to be some interesting species-specific differences between human TLR9 and mouse TLR9 in terms of the preferred nucleotide recognition sequence [19]. We tested the species specificity of the response in our epithelial cells by stimulating with ODN 1826, a mouse-specific B class ODN, and found that cells were not significantly activated by the mouse sequence in comparison to the human-specific sequence.


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6. End1/E6E7 cells are activated by human-specific class B ODNs. Cells were plated in 96-well dishes and stimulated overnight with 10 or 50 µg/ml of CpG ODN 2006 (class B, human), 1826 (class B, mouse), 2336 (class A, human), or TNF at 50 ng/ml. Supernatant was then collected and assayed for IL8 by ELISA. Data are reported as the mean ± SD of triplicate wells. Shown above is a representative of two independent experiments. Significance is as follows: {dagger}P = 0.02; *P = 0.001; **P = 0.0001 (stimulated vs. unstimulated).

TLR9-Mediated Responses in Cervical Epithelium Require Endosomal Acidification

TLR9-dependent responses to CpG ODN and bacterial DNA can be blocked by inhibitors of endosomal acidification or maturation, such as bafilomycin A and chloroquine [3234], a feature that distinguishes TLR9 signaling from that of other TLRs. To further evaluate the role of TLR9 in mediating the response of cervical epithelial cells to oligodinucleotides, we examined the effect of chloroquine on the ability of CpG ODN 2006 to induce IL8 secretion. As expected, we found a marked reduction in IL8 production in the presence of chloroquine (Fig. 7), thus supporting the role of TLR9 in activation of cervical epithelium by DNA.


Figure 7
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 7. CpG induced activation of End1/E6E7 cells is blocked by chloroquine. Cells were plated in 96-well dishes in the presence or absence of 10 µM chloroquine, and stimulated overnight with 10 or 50 µg/ml of CpG ODN 2006, or with TNF at 50 ng/ml. Supernatant was then collected and assayed for IL8 by ELISA. Data are reported as the mean ± SD of triplicate wells. Shown above is a representative of two independent experiments. Significance is as follows: *P = 0.001 (chloroquine treatment vs. no chloroquine treatment).

DISCUSSION

The mucosal surface of the genitourinary tract provides the first line of defense against sexually transmitted pathogens, and the expression of innate immune receptors at this site dictates the ability of epithelial cells to respond to specific microbial ligands. Although considerable effort has been aimed at understanding TLR responses in professional immune cells, the role of various TLR-related molecules at mucosal surfaces remains poorly understood. In the case of TLR3 and TLR9, the expression and function has been most extensively studied in antigen-presenting cells, such as dendritic cells. The expression of TLR3 and TLR9 has been reported in a variety of mucosal epithelial cell lines of gastric and respiratory origin [3538], although a true role for these receptors in host-pathogen interactions at the mucosal surface remains to be proven. In addition, there have been a number of recent reports examining TLR3 and TLR9 in human uterine epithelium [3942].

Ours is the first account of the expression and function of TLR3 and TLR9 in cervical epithelium. We found that endocervical, ectocervical, and vaginal epithelial cells express messenger RNA for TLR3 and TLR9, and that protein expression is almost exclusively intracellular. Protein function was established using synthetic ligands specific for TLR3 and TLR9. It should be noted that TLR3-independent signaling by double-stranded RNA can occur via the dsRNA-dependent protein kinase (PKR) [43, 44] and the retinoic acid inducible gene 1 (RIG1) [45, 46]. However, published data would suggest that in order for poly[I:C] to activate these intracellular receptors, it must be delivered intracellularly using lipid transfection agents or electroporation [45, 47]. Because we did not undertake such manipulations with the poly[I:C], we feel that the contribution of these other receptors is likely to be minor, although we cannot say with certainty that they did not contribute to the overall response. Thus, the role of PKR and RIG1 in the mucosal epithelial response to double-stranded RNA and poly[I:C] remains to be seen.

Given that our immortalized cell line stably expresses the HPV E6 and E7 proteins, we felt it was important to verify that the TLR3 and TLR9 expression and signaling were, in fact, not an unanticipated consequence of the immortalization process. For example, the E6 protein has been shown to bind IRF3 and inhibit its transactivation function [48]. Thus, one might anticipate some abnormalities in interferon signaling in cells that overexpress E6. However, the confirmation of our findings in terms of gene expression and function in the primary cervical epithelial cells suggests that TLR3 and TLR9 signaling events are intrinsic to this particular tissue and cell type.

Signaling by nucleic acids has been studied in other in vitro systems, but our data reveal some unique features of signaling in cervical epithelium that are noteworthy, and contrast our system with that which has been described in dendritic cells and other professional immune cells. For example, there have been reports that TLR9-mediated responses in dendritic cells induce type 1 interferons [49, 50]. However, although TLR9 activation induced the secretion of the proinflammatory cytokine IL8, we found that the primary cervical epithelial cells did not upregulate IFNB or CCL5, which could be induced by poly[I:C]. Transcriptional regulation of IL8 is primarily dependent on NFKB [51], whereas IFNB is dependent on IRF3 [52] and CCL5 is regulated by both [53]. The link between TLR9 signaling and type I IFN production was recently reported to be via IRF7 [54] and IRF8 [55], which are expressed primarily in lymphoid [56, 57] and myeloid cells [58], respectively. Thus, this lack of TLR9-dependent activation of the IRF signaling pathway might simply reflect an innate difference in the IRFs available in epithelial cells vs. myeloid cells. In addition, it was recently reported that the differential induction of type I IFNs by the type A vs. type B ODNs might be explained by CpG trafficking, a phenomenon that could be overcome by treating the cells with a cationic lipid to enhance endosomal retention [59]. We have yet to explore the subcellular trafficking of DNA in these cells.

Another unique finding in our model stems from the lack of TLR7/TLR8 activity in cervical epithelium. Although it is difficult to confirm protein expression because of the limited antibodies available for these receptors, the identification of a strong PCR product for TLR7 in End/E6E7 cDNA suggests that at least TLR7 is present in the reproductive tract; for TLR8, the weak signal might represent absent or simply inadequate protein expression. However, we failed to observe cell activation by any of the known ligands for TLR7 or TLR8. One possibility is that the cells are simply unable to internalize or properly traffic the TLR7/TLR8 ligands to the proper subcellular location, thus making them inaccessible to the receptor. Although we have not looked specifically at these ligands, we do know the cells will readily take up fluorescently labeled DNA and double-stranded RNA (data not shown). An alternate explanation would be that, in the absence of sufficient TLR8 expression, both TLR7 and TLR8 activity is blunted. It is also possible that TLR7/TLR8-specific adaptor proteins or transcription factors are absent. The molecular basis of this unresponsiveness remains to be determined. It is noteworthy that the imidazoquinolines imiquimod and resiquimod (R848), which are ligands for TLR7/TLR8, are marketed as antiviral and antitumor agents for genital tract infections with agents such as human papilloma virus and herpes simplex virus. Their antiviral effects in terms of type I interferon production are likely to be indirect, via TLR7/TLR8 activation. These data would further suggest that their effect is not on the infected epithelial cells per se, but more likely on the dendritic cells and other professional immune cells that would be found in the subepithelial space of the lower reproductive tract.

The presence of functional TLR3 and TLR9 at mucosal epithelial surfaces supports a role for these receptors in epithelial cell responses to intracellular pathogens. Many viruses that infect cervical epithelial cells either contain dsRNA or express dsRNA during part of the viral life cycle, which could lead to activation of TLR3. Likewise, TLR9 not only would be expected to encounter immunostimulatory DNA that is released during bacterial infections, but also is likely to play a role during genital epithelial infection with viral pathogens, such as herpes simplex virus, which has been reported to contain methylated CpG motifs [50, 60, 61]. These findings suggest that epithelial cell-derived TLR3 and TLR9 are capable of regulating the proinflammatory cytokine and, in the case of TLR3, the antiviral environment of the lower female reproductive tract. The role that these two receptors would play in vivo during a viral or bacterial infection has yet to be adequately investigated. Two groups have reported that activation of TLR9 or TLR3, but not TLR4, in the mouse vagina protects against genital tract infection with herpes simplex virus [60, 62, 63], suggesting that local delivery of these nucleic acid preparations is activating a protective antiviral response that could be used to protect against sexually transmitted infections. In addition, there are data to suggest that TLR9 activation can enhance the effectiveness of mucosal immunization with viral protein antigens in the genital tract [64]. Perhaps by harnessing the activity of TLR3 and TLR9, one might be able to design better vaccine candidates to improve mucosal immunity either during natural infection or in response to vaccines.

Finally, the role of TLR3 and TLR9 in maintaining the health of the lower female genital tract in the absence of infection remains unclear, as does their hormonal regulation during various stages of the reproductive cycle. Future studies on the role of TLR3 and TLR9, along with the other epithelial-specific TLRs, will need to address the regulation of these receptors in both health and disease as it applies to women's health issues and sexually transmitted infections.


View this table:
[in this window]
[in a new window]
 
TABLE 1. PCR primer pairs for amplification of human mRNA.

FOOTNOTES

1 Supported by grants from the National Institutes of Health AI-46613 and AI-064749 to R.R.I. Back

2 Correspondence: Robin R. Ingalls, Evans Biomedical Research Center, 650 Albany St., Boston, MA 02118. FAX: 617 414 5280; ringalls{at}bu.edu Back

Received: 14 October 2005.

First decision: 3 December 2005.

Accepted: 16 January 2006.

REFERENCES

  1. Medzhitov R, Preston-Hurlburt P, Janeway CA, Jr, A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 1997 388:394-397[CrossRef][Medline]
  2. Medzhitov R, Janeway CA, Jr, Innate immunity: the virtues of a nonclonal system of recognition. Cell 1997 91:295-298[CrossRef][Medline]
  3. Janeway CA, Jr, Medzhitov R, Innate immune recognition. Annu Rev Immunol 2002 20:197-216[CrossRef][Medline]
  4. Kimbrell DA, Beutler B, The evolution and genetics of innate immunity. Nat Rev Genet 2001 2:256-267[CrossRef][Medline]
  5. Lien E, Ingalls RR, Toll-like receptors. Crit Care Med 2002 30:S111
  6. Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F, Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem 1999 274:10689-10692[Abstract/Free Full Text]
  7. Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, Takeda K, Akira S, Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol 1999 162:3749-3752[Abstract/Free Full Text]
  8. Poltorak A, He X, Smirnova I, Liu M-Y, Van Huffel C, Du X, Birdwell D, Alejos A, Silva M, Galanos C, Freudenberg M, Ricciardi-Castagnoli P, et al Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 1998 282:2085-2088[Abstract/Free Full Text]
  9. Aliprantis AO, Yang RB, Mark MR, Suggett S, Devaux B, Radolf JD, Klimpel GR, Godowski P, Zychlinsky A, Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 1999 285:736-739[Abstract/Free Full Text]
  10. Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, Bleharski JR, Maitland M, Norgard MV, Plevy SE, Smale ST, Brennan PJ, Bloom BR, et al Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science 1999 285:732-736[Abstract/Free Full Text]
  11. Hirschfeld M, Kirschning CJ, Schwandner R, Wesche H, Weis JH, Wooten RM, Weis JJ, Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by toll-like receptor 2. J Immunol 1999 163:2382-2386[Abstract/Free Full Text]
  12. Heine H, Kirschning CJ, Lien E, Monks BG, Rothe M, Golenbock DT, Cutting edge: cells that carry A null allele for toll-like receptor 2 are capable of responding to endotoxin. J Immunol 1999 162:6971-6975[Abstract/Free Full Text]
  13. Means TK, Lien E, Yoshimura A, Wang S, Golenbock DT, Fenton MJ, The CD14 ligands lipoarabinomannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J Immunol 1999 163:6748-6755[Abstract/Free Full Text]
  14. Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ, Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem 1999 274:17406-17409[Abstract/Free Full Text]
  15. Massari P, Henneke P, Ho Y, Latz E, Golenbock DT, Wetzler LM, Cutting edge: immune stimulation by neisserial porins is toll-like receptor 2 and MyD88 dependent. J Immunol 2002 168:1533-1537[Abstract/Free Full Text]
  16. Galdiero M, Finamore E, Rossano F, Gambuzza M, Catania MR, Teti G, Midiri A, Mancuso G, Haemophilus influenzae porin induces Toll-like receptor 2-mediated cytokine production in human monocytes and mouse macrophages. Infect Immun 2004 72:1204-1209[Abstract/Free Full Text]
  17. Du X, Poltorak A, Wei Y, Beutler B, Three novel mammalian toll-like receptors: gene structure, expression, and evolution. Eur Cytokine Netw 2000 11:362-371[Medline]
  18. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S, A Toll-like receptor recognizes bacterial DNA. Nature 2000 408:740-745[CrossRef][Medline]
  19. Bauer S, Kirschning CJ, Hacker H, Redecke V, Hausmann S, Akira S, Wagner H, Lipford GB, Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc Natl Acad Sci U S A 2001 98:9237-9242[Abstract/Free Full Text]
  20. Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, Horiuchi T, Tomizawa H, Takeda K, Akira S, Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol 2002 3:196-200[CrossRef][Medline]
  21. Jurk M, Heil F, Vollmer J, Schetter C, Krieg AM, Wagner H, Lipford G, Bauer S, Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848. Nat Immunol 2002 3:499[CrossRef][Medline]
  22. Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C, Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 2004 303:1529-1531[Abstract/Free Full Text]
  23. Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW, Iwasaki A, Flavell RA, Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A 2004 101:5598-5603[Abstract/Free Full Text]
  24. Alexopoulou L, Holt AC, Medzhitov R, Flavell RA, Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 2001 413:732-738[CrossRef][Medline]
  25. Nishiya T, DeFranco AL, Ligand-regulated chimeric receptor approach reveals distinctive subcellular localization and signaling properties of the Toll-like receptors. J Biol Chem 2004 279:19008-19017[Abstract/Free Full Text]
  26. Latz E, Schoenemeyer A, Visintin A, Fitzgerald KA, Monks BG, Knetter CF, Lien E, Nilsen NJ, Espevik T, Golenbock DT, TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat Immunol 2004 5:190-198[CrossRef][Medline]
  27. Fisette PL, Ram S, Andersen JM, Guo W, Ingalls RR, The Lip lipoprotein from Neisseria gonorrhoeae stimulates cytokine release and NF-kB activation in epithelial cells in a TLR2-dependent manner. J Biol Chem 2003 278:46252-46260[Abstract/Free Full Text]
  28. Fichorova RN, Rheinwald JG, Anderson DJ, Generation of papillomavirus-immortalized cell lines from normal human ectocervical, endocervical, and vaginal epithelium that maintain expression of tissue-specific differentiation proteins. Biol Reprod 1997 57:847-855[Abstract]
  29. Fichorova RN, Cronin AO, Lien E, Anderson DJ, Ingalls RR, Response to Neisseria gonorrhoeae by cervicovaginal epithelial cells occurs in the absence of Toll-like receptor 4-mediated signaling. J Immunol 2002 168:2424-2432[Abstract/Free Full Text]
  30. Heil F, Ahmad-Nejad P, Hemmi H, Hochrein H, Ampenberger F, Gellert T, Dietrich H, Lipford G, Takeda K, Akira S, Wagner H, Bauer S, The Toll-like receptor 7 (TLR7)-specific stimulus loxoribine uncovers a strong relationship within the TLR7, 8 and 9 subfamily. Eur J Immunol 2003 33:2987-2997[CrossRef][Medline]
  31. Klinman DM, Takeshita F, Gursel I, Leifer C, Ishii KJ, Verthelyi D, Gursel M, CpG DNA: recognition by and activation of monocytes. Microbes Infect 2002 4:897-901[CrossRef][Medline]
  32. Yi AK, Tuetken R, Redford T, Waldschmidt M, Kirsch J, Krieg AM, CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J Immunol 1998 160:4755-4761[Abstract/Free Full Text]
  33. Hacker H, Mischak H, Miethke T, Liptay S, Schmid R, Sparwasser T, Heeg K, Lipford GB, Wagner H, CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. EMBO J 1998 17:6230-6240[CrossRef][Medline]
  34. Macfarlane DE, Manzel L, Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds. J Immunol 1998 160:1122-1131[Abstract/Free Full Text]
  35. Cario E, Podolsky DK, Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun 2000 68:7010-7017[Abstract/Free Full Text]
  36. Schmausser B, Andrulis M, Endrich S, Lee SK, Josenhans C, Muller-Hermelink HK, Eck M, Expression and subcellular distribution of toll-like receptors TLR4, TLR5 and TLR9 on the gastric epithelium in Helicobacter pylori infection. Clin Exp Immunol 2004 136:521-526[CrossRef][Medline]
  37. Platz J, Beisswenger C, Dalpke A, Koczulla R, Pinkenburg O, Vogelmeier C, Bals R, Microbial DNA induces a host defense reaction of human respiratory epithelial cells. J Immunol 2004 173:1219-1223[Abstract/Free Full Text]
  38. Furrie E, Macfarlane S, Thomson G, Macfarlane GT, Toll-like receptors-2, -3 and -4 expression patterns on human colon and their regulation by mucosal-associated bacteria. Immunology 2005 115:565-574[CrossRef][Medline]
  39. Jorgenson RL, Young SL, Lesmeister MJ, Lyddon TD, Misfeldt ML, Human endometrial epithelial cells cyclically express Toll-like receptor 3 (TLR3) and exhibit TLR3-dependent responses to dsRNA. Hum Immunol 2005 66:469-482[CrossRef][Medline]
  40. Young SL, Lyddon TD, Jorgenson RL, Misfeldt ML, Expression of Toll-like receptors in human endometrial epithelial cells and cell lines. Am J Reprod Immunol 2004 52:67-73[Medline]
  41. Schaefer TM, Desouza K, Fahey JV, Beagley KW, Wira CR, Toll-like receptor (TLR) expression and TLR-mediated cytokine/chemokine production by human uterine epithelial cells. Immunology 2004 112:428-436[CrossRef][Medline]
  42. Schaefer TM, Fahey JV, Wright JA, Wira CR, Innate immunity in the human female reproductive tract: antiviral response of uterine epithelial cells to the TLR3 agonist poly(I:C). J Immunol 2005 174:992-1002[Abstract/Free Full Text]
  43. Silva AM, Whitmore M, Xu Z, Jiang Z, Li X, Williams BR, Protein kinase R (PKR) interacts with and activates mitogen-activated protein kinase kinase 6 (MKK6) in response to double-stranded RNA stimulation. J Biol Chem 2004 279:37670-37676[Abstract/Free Full Text]
  44. Jiang Z, Zamanian-Daryoush M, Nie H, Silva AM, Williams BR, Li X, Poly(I-C)-induced Toll-like receptor 3 (TLR3)-mediated activation of NFkappa B and MAP kinase is through an interleukin-1 receptor-associated kinase (IRAK)-independent pathway employing the signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J Biol Chem 2003 278:16713-16719[Abstract/Free Full Text]
  45. Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, Taira K, Akira S, Fujita T, The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 2004 5:730-737[CrossRef][Medline]
  46. Kato H, Sato S, Yoneyama M, Yamamoto M, Uematsu S, Matsui K, Tsujimura T, Takeda K, Fujita T, Takeuchi O, Akira S, Cell type-specific involvement of RIG-I in antiviral response. Immunity 2005 23:19-28[CrossRef][Medline]
  47. Diebold SS, Montoya M, Unger H, Alexopoulou L, Roy P, Haswell LE, Al-Shamkhani A, Flavell R, Borrow P, Reis e Sousa C, Viral infection switches non-plasmacytoid dendritic cells into high interferon producers. Nature 2003 424:324-328[CrossRef][Medline]
  48. Ronco LV, Karpova AY, Vidal M, Howley PM, Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev 1998 12:2061-2072[Abstract/Free Full Text]
  49. Kadowaki N, Ho S, Antonenko S, de Waal Malefyt R, Kastelein RA, Bazan F, Liu YJ, Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med 2001 194:863-870[Abstract/Free Full Text]
  50. Lund J, Sato A, Akira S, Medzhitov R, Iwasaki A, Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. J Exp Med 2003 198:513-520[Abstract/Free Full Text]
  51. Genin P, Algarte M, Roof P, Lin R, Hiscott J, Regulation of RANTES chemokine gene expression requires cooperativity between NF-kappa B and IFN-regulatory factor transcription factors. J Immunol 2000 164:5352-5361[Abstract/Free Full Text]
  52. Juang YT, Lowther W, Kellum M, Au WC, Lin R, Hiscott J, Pitha PM, Primary activation of interferon A and interferon B gene transcription by interferon regulatory factor 3. Proc Natl Acad Sci U S A 1998 95:9837-9842[Abstract/Free Full Text]
  53. Lin R, Heylbroeck C, Genin P, Pitha PM, Hiscott J, Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol Cell Biol 1999 19:959-966[Abstract/Free Full Text]
  54. Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N, Taniguchi T, IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005 434:772-777[CrossRef][Medline]
  55. Tsujimura H, Tamura T, Kong HJ, Nishiyama A, Ishii KJ, Klinman DM, Ozato K, Toll-like receptor 9 signaling activates NF-kappaB through IFN regulatory factor-8/IFN consensus sequence binding protein in dendritic cells. J Immunol 2004 172:6820-6827[Abstract/Free Full Text]
  56. Au WC, Moore PA, LaFleur DW, Tombal B, Pitha PM, Characterization of the interferon regulatory factor-7 and its potential role in the transcription activation of interferon A genes. J Biol Chem 1998 273:29210-29217[Abstract/Free Full Text]
  57. Yeow WS, Au WC, Juang YT, Fields CD, Dent CL, Gewert DR, Pitha PM, Reconstitution of virus-mediated expression of interferon alpha genes in human fibroblast cells by ectopic interferon regulatory factor-7. J Biol Chem 2000 275:6313-6320[Abstract/Free Full Text]
  58. Tamura T, Ozato K, ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. J Interferon Cytokine Res 2002 22:145-152[CrossRef][Medline]
  59. Honda K, Ohba Y, Yanai H, Negishi H, Mizutani T, Takaoka A, Taya C, Taniguchi T, Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 2005 434:1035-1040[CrossRef][Medline]
  60. Ashkar AA, Bauer S, Mitchell WJ, Vieira J, Rosenthal KL, Local delivery of CpG oligodeoxynucleotides induces rapid changes in the genital mucosa and inhibits replication, but not entry, of herpes simplex virus type 2. J Virol 2003 77:8948-8956[Abstract/Free Full Text]
  61. Karlin S, Doerfler W, Cardon LR, Why is CpG suppressed in the genomes of virtually all small eukaryotic viruses but not in those of large eukaryotic viruses?. J Virol 1994 68:2889-2897[Abstract/Free Full Text]
  62. Pyles RB, Higgins D, Chalk C, Zalar A, Eiden J, Brown C, Van Nest G, Stanberry LR, Use of immunostimulatory sequence-containing oligonucleotides as topical therapy for genital herpes simplex virus type 2 infection. J Virol 2002 76:11387-11396[Abstract/Free Full Text]
  63. Ashkar AA, Yao XD, Gill N, Sajic D, Patrick AJ, Rosenthal KL, Toll-like receptor (TLR)-3, but not TLR4, agonist protects against genital herpes infection in the absence of inflammation seen with CpG DNA. J Infect Dis 2004 190:1841-1849[CrossRef][Medline]
  64. Kwant A, Rosenthal KL, Intravaginal immunization with viral subunit protein plus CpG oligodeoxynucleotides induces protective immunity against HSV-2. Vaccine 2004 22:3098-3104[CrossRef][Medline]



This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
R. T. Trifonova, G. F. Doncel, and R. N. Fichorova
Polyanionic Microbicides Modify Toll-Like Receptor-Mediated Cervicovaginal Immune Responses
Antimicrob. Agents Chemother., April 1, 2009; 53(4): 1490 - 1500.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
S. Bertin, M. Samson, C. Pons, J.-M. Guigonis, A. Gavelli, P. Baque, N. Brossette, S. Pagnotta, J.-E. Ricci, and V. Pierrefite-Carle
Comparative Proteomics Study Reveals That Bacterial CpG Motifs Induce Tumor Cell Autophagy in Vitro and in Vivo
Mol. Cell. Proteomics, December 1, 2008; 7(12): 2311 - 2322.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
A. W Horne, S. J Stock, and A. E King
Innate immunity and disorders of the female reproductive tract
Reproduction, June 1, 2008; 135(6): 739 - 749.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
E. Vercammen, J. Staal, and R. Beyaert
Sensing of Viral Infection and Activation of Innate Immunity by Toll-Like Receptor 3
Clin. Microbiol. Rev., January 1, 2008; 21(1): 13 - 25.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. Zhang, I. Borecki, L. Nguyen, D. Ma, K. Smith, P. C. Huettner, D. G. Mutch, T. J. Herzog, R. K. Gibb, M. A. Powell, et al.
CD83 Gene Polymorphisms Increase Susceptibility to Human Invasive Cervical Cancer
Cancer Res., December 1, 2007; 67(23): 11202 - 11208.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M.A. Palladino, T.A. Johnson, R. Gupta, J.L. Chapman, and P. Ojha
Members of the Toll-Like Receptor Family of Innate Immunity Pattern-Recognition Receptors Are Abundant in the Male Rat Reproductive Tract
Biol Reprod, June 1, 2007; 76(6): 958 - 964.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Paladino, D. T. Cummings, R. S. Noyce, and K. L. Mossman
The IFN-Independent Response to Virus Particle Entry Provides a First Line of Antiviral Defense That Is Independent of TLRs and Retinoic Acid-Inducible Gene I
J. Immunol., December 1, 2006; 177(11): 8008 - 8016.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/5/824    most recent
biolreprod.105.048629v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.
Agricola
Right arrow Articles by Andersen, J. M.
Right arrow Articles by Ingalls, R. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS