Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print February 1, 2006.
Biol Reprod 2006, 10.1095/biolreprod.106.050807
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/5/913    most recent
biolreprod.106.050807v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.
Agricola
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.
BIOLOGY OF REPRODUCTION 74, 913–922 (2006)
DOI: 10.1095/biolreprod.106.050807
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

Stanniocalcin (STC) in the Endometrial Glands of the Ovine Uterus: Regulation by Progesterone and Placental Hormones1

Gwonhwa Song 3, Fuller W. Bazer 3, Graham F. Wagner 4, and Thomas E. Spencer 2 3

Center for Animal Biotechnology and Genomics and Department of Animal Science,3 Texas A&M University, College Station, Texas 77843 Department of Physiology,4 University of Western Ontario, London, Ontario, Canada N6A 4L6

ABSTRACT

Stanniocalcin (STC) is a hormone in fish that regulates calcium levels. Mammals have two orthologs of STC with roles in calcium and phosphate metabolism and perhaps cell differentiation. In the kidney and gut, STC regulates calcium and phosphate homeostasis. In the mouse uterus, Stc1 increases in the mesometrial decidua during implantation. These studies determined the effects of pregnancy and related hormones on STC expression in the ovine uterus. In Days 10–16 cyclic and pregnant ewes, STC1 mRNA was not detected in the uterus. Intriguingly, STC1 mRNA appeared on Day 18 of pregnancy, specifically in the endometrial glands, increased from Day 18 to Day 80, and remained abundant to Day 120 of gestation. STC1 mRNA was not detected in the placenta, whereas STC2 mRNA was detected at low abundance in conceptus trophectoderm and endometrial glands during later pregnancy. Immunoreactive STC1 protein was detected predominantly in the endometrial glands after Day 16 of pregnancy and in areolae that transport uterine gland secretions across the placenta. In ovariectomized ewes, long-term progesterone therapy induced STC1 mRNA. Although interferon tau had no effect on endometrial STC1, intrauterine infusions of ovine placental lactogen (PL) increased endometrial gland STC1 mRNA abundance in progestinized ewes. These studies demonstrate that STC1 is induced by progesterone and increased by a placental hormone (PL) in endometrial glands of the ovine uterus during conceptus (embryo/fetus and extraembryonic membranes) implantation and placentation. Western blot analyses revealed the presence of a 25-kDa STC1 protein in the endometrium, uterine luminal fluid, and allantoic fluid. The data suggest that STC1 secreted by the endometrial glands is transported into the fetal circulation and allantoic fluid, where it is hypothesized to regulate growth and differentiation of the fetus and placenta, by placental areolae.

growth hormone, implantation, placental lactogen, pregnancy, progesterone, stanniocalcin, trophoblast, uterus

INTRODUCTION

Stanniocalcin (STC) was originally described as a hormone with calcitonin-like actions in fish [14]. The hormone was discovered in the corpuscles of Stannius, unique endocrine glands on the kidneys of bony fish [5]. Removal of the organ or stanniectomy causes hypercalcemia [6, 7]. Fish STC1 was subsequently purified from the corpuscles of Stannius and found to be a homodimeric phosphoglycoprotein that regulates calcium and phosphate homeostasis [8]. In fish, STC synthesis and secretion are controlled primarily by serum calcium levels [5], and STC acts to restore normocalcemia by acting on the gills to reduce further influx of calcium from the aquatic environment, on the kidneys to promote reabsorption of phosphate and chelate excess calcium, and on the gut to inhibit calcium uptake across the intestinal epithelium [1, 3, 5, 8, 9].

STC1, a mammalian ortholog of fish STC1, has relatively high amino acid sequence identity (approximately 50%) with fish STC and is expressed in a variety of tissues including brain, kidney, lung, and heart [10]. STC2 has lower identity (approximately 35%) with STC1 and fish STC1 [11]. Similar to STC1, STC2 is expressed in a variety of tissues. Research into the functions of STCs in mammals is at an early stage; therefore, its physiological roles have not been established (see for review [4, 1214]). Similar to fish STC, mammalian STC1 regulates intracellular calcium and phosphate (Pi) levels in the kidney and intestine [5, 15], but the function of STC2 is unknown. Mammalian STC1 regulates renal transport of phosphate through stimulation of NaPi-2 cotransport activity [3, 1618]. In rodents, Stc1 expression increases in ovarian tissues during gestation and lactation [19], as well as in mesometrial decidua of the uterus during implantation [20]. In the rat ovary, STC1 and STC2 are expressed in ovarian theca/interstitial cells, and in vitro studies suggest that they act in a paracrine manner to dampen gonadotropin stimulation of granulosa cell differentiation [11, 21]. In mice, Stc1 does not appear to be essential for reproduction or growth, because null mutants have no overt phenotype [22]; however, in that study, Stc2 was found in all tissues that normally express Stc1, and may compensate for the lack of Stc1.

The STCs have not been investigated in the reproductive tract of mammals other than mice; therefore, these studies were conducted to determine whether the STC genes are expressed in the ovine uterus and to determine the effects of pregnancy, progesterone, and placental hormones on STC1 and STC2 expression in the endometrium. The results of these studies indicate that STC1 is expressed specifically by the endometrial glands of the pregnant uterus and suggest that it has a biological role(s) in regulating fetal and placental development and physiology.

MATERIALS AND METHODS

Animals

Crossbred Suffolk ewes (Ovis aries) bred and raised on the premises of Texas A&M University, were observed daily for estrus in the presence of vasectomized rams and used in the experiments after they exhibited at least two estrous cycles of normal duration (16–18 days). All experimental and surgical procedures were in compliance with the Guide for the Care and Use of Agriculture Animals in Teaching and Research and approved by the Institutional Animal Care and Use Committee of Texas A&M University.

Experimental Designs

Experiment 1. At estrus (Day 0), ewes were mated to either an intact or a vasectomized ram as described previously [23] and then hysterectomized (n = 5 ewes/day) on either Day 10, 12, 14, or 16 of the estrous cycle or Day 10, 12, 14, 16, 18 or 20 of pregnancy. On Days 10–16, the uterine lumen was flushed with 20 ml of sterile saline. Presence of one or more morphologically normal conceptuses confirmed pregnancy in mated ewes. It was not possible to obtain uterine flushes on either Day 18 or Day 20 of pregnancy, because the conceptus had firmly adhered to the endometrial luminal epithelium (LE) and basal lamina. At hysterectomy, several sections (~0.5 cm) from the mid portion of each uterine horn ipsilateral to the corpus luteum (CL) were fixed in fresh 4% paraformaldehyde in PBS (pH 7.2). In monovulatory pregnant ewes, uterine tissue samples were marked as either contralateral or ipsilateral to the ovary bearing the CL. No tissues from the contralateral uterine horn were used for this study. After 24 h, fixed tissues were changed to 70% ethanol for 24 h, dehydrated through a graded series of alcohol to xylene, and then embedded in Paraplast-Plus (Oxford Labware). Several sections (1–1.5 cm) from the middle of each uterine horn were embedded in Tissue-Tek OCT compound (Miles), frozen in liquid nitrogen vapor, and stored at –80°C. The remaining endometrium was physically dissected from myometrium, frozen in liquid nitrogen, and stored at –80°C for subsequent RNA extraction. Uterine flushes were clarified by centrifugation (3000 x g for 30 min at 4°C) and frozen at –80°C for Western blot analysis.

Experiment 2. At estrus (Day 0), ewes were mated to an intact ram as described previously [24]. Ewes were then hysterectomized (n = 5 ewes/day) on either Day 40, 60, 80, 100, 120, or 140 of pregnancy (gestation period is 147 days). Allantoic fluid samples were obtained and frozen at –80°C. At hysterectomy, the uterus was trimmed free of cervix and oviduct and opened along the mesometrial border. Several sections (~0.5 cm) of both intercaruncular and placentomal uterine wall regions from the mid portion of each uterine horn were fixed in fresh 4% paraformaldehyde in PBS (pH 7.2). Placentomes were then removed by physical dissection, and remaining intercaruncular endometrium was dissected from the myometrium. Endometrial samples were frozen in liquid nitrogen and stored at –80°C for RNA extraction.

Experiment 3. Sixteen cyclic ewes were ovariectomized and fitted with intrauterine catheters on Day 5 postestrus as described previously [25]. Ewes were then assigned randomly (n = 4 ewes/treatment) to receive daily i.m. injections of progesterone (Sigma Chemical Co.) or progesterone and a progesterone receptor (PGR) antagonist (ZK 136,317; generously provided by Dr. Kristof Chwalisz, Schering AG, Berlin, Germany) and intrauterine infusions of either control serum proteins or recombinant ovine interferon tau (IFNT) protein as follows: 1) 50 mg progesterone (P4; Days 5–24) and 200 µg control (CX) serum proteins (Days 11–24; P4+CX); 2) P4 and 75 mg of ZK 136 317 (Days 11–24) and CX proteins (200 µg; P4+ZK+CX); 3) P4 and IFNT (2 x 107 antiviral units, Days 11–24; P4+IFN); or 4) P4 and ZK and IFNT (P4+ZK+IFN). All ewes were hysterectomized on Day 25 postestrus. Recombinant ovine IFNT was prepared in a yeast bacterial system and assayed for biological activity using an antiviral assay as described previously [26]. Control serum proteins and IFNT were prepared for intrauterine injections as described previously [27].

Experiment 4. Fifteen cyclic ewes were ovariectomized and fitted with intrauterine catheters on Day 5 postestrus as described previously [28]. All ewes received daily i.m. injections of 50 mg P4 (Days 5–25) and intrauterine injections of IFNT (2 x 107 antiviral units/day) from Day 11 to Day 20. Ewes (n = 5 per treatment group) also received daily intrauterine injections of either CX serum proteins (200 µg), recombinant ovine placental lactogen (PL; 200 µg), or recombinant ovine growth hormone (GH; 200 µg) from Day 16 to Day 25, when all ewes were hysterectomized. Recombinant ovine PL and ovine GH were prepared in bacteria and purified as described previously [29].

For both experiments 3 and 4, portions (~0.5 cm) from the middle region of the uterine horn were fixed at hysterectomy in fresh 4% paraformaldehyde in PBS (pH 7.2) for 24 h, washed in 70% ethanol for 24 h, dehydrated through a graded series of alcohol to xylene, and then embedded in Paraplast-Plus (Oxford Labware).

Experiment 5. Ewes (n = 4) were made unilaterally pregnant as described previously [30]. On Day 80 of pregnancy, uterine secretions, e.g., uterine milk, were collected from the nongravid uterine horn of unilaterally pregnant ewes (n = 4) on Day 80 of pregnancy by flushing the uterine horn with 100 ml of saline. In addition, samples of allantoic fluid and amniotic fluid (50 ml) were obtained using a syringe fitted with a 20-gauge needle from the gravid uterine horn. Uterine milk and allantoic fluids were clarified by centrifugation and stored at –80°C.

RNA Isolation

Total cellular RNA was isolated from frozen endometrium from the uterine horn ipsilateral to the CL (experiment 1) and intercaruncular endometrium or placentomes (experiment 2) using Trizol reagent (Gibco-BRL) according to manufacturer's recommendations. The quantity and quality of total RNA was determined by spectrometry and denaturing agarose gel electrophoresis, respectively.

Cloning of Partial cDNAs for Ovine STC1 and STC2

Partial cDNAs for ovine STC1 and STC2 mRNAs were amplified by RT-PCR using total RNA from endometrium from ewes on Day 18 of pregnancy. For STC1, the sense primer (5'-TGATCAGTGCTTCTGCAACC-3') and antisense primer (5'-TCACAGTCCAGTAGGCTTCG-3') were derived from the bovine STC1 mRNA coding sequence (GenBank accession no. NM_176669). For STC2, the sense primer (5'-AACGCTGGAAAATTTGATGC-3') and antisense primer (5'- CTCTTGCTACCTCGCTCACC –3') were derived from the human STC2 mRNA coding sequence (GenBank accession no. AF055460). PCR amplification was as follows: 1) 95°C for 5 min; 2) 95°C for 45 sec, 59.1°C for 1 min (for STC1), 61.8°C for 1 min (for STC2), and 72°C for 1 min for 35 cycles; and 3) 72°C for 10 min. Partial ovine STC1 and STC2 cDNAs were cloned into pCRII using a T/A Cloning Kit (Invitrogen) and their sequences were verified using an ABI PRISM Dye Terminator Cycle Sequencing Kit and ABI PRISM automated DNA sequencer (Perkin-Elmer Applied Biosystems).

Slot Blot Hybridization Analyses

Steady-state levels of mRNA in ovine endometria from experiments 1 and 2 were assessed by slot blot hybridization as described previously [31, 32]. Antisense cRNA probes were generated by linearizing both pCRII-STC1 and pCRII-STC2 plasmids with XbaI and in vitro transcription with SP6 RNA polymerase, and sense cRNA probes were generated using BamHI and T7 RNA polymerase. Radiolabeled antisense and sense cRNA probes were then generated by in vitro transcription with [{alpha}-32P]-UTP. Denatured total endometrial RNA (20 µg) from each ewe was hybridized with radiolabeled cRNA probes. To correct for variation in total RNA loading, a duplicate RNA slot membrane was hybridized with radiolabeled antisense 18S cRNA (pT718S; Ambion). Following washing, the blots were digested with ribonuclease A and radioactivity associated with slots quantified using a Typhoon 8600 MultiImager (Molecular Dynamics).

In Situ Hybridization Analyses

Location of STC mRNA expression in sections (5 µm) of the ovine uterus was determined by radioactive in situ hybridization analysis as described previously [31, 32]. Briefly, deparaffinized, rehydrated, and deproteinated uterine tissue sections were hybridized with radiolabeled antisense or sense cRNA probes generated from linearized ovine STC1 and STC2 partial cDNAs using in vitro transcription with [{alpha}-35S]-UTP. After hybridization, washing, and ribonuclease A digestion, slides were dipped in NTB-2 liquid photographic emulsion (Kodak) and exposed at 4°C for 1 to 2 wk. Slides were developed in Kodak D-19 developer, counterstained with Gill hematoxylin (Fisher Scientific), and then dehydrated through a graded series of alcohol to xylene. Coverslips were then affixed with Permount (Fisher). Images of representative fields were recorded under brightfield and darkfield illumination using a Nikon Eclipse 1000 photomicroscope (Nikon Instruments Inc.) fitted with a Nikon DXM1200 digital camera.

In experiments 3 and 4, the relative abundance of STC1 mRNA in the endometrial glands was determined with Scion Image software (release beta 4.03; Scion Corporation, NIH). Briefly, photomicrographs of at least 10 regions of the uterus from each animal were acquired under darkfield illumination and converted to a TIFF file. Using Scion Image software, the optical intensity for the mRNA hybridization signals in the endometrial glands was determined. The inter- and intrasection variation in optical intensity value measurements was less than 5%.

Immunohistochemical Analyses

Immunocytochemical localization of STC1 protein in the ovine uterus was performed as described previously [28] in tissue sections from experiments 1 and 2 with rabbit anti-human STC1 antiserum [20] at a 1:25,000 dilution. Antigen retrieval was performed by using a boiling citrate buffer and negative controls included substitution of purified rabbit IgG for the primary antibody at the same final concentration.

Western Blot Analyses

Endometrial extracts of uteri from Days 12, 18, and 80 of pregnancy in experiments 1 and 2 were prepared by homogenizing the uterine tissues in extraction buffer (60 mM Tris pH 7.0, 1 mM Na3VO4, 10% glycerol, 2% SDS, and 1x protease inhibitor cocktail [Roche]). Uterine flushes from Day 16 pregnant ewes in experiment 1 were concentrated using Centricon-3 columns (Amicon). Protein concentrations of uterine flushes, uterine milk, and allantoic fluid were determined using the Bradford protein assay (Bio-Rad) with BSA as the standard. Proteins were denatured and separated by 15% SDS-PAGE, and Western blot analysis was performed as described previously [33] using enhanced chemiluminescence detection (SuperSignal West Pico, Pierce) and X-OMAT AR X-ray film (Kodak). Immunoreactive STC1 protein was detected using the rabbit anti-human STC1 antiserum [20] at a 1:40,000 final dilution.

Statistical Analyses

All quantitative data were subjected to least-squares regression analyses (ANOVA) using the General Linear Models procedures of the Statistical Analysis System (SAS Institute). Slot blot hybridization data were corrected for differences in sample loading using the 18S rRNA data as a covariate. Data from experiments 1 and 2 were analyzed for effects of day, pregnancy status (cyclic or pregnant), tissue (caruncular and intercaruncular endometrium), treatment, and their interactions. Within pregnancy status, least squares regression analyses were used to determine effects of day on endometrial mRNA levels. Optical intensity measurements of mRNA abundance in the endometrial glands as determined by in situ hybridization analyses of uteri from experiments 3 and 4 were analyzed for effects of treatment, animal, and slide. Preplanned orthogonal contrasts were used to determine main effects of treatment. All tests of significance were performed using the appropriate error terms according to the expectation of the mean squares for error. A P value of 0.05 or less was considered significant, whereas a P value of 0.05 to 0.10 was considered a trend toward significance. Data are presented as least-square means (LSM) with SEM.

RESULTS

Steady-State Levels of STC1 and STC2 mRNA in the Endometrium of the Ovine Uterus

Steady-state levels of STC1 and STC2 mRNA in endometria of cyclic and pregnant ewes were determined by slot blot hybridization analysis (Fig. 1). STC1 mRNA was detected in the endometrium of pregnant ewes, but not in the endometrium of cyclic ewes. In addition, STC1 mRNA was not detected in the placentomal tissues of pregnant ewes (data not shown). In pregnant ewes, STC1 mRNA first appeared on Day 18 of pregnancy, increased (P < 0.01) ~6-fold to Day 80, and remained abundant thereafter. STC2 mRNA was found in the endometria of both cyclic and pregnant ewes as well as in the placentomes. Overall, STC2 mRNA levels were low in the endometrium and not different (P > 0.10) between cyclic and pregnant ewes on Days 10 to 16. STC2 mRNA levels increased (linear, P < 0.05) ~3-fold in the endometrium of pregnant ewes after Day 20. Low levels of STC2 mRNA were observed throughout gestation in the placentomal tissues.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Steady-state levels of STC1 and STC2 mRNAs in ovine uterine and placental tissues. A) STC1 mRNA in the endometrium of cyclic (C) and early pregnant (P) ewes (Days 10–20) and in the intercaruncular (ICAR) endometria of later pregnant ewes (Days 40 –120). STC1 mRNA was detected in the endometrium of pregnant ewes, but not in the endometrium of cyclic ewes (ND, not detectable) or in the placentomal tissues of pregnant ewes (data not shown). In pregnant ewes, STC1 mRNA was first detected on Day 18 of pregnancy, increased (P < 0.01) ~6-fold to Day 80, and remained abundant thereafter in the intercaruncular (ICAR) endometrium. B) STC2 mRNA in the endometrium of cyclic (C) and early pregnant (P) ewes (Days 10 to 20) and in the intercaruncular (ICAR) endometria and placentomes (PLAC) of later pregnant ewes (Days 40–120). STC2 mRNA was detected in the endometria of both cyclic and pregnant ewes as well as in the placentomes. Overall, STC2 mRNA levels were low in the endometrium and not different (P > 0.10) between cyclic and pregnant ewes on Days 10–16. STC2 mRNA levels increased (P < 0.05) ~3-fold in the endometrium of pregnant ewes after Day 20. Low levels of STC2 mRNA were observed throughout gestation in the placentomal tissues. Data are expressed as LSM relative units (RU) ± SEM.

Localization of STC1 and STC2 mRNAs in the Ovine Uterus

In situ hybridization analyses determined the location of STC1 and STC2 mRNAs in uteri of cyclic and pregnant ewes (Figs. 2 and 3). In cyclic ewes, STC1 mRNA was not detected between Days 10 and 16 of the estrous cycle or pregnancy (Fig. 2). Similarly, STC1 mRNA was not detected in the endometrium of Days 10 to 16 pregnant ewes. On Day 18 of pregnancy, STC1 mRNA was detected in the endometrial glandular epithelium (GE), but not in any other uterine or placental cell types, including the LE, stroma, myometrium, blood vessels, immune cells, or conceptus trophectoderm. Throughout pregnancy, STC1 mRNA was observed only in the endometrial GE. The photomicrographs of Day 60, 80, 100, and 120 placentomes contain red blood cells at the placentome-myometrium interface that diffract light under darkfield illumination, but are not positive for STC1 mRNA.


Figure 2
View larger version (131K):
[in this window]
[in a new window]
 
FIG. 2. In situ hybridization analysis of STC1 mRNA in the uterus of cyclic and pregnant ewes. Cross-sections of the uterine wall from cyclic (C) and pregnant (P) ewes and placentomes of pregnant ewes were hybridized with radiolabeled antisense or sense ovine STC1 cRNAs. Note that STC1 mRNA is expressed only in the glandular epithelia of the endometrium during pregnancy. GE, Glandular epithelium; LE, luminal epithelium; M, myometrium; S, stroma; Tr, trophectoderm. Bar = 10 µm.


Figure 3
View larger version (101K):
[in this window]
[in a new window]
 
FIG. 3. In situ hybridization analyisis of STC2 mRNA in the endometrium of cyclic and pregnant ewes and placentomal tissue of later pregnant ewes. Cross-sections of the uterine wall from cyclic (C) and pregnant (P) ewes were hybridized with radiolabeled antisense or sense ovine STC2 cRNAs. Very low levels of STC2 mRNA were detected in the endometrial stroma and glands of the cyclic and early pregnant uterus. In later pregnant ewes, STC2 mRNA was observed predominantly in the endometrial lumina epithelium (LE), glandular epithelium (GE) and conceptus trophectoderm (Tr) as well as in the maternal caruncular stroma (S) of the placentome. Bar = 10 µm.

In contrast to STC1, STC2 mRNA was detected at very low levels in the endometrial LE, GE, and stroma of cyclic and early pregnant ewes (Fig. 3). In later pregnant ewes, STC2 mRNA was detected predominantly in the endometrial LE and GE as well as in the conceptus trophectoderm, with lower levels in the stroma. Given the temporal and spatial alterations in the two STC genes in ovine uteroplacental tissues, we focused on STC1 in the remainder of the studies.

Localization of Immunoreactive STC1 Protein in the Ovine Uterus

Immunohistochemical analysis indicated that STC1 protein was localized predominantly on the apical surface of GE between Days 18 and 140 of gestation (Fig. 4). Consistent with results from in situ hybridization analyses, STC1 protein was predominantly detected in the endometrial glands near the apical surface. In caruncular areas, immunoreactive STC1 was detected only in GE adjacent to the placentome. Areolae are specialized areas of the intercotyledonary placenta that form over the opening of a gland duct on the endometrial luminal surface [34]. STC1 protein was consistently observed in the folded areolae of the intercotyledonary placenta.


Figure 4
View larger version (146K):
[in this window]
[in a new window]
 
FIG. 4. Immunohistochemical localization of STC1 protein in uteri from cyclic (C) and pregnant (P) ewes. In the IgG control, normal rabbit IgG was substituted for rabbit polyclonal antibody to human STC1. Sections were not counterstained. Note the immunoreactive STC1 protein in the endometrial glandular epithelia and accumulation in the placental areolae as shown on Day 100 of pregnancy. LE, Luminal epithelium; GE, glandular epithelium; M, myometrium; S, stroma; Tr, trophectoderm. Bar = 10 µm, except in higher magnifications of the glands and areolae on Day 100 of pregnancy, for which bar = 100 µm.

Progesterone Induces STC1 mRNA in the Endometrial Glands of the Ovine Uterus

Osteopontin (secreted phosphoprotein 1 or SPP1 and uterine SERPIN, also known as uterine milk protein or UTMP) is also expressed only in the endometrial GE and induced by progesterone [25, 3537]. Therefore, experiment 3 was conducted to determine if the induction of STC1 mRNA in the endometrial glands of early pregnant ewes was caused by progesterone and/or IFNT from the conceptus (Fig. 5A). Continuous, long-term progesterone treatment for 20 days alone induced STC1 mRNA in the endometrium of the ovine uterus (Fig. 5B). As illustrated in Figure 5C, STC1 mRNA was 11.6-fold higher (P < 0.01) in the endometrial glands of P4+CX-treated ewes as compared to P4+ZK+CX-treated ewes. Indeed, STC1 mRNA was not observed in the endometrial glands of uteri from any of the ewes receiving progesterone and the ZK antiprogestin (Fig. 5B). Intrauterine infusion of IFNT had no effect (P > 0.10) on STC1 mRNA abundance in the endometrial glands when P4+IFN-treated ewes were compared to P4+CX-treated ewes. STC2 mRNA was not detected by in situ hybridization analysis in endometria of ewes in any treatment group (data not shown).


Figure 5
View larger version (68K):
[in this window]
[in a new window]
 
FIG. 5. Effects of progesterone and interferon tau on endometrial STC1 mRNA. A) Experimental design (see Materials and Methods for complete description of experimental design). CX, Control serum proteins; Hystx, hysterectomy; IFN, recombinant ovine interferon tau; Ovx/Cath, ovariectomy and uterine catheterization; P4, progesterone; ZK, ZK137,316. B) In situ hybridization analysis of STC1 mRNA in the uterus. STC1 mRNA was not observed in the endometrial glands of uteri from any of the ewes receiving progesterone and the ZK antiprogestin. LE, Luminal epithelium; GE, glandular epithelium; S, stroma. Bar = 10 µm. C) Quantification of STC1 mRNA in the endometrial glands of uteri. STC1 mRNA was 11.6-fold higher (P < 0.01) in the endometrial glands of P4+CX-treated ewes as compared to P4+ZK+CX-treated ewes. However, intrauterine infusion of IFNT had no effect (P > 0.10) on STC1 mRNA abundance in the endometrial glands when P4+IFN-treated ewes were compared to P4+CX-treated ewes. Data are expressed as LSM optical intensity ± SEM.

PL and GH Increase STC1 mRNA in the Endometrium

In addition to being progesterone-induced genes in the endometrial glands of the ovine uterus, SPP1 and SERPIN are also stimulated by intrauterine administration of ovine PL and ovine GH [28, 38]. Therefore, experiment 4 was conducted to determine whether ovine PL and/or ovine GH regulated STC expression in the endometrial glands of the ovine uterus (Fig. 6A). Intrauterine administration of recombinant ovine PL increased STC1 mRNA in the endometrial glands of the ovine uterus by 1.8-fold (P < 0.05, CX vs. PL; Fig. 6, B and C). Similarly, intrauterine administration of recombinant ovine GH tended to increase STC1 mRNA in the endometrial glands by 1.4-fold (P < 0.10, CX vs. GH). Similar to experiment 3, STC2 mRNA was not detected by in situ hybridization analysis of the endometria from any of the ewes in the experiment (data not shown).


Figure 6
View larger version (55K):
[in this window]
[in a new window]
 
FIG. 6. Effects of intrauterine infusion of placental lactogen and growth hormone on endometrial STC1 mRNA. A) Experimental design (see Materials and Methods for complete description of experimental design). CX, Control serum proteins; GH, growth hormone; Hystx, hysterectomy; IFN, recombinant ovine interferon tau; Ovx/Cath, ovariectomy and uterine catheterization; P4, progesterone; PL, placental lactogen. B) In situ hybridization analysis of STC1 mRNA in the uterus. LE, luminal epithelium; GE, glandular epithelium; S, stroma. Bar = 10 µm. C) Quantification of STC1 mRNA in the endometrial glands of uteri. Intrauterine administration of recombinant ovine PL increased STC1 mRNA in the endometrial glands of the ovine uterus by 1.8-fold (*P < 0.05, CX vs. PL). Intrauterine administration of recombinant ovine GH tended to increase STC1 mRNA in the endometrial glands by 1.4-fold (+P < 0.10, CX vs. GH). Data are expressed as LSM optical intensity ± SEM.

Western Blot Analysis of STC1 Protein in the Endometrium, Uterine Secretions, and Fetal Fluids

Western blot analysis (under reducing conditions) of endometrial extracts, uterine secretions and allantoic fluid from pregnant ewes with rabbit anti-human STC1 antibody detected a single protein of ~25 kDa in size. Immunoreactive STC1 was observed in the uterine luminal fluid, e.g., uterine milk, and allantoic fluid of Day 80 unilateral pregnant ewes, but not in the uterine luminal fluid obtained by flush of Day 16 pregnant ewes (Fig. 7). In addition, STC1 was not detected in the amniotic fluid from Day 80 pregnant ewes (data not shown). These results support the idea that STC1 is synthesized in GE, secreted by glands into the uterine lumen, transported by the areolae across the placenta into the fetal circulation, cleared by the kidney into the urachus, and then stored in the allantoic fluid during gestation.


Figure 7
View larger version (41K):
[in this window]
[in a new window]
 
FIG. 7. Analysis of immunoreactive STC1 protein in the uterine luminal fluid and allantoic fluid of pregnant ewes. Proteins were separated by 15% SDS-PAGE under reducing conditions. Western blot analysis found a single immunoreactive protein of ~25 kDa in uterine luminal fluid and allantoic fluid samples from Day 80 unilaterally pregnant ewes, but not in uterine luminal fluid of Day 16 pregnant ewes or amniotic fluid of Day 80 ewes (data not shown). Positions of prestained molecular weight standards (x 10–3) are indicated.

DISCUSSION

The results of the present studies demonstrate that STC1 is exclusively expressed in the endometrial glands of the ovine uterus after Day 16 of pregnancy. In sheep, the blastocyst enters the uterus by Day 6, but only begins implantation on Day 16 [39]. In rodents, STC1 gene expression was found to shift from the uterine LE to the mesometrial decidua during implantation [20]. In contrast, in the endometrium of the ovine uterus, the STC1 gene was uniquely expressed in glandular epithelial cells. Likewise, STC1 protein was present near the apical surface of gland cells and secreted into the uterine lumen, as evidenced by the presence of immunoreactive STC1 protein in uterine secretions, placental areolae, and allantoic fluid. In this context, STC1 would appear to be secreted in an exocrine manner. If STC1 is also secreted in an endocrine direction by the endometrial glands, it may play an additional role in regulating maternal physiology, and perhaps be useful as an endocrine marker of pregnancy in sheep. STC2, a paralog of STC1, has been identified [11, 40, 41] and detected in various tissues, but its biological roles are not known. In the present study, low levels of STC2 mRNA were detected in the endometrial glands and placenta. Results of the present studies indicate that STC1 is the predominant form of the hormone produced in the ovine uterus and present in uteroplacental tissues of the sheep.

The gland-specific expression of the STC1 gene in the endometrium of the ovine uterus is similar to that of SPP1 and SERPIN, which also encode secreted proteins that are present in the uterine lumen and allantoic fluid during pregnancy [4244]. All three genes are induced in the glands of the endometrium in response to progesterone. Available results indicate that continuous exposure of the uterus to progesterone specifically downregulates PGR in the endometrial epithelia [45, 46]. The disappearance of PGR from the endometrial GE after Day 13 of pregnancy is associated with subsequent induction of SPP1 after Day 13 followed by SERPIN and STC1 between Days 16 and 18 [25, 35, 47, 48]. Indeed, treatment of ewes with an antiprogestin inhibited progesterone-dependent downregulation of the PGR in the endometrial epithelia of the ovine uterus [25]. Furthermore, administration of estrogen with progesterone to ewes upregulated PGR in the endometrial GE, which, in turn, suppressed SPP1 and SERPIN [28]. Collectively, available evidence suggests that the STC1 gene is repressed by liganded PGR, and this repression is removed by progesterone downregulation of the PGR gene that occurs after Day 13 of pregnancy. Thus, progesterone induction of STC1, as well as SPP1 and SERPIN, is not a classical mechanism of gene regulation by progesterone and PGR. Indeed, downregulation of PGR by progesterone may be requisite for GE remodeling and differentiated function (see [46]). Given that STC1 gene expression was first observed in the endometrial glands on Day 18 of pregnancy, it is likely that another factor(s) besides progesterone regulates the STC1 gene, because PGR gene expression is lost between Days 13 and 15 of pregnancy [48].

In the present study, ovine PL and GH were found to stimulate STC1 in the endometrial glands. During pregnancy, the uterus is sequentially exposed to progesterone from the ovary and then to IFNT, PL, and GH from the placenta. IFNT is produced by the mononuclear trophectoderm between Days 11 to 20 of early pregnancy and is the signal for maternal recognition of pregnancy [49]. IFNT acts in a paracrine manner on the endometrium to inhibit development of the luteolytic mechanism in the endometrial LE, thereby promoting continued production of progesterone by the corpus luteum. Although IFNT stimulates a large number of genes in the endometrial GE and stroma [49], STC1 expression in the endometrial glands was not affected by IFNT in the present studies. PL is produced specifically by the trophoblast giant binucleate cells, which first differentiate between Days 14 and 15 in the conceptus [50]. Peak concentrations of PL in maternal serum closely parallel dynamic changes in total protein synthesized and secreted by the GE of the ovine endometrium during gestation [36, 5154]. In the current studies, STC1 mRNA and protein was first observed on Day 18 of pregnancy and increased to maximal levels by Day 80 of pregnancy, which is associated with the onset of and increases in PL production by the trophoblast giant binucleate cells. Indeed, SPP1 and SERPIN are also stimulated in the endometrium of ovariectomized ewes treated with progesterone and IFNT [28, 38]. Lacroix et al. [55, 56] first described the expression of GH in the ovine placenta between Days 35 and 70. Similar to uterine SERPINs, STC1 tended to be stimulated in the endometrial glands by intrauterine infusions of ovine GH. Thus, somatolactogenic hormones from the conceptus act in a paracrine manner on the endometrium to increase STC1 mRNA in the GE. Future studies will need to focus on the molecular mechanism of PL and GH modulation of STC1 gene expression. The mechanism likely involves both prolactin receptors (PRLRs) and GH receptors (GHRs), because ovine PL can signal through a homodimer of PRLRs as well as through a heterodimer of PRLRs and GHRs, whereas GH signals only via a homodimer of GHRs [57]. Indeed, PRLRs are expressed exclusively in the endometrial glands of the ovine uterus, and PL binds to those receptors [35, 38, 58]. Furthermore, IFNT stimulates PRLRs in the endometrial glands of the ovine uterus [59]. Although likely more complicated, available evidence supports the idea that progesterone downregulates PGR, which is permissive for the onset of STC1, and then IFNT stimulates PRLRs, which in turn respond to PL from the new trophoblast giant binucleate cells, which further stimulate STC1 gene expression along with GH during later pregnancy.

Although mouse STC1 expression is highly upregulated in the ovary during lactation [19] and changes dynamically in the uterus during the preimplantation period [19, 20], its biological and molecular functions in the mammalian uterus during pregnancy are not known. In the present study, we found that STC1 is induced by progesterone and stimulated by PL and GH. The temporal alterations in endometrial STC1 mRNA and protein parallel fetal growth and development. Indeed, our results indicate that STC1 is secreted by the endometrial glands into the uterine lumen, where it is transported into the fetal circulation by the areolae of the intercotyledonary placenta. After implantation, the chorioallantois develops unique structures, termed areloae, that develop over the mouth of each uterine gland as specialized areas for absorption and transport of uterine histotroph into the conceptus [60]. These results support the idea that STC1 protein is synthesized by the endometrial glands and then secreted into the uterine lumen, where it is absorbed by the placenta, transported into the fetal circulation, and cleared by the kidney into the allantois via the urachus [60, 61]. Although the allantois was initially considered a reservoir for waste products of the fetus, it serves to store most secreted proteins from the endometrium, including SERPINs [36, 62]. In contrast, amniotic fluid is not in the path for protein clearance by the fetal kidney, and therefore does not function in this capacity. Alternatively, STC1 may originate from the fetus itself, given that Stc1 is highly expressed by the mouse fetus, in particular by the kidneys, testes, bone and muscle [63].

Although the functions of uterine STC1 are not known, based on its biological properties in fish and mammals, it may be involved in the regulation of calcium and phosphate transport by placental membranes as well as their homeostasis in the fetus. All of the nutrients and minerals required to provide the anabolic requirements of the developing ovine fetus must pass from the maternal circulation through either the uterine glands (interplacentomal) or feto-maternal syncytiotrophoblast (placentomal) and then cross the placental trophoblast epithelium [64]. Calcium is essential for cellular homeostasis and function. During pregnancy, fetal calcium must cross the placenta, in exponentially increasing amounts during the second half of gestation to support fetal bone growth [65]. Calcium transport across the placenta is an active process, because the level of serum calcium in the fetus is higher than that in the mother [66]. Indeed, S100 calcium binding protein G (S100G, also known as calbindin-D9K) is present in the maternal endometrial glands and is higher in the trophoblasts of the interplacentomal placenta as compared to those of the placentomes [67, 68]. Given the importance of calcium in placental function and fetal growth, STC1 from the endometrial glands may regulate calcium and phosphate homeostasis in the placenta as well as perhaps the fetus.

ACKNOWLEDGMENTS

We thank all members of our laboratory for assistance and management of animals.

FOOTNOTES

1 Supported by grants from the Canadian Institutes of Health Research and the Kidney Foundation of Canada to G.F.W. Back

2 Correspondence: Thomas E. Spencer, Center for Animal Biotechnology and Genomics, 442 Kleberg Center, 2471 TAMU, Texas A&M University, College Station, TX 77843-2471. FAX: 979 862 2662; tspencer{at}tamu.edu Back

Received: 7 January 2006.

First decision: 23 January 2006.

Accepted: 30 January 2006.

REFERENCES

  1. Butkus A, Roche PJ, Fernley RT, Haralambidis J, Penschow JD, Ryan GB, Trahair JF, Tregear GW, Coghlan JP, Purification and cloning of a corpuscles of Stannius protein from Anguilla australis. Mol Cell Endocrinol 1987 54:123-133[CrossRef][Medline]
  2. Sundell K, Bjornsson BT, Itoh H, Kawauchi H, Chum salmon (Oncorhynchus keta) stanniocalcin inhibits in vitro intestinal calcium uptake in Atlantic cod (Gadus morhua). J Comp Physiol [B] 1992 162:489-495[Medline]
  3. Lu M, Wagner GF, Renfro JL, Stanniocalcin stimulates phosphate reabsorption by flounder renal proximal tubule in primary culture. Am J Physiol 1994 267:R1356-R1362
  4. Gerritsen ME, Wagner GF, Stanniocalcin: no longer just a fish tale. Vitam Horm 2005 70:105-135[Medline]
  5. Wagner GF, The molecular biology of the corpuscles of stannius and regulation of stanniocaclin gene expression. In: Hochachka PW, Mommsen TP (eds.) Fish Physiology Amsterdam: Academic Press 1994 273-306
  6. So YP, Fenwick JC, Relationship between net 45calcium influx across a perfused isolated eel gill and the development of post-stanniectomy hypercalcemia. J Exp Zool 1977 200:259-264[CrossRef][Medline]
  7. Fenwick JC, Brasseur JG, Effects of stanniectomy and experimental hypercalcemia on plasma calcium levels and calcium influx in American eels, Anguilla rostrata, LeSueur. Gen Comp Endocrinol 1991 82:459-465[CrossRef][Medline]
  8. Wagner GF, Hampong M, Park CM, Copp DH, Purification, characterization, and bioassay of teleocalcin, a glycoprotein from salmon corpuscles of Stannius. Gen Comp Endocrinol 1986 63:481-491[CrossRef][Medline]
  9. Wagner GF, Jaworski E, Calcium regulates stanniocalcin mRNA levels in primary cultured rainbow trout corpuscles of stannius. Mol Cell Endocrinol 1994 99:315-322[CrossRef][Medline]
  10. Varghese R, Wong CK, Deol H, Wagner GF, DiMattia GE, Comparative analysis of mammalian stanniocalcin genes. Endocrinology 1998 139:4714-4725[Abstract/Free Full Text]
  11. Luo CW, Pisarska MD, Hsueh AJ, Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology 2005 146:469-476[Abstract/Free Full Text]
  12. Ishibashi K, Imai M, Prospect of a stanniocalcin endocrine/paracrine system in mammals. Am J Physiol Renal Physiol 2002 282:F367-F375[Abstract/Free Full Text]
  13. Chang AC, Jellinek DA, Reddel RR, Mammalian stanniocalcins and cancer. Endocr Relat Cancer 2003 10:359-373[Abstract]
  14. Yoshiko Y, Aubin JE, Stanniocalcin 1 as a pleiotropic factor in mammals. Peptides 2004 25:1663-1669[CrossRef][Medline]
  15. Madsen KL, Tavernini MM, Yachimec C, Mendrick DL, Alfonso PJ, Buergin M, Olsen HS, Antonaccio MJ, Thomson AB, Fedorak RN, Stanniocalcin: a novel protein regulating calcium and phosphate transport across mammalian intestine. Am J Physiol 1998 274:G96-G102
  16. Olsen HS, Cepeda MA, Zhang QQ, Rosen CA, Vozzolo BL, Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc Natl Acad Sci U S A 1996 93:1792-1796[Abstract/Free Full Text]
  17. Haddad M, Roder S, Olsen HS, Wagner GF, Immunocytochemical localization of stanniocalcin cells in the rat kidney. Endocrinology 1996 137:2113-2117[Abstract]
  18. Wagner GF, Vozzolo BL, Jaworski E, Haddad M, Kline RL, Olsen HS, Rosen CA, Davidson MB, Renfro JL, Human stanniocalcin inhibits renal phosphate excretion in the rat. J Bone Miner Res 1997 12:165-171[CrossRef][Medline]
  19. Deol HK, Varghese R, Wagner GF, Dimattia GE, Dynamic regulation of mouse ovarian stanniocalcin expression during gestation and lactation. Endocrinology 2000 141:3412-3421[Abstract/Free Full Text]
  20. Stasko SE, DiMattia GE, Wagner GF, Dynamic changes in stanniocalcin gene expression in the mouse uterus during early implantation. Mol Cell Endocrinol 2001 174:145-149[CrossRef][Medline]
  21. Luo CW, Kawamura K, Klein C, Hsueh AJ, Paracrine regulation of ovarian granulosa cell differentiation by stanniocalcin (STC) 1: mediation through specific STC1 receptors. Mol Endocrinol 2004 18:2085-2096[Abstract/Free Full Text]
  22. Chang AC-M, Cha J, Koentgen F, Reddel RR, The murine stanniocalcin 1 gene is not essential for growth and development. Mol Cell Biol 2005 25:10604-10610[Abstract/Free Full Text]
  23. Spencer TE, Bartol FF, Bazer FW, Johnson GA, Joyce MM, Identification and characterization of glycosylation-dependent cell adhesion molecule 1-like protein expression in the ovine uterus. Biol Reprod 1999 60:241-250[Abstract/Free Full Text]
  24. Kwon H, Spencer TE, Bazer FW, Wu G, Developmental changes of amino acids in ovine fetal fluids. Biol Reprod 2003 68:1813-1820[Abstract/Free Full Text]
  25. Johnson GA, Spencer TE, Burghardt RC, Taylor KM, Gray CA, Bazer FW, Progesterone modulation of osteopontin gene expression in the ovine uterus. Biol Reprod 2000 62:1315-1321[Abstract/Free Full Text]
  26. Van Heeke G, Ott TL, Strauss A, Ammaturo D, Bazer FW, High yield expression and secretion of the ovine pregnancy recognition hormone interferon-tau by Pichia pastoris. J Interferon Cytokine Res 1996 16:119-126[Medline]
  27. Spencer TE, Ing NH, Ott TL, Mayes JS, Becker WC, Watson GH, Mirando MA, Brazer FW, Intrauterine injection of ovine interferon-tau alters oestrogen receptor and oxytocin receptor expression in the endometrium of cyclic ewes. J Mol Endocrinol 1995 15:203-220[Abstract]
  28. Spencer TE, Gray A, Johnson GA, Taylor KM, Gertler A, Gootwine E, Ott TL, Bazer FW, Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol Reprod 1999 61:1409-1418[Abstract/Free Full Text]
  29. Sakal E, Bignon C, Grosclaude J, Kantor A, Shapira R, Leibovitch H, Helman D, Nespoulous C, Shamay A, Rowlinson SW, Djiane J, Gertler A, Large-scale preparation and characterization of recombinant ovine placental lactogen. J Endocrinol 1997 152:317-327[Abstract]
  30. Bazer FW, Roberts RM, Basha SM, Zavy MT, Caton D, Barron DH, Method for obtaining ovine uterine secretions from unilaterally pregnant ewes. J Anim Sci 1979 49:1522-1527[Abstract/Free Full Text]
  31. Choi Y, Johnson GA, Burghardt RC, Berghman LR, Joyce MM, Taylor KM, Stewart MD, Bazer FW, Spencer TE, Interferon regulatory factor-two restricts expression of interferon-stimulated genes to the endometrial stroma and glandular epithelium of the ovine uterus. Biol Reprod 2001 65:1038-1049[Abstract/Free Full Text]
  32. Spencer TE, Stagg AG, Ott TL, Johnson GA, Ramsey WS, Bazer FW, Differential effects of intrauterine and subcutaneous administration of recombinant ovine interferon tau on the endometrium of cyclic ewes. Biol Reprod 1999 61:464-470[Abstract/Free Full Text]
  33. Stewart DM, Johnson GA, Vyhlidal CA, Burghardt RC, Safe SH, Yu-Lee LY, Bazer FW, Spencer TE, Interferon-tau activates multiple signal transducer and activator of transcription proteins and has complex effects on interferon-responsive gene transcription in ovine endometrial epithelial cells. Endocrinology 2001 142:98-107[Abstract/Free Full Text]
  34. Wimsatt WA, Hew histological observations on the placenta of the sheep. Am J Anat 1950 87:391-436[CrossRef][Medline]
  35. Stewart MD, Johnson GA, Gray CA, Burghardt RC, Schuler LA, Joyce MM, Bazer FW, Spencer TE, Prolactin receptor and uterine milk protein expression in the ovine endometrium during the estrous cycle and pregnancy. Biol Reprod 2000 62:1779-1789[Abstract/Free Full Text]
  36. Moffatt RJ, Bazer FW, Roberts RM, Thatcher WW, Secretory function of the ovine uterus: effects of gestation and steroid replacement therapy. J Anim Sci 1987 65:1400-1410[Abstract/Free Full Text]
  37. Moffatt J, Bazer FW, Hansen PJ, Chun PW, Roberts RM, Purification, secretion and immunocytochemical localization of the uterine milk proteins, major progesterone-induced proteins in uterine secretions of the sheep. Biol Reprod 1987 36:419-430[Abstract]
  38. Noel S, Herman A, Johnson GA, Gray CA, Stewart MD, Bazer FW, Gertler A, Spencer TE, Ovine placental lactogen specifically binds to endometrial glands of the ovine uterus. Biol Reprod 2003 68:772-780[Abstract/Free Full Text]
  39. Spencer TE, Johnson GA, Bazer FW, Burghardt RC, Implantation mechanisms: insights from the sheep. Reproduction 2004 128:657-668[Abstract/Free Full Text]
  40. Chang AC, Reddel RR, Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol 1998 141:95-99[CrossRef][Medline]
  41. DiMattia GE, Varghese R, Wagner GF, Molecular cloning and characterization of stanniocalcin-related protein. Mol Cell Endocrinol 1998 146:137-140[CrossRef][Medline]
  42. Ing NH, Roberts RM, The major progesterone-modulated proteins secreted into the sheep uterus are members of the serpin superfamily of serine protease inhibitors. J Biol Chem 1989 264:3372-3379[Abstract/Free Full Text]
  43. Johnson GA, Burghardt RC, Spencer TE, Newton GR, Ott TL, Bazer FW, Ovine osteopontin: II. Osteopontin and alpha(v)beta(3) integrin expression in the uterus and conceptus during the periimplantation period. Biol Reprod 1999 61:892-899[Abstract/Free Full Text]
  44. Johnson GA, Burghardt RC, Joyce MM, Spencer TE, Bazer FW, Gray CA, Pfarrer C, Osteopontin is synthesized by uterine glands and a 45-kDa cleavage fragment is localized at the uterine-placental interface throughout ovine pregnancy. Biol Reprod 2003 69:92-98[Abstract/Free Full Text]
  45. Spencer TE, Bazer FW, Biology of progesterone action during pregnancy recognition and maintenance of pregnancy. Front Biosci 2002 7:d1879-d1898[Medline]
  46. Spencer TE, Johnson GA, Burghardt RC, Bazer FW, Progesterone and placental hormone actions on the uterus: insights from domestic animals. Biol Reprod 2004 71:2-10[Abstract/Free Full Text]
  47. Johnson GA, Spencer TE, Burghardt RC, Bazer FW, Ovine osteopontin: I. Cloning and expression of messenger ribonucleic acid in the uterus during the periimplantation period. Biol Reprod 1999 61:884-891[Abstract/Free Full Text]
  48. Spencer TE, Bazer FW, Temporal and spatial alterations in uterine estrogen receptor and progesterone receptor gene expression during the estrous cycle and early pregnancy in the ewe. Biol Reprod 1995 53:1527-1543[Abstract]
  49. Spencer TE, Bazer FW, Conceptus signals for establishment and maintenance of pregnancy. Reprod Biol Endocrinol 2004 2:49[CrossRef][Medline]
  50. Wooding FB, Current topic: the synepitheliochorial placenta of ruminants: binucleate cell fusions and hormone production. Placenta 1992 13:101-113[Medline]
  51. Kelly PA, Robertson HA, Friesen HG, Temporal pattern of placental lactogen and progesterone secretion in sheep. Nature 1974 248:435-437[CrossRef][Medline]
  52. Handwerger S, Crenshaw C, Jr. Maurer WF, Barrett J, Hurley TW, Golander A, Fellows RE, Studies on ovine placental lactogen secretion by homologous radioimmunoassay. J Endocrinol 1977 72:27-34[Abstract]
  53. Chan JS, Robertson HA, Friesen HG, Maternal and fetal concentrations of ovine placental lactogen measured by radioimmunoassay. Endocrinology 1978 102:1606-1613[Abstract]
  54. Stephenson DC, Leslie MV, Low BG, Newton GR, Hansen PJ, Bazer FW, Secretion of the major progesterone-induced proteins of the sheep uterus by caruncular and intercaruncular endometrium of the pregnant ewe from days 20–140 of gestation. Domest Anim Endocrinol 1989 6:349-362[CrossRef][Medline]
  55. Lacroix MC, Devinoy E, Cassy S, Servely JL, Vidaud M, Kann G, Expression of growth hormone and its receptor in the placental and feto-maternal environment during early pregnancy in sheep. Endocrinology 1999 140:5587-5597[Abstract/Free Full Text]
  56. Lacroix MC, Devinoy E, Servely JL, Puissant C, Kann G, Expression of the growth hormone gene in ovine placenta: detection and cellular localization of the protein. Endocrinology 1996 137:4886-4892[Abstract]
  57. Gertler A, Djiane J, Mechanism of ruminant placental lactogen action: molecular and in vivo studies. Mol Genet Metab 2002 75:189-201[CrossRef][Medline]
  58. Cassy S, Charlier M, Guillomot M, Pessemesse L, Djiane J, Cellular localization and evolution of prolactin receptor mRNA in ovine endometrium during pregnancy. FEBS Lett 1999 445:207-211[CrossRef][Medline]
  59. Martin C, Pessemesse L, de la Llosa-Hermier MP, Martal J, Djiane J, Charlier M, Interferon-tau upregulates prolactin receptor mRNA in the ovine endometrium during the peri-implantation period. Reproduction 2004 128:99-105[Abstract/Free Full Text]
  60. Bazer FW, Uterine protein secretions: Relationship to development of the conceptus. J Anim Sci 1975 41:1376-1382[Abstract/Free Full Text]
  61. Roberts RM, Bazer FW, The functions of uterine secretions. J Reprod Fertil 1988 82:875-892[Abstract]
  62. Bazer FW, Chen TT, Knight JW, Schlosnagle D, Baldwin NJ, Roberts RM, Presence of a progesterone-induced, uterine specific, acid phosphatase in allantoic fluid of gilts. J Anim Sci 1975 41:1112-1119[Abstract/Free Full Text]
  63. Jiang W, Chang A, Satoh M, Furuichi Y, Tam P, Reddel R, The distribution of stanniocalcin 1 protein in fetal mouse tissues suggests a role in bone and muscle development. J Endocrinol 2000 165:457-466[Abstract]
  64. Wooding FBP, Flint APF, Placentation. In: Lamming GE (ed.) Marshall's Physiology of Reproduction, 4th ed New York: Chapman and Hall 1994 233-460
  65. Grace ND, Watkinson JH, Martinson PL, Accumulation of minerals by the fetus and conceptus of single and twin bearing ewes. N Z J Agric Res 1986 29:207-222
  66. Care AD, Abbas SK, Pickard DW, Barri M, Drinkhill M, Findlay JB, White IR, Caple IW, Stimulation of ovine placental transport of calcium and magnesium by mid-molecule fragments of human parathyroid hormone-related protein. Exp Physiol 1990 75:605-608[Abstract]
  67. Morgan G, Wooding FB, Care AD, Jones GV, Genetic regulation of placental function: a quantitative in situ hybridization study of calcium binding protein (calbindin-D9k) and calcium ATPase mRNAs in sheep placenta. Placenta 1997 18:211-218[CrossRef][Medline]
  68. Wooding FB, Morgan G, Jones GV, Care AD, Calcium transport and the localisation of calbindin-D9k in the ruminant placenta during the second half of pregnancy. Cell Tissue Res 1996 285:477-489[CrossRef][Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
G. Song, M. C. Satterfield, J. Kim, F. W. Bazer, and T. E. Spencer
Gastrin-Releasing Peptide (GRP) in the Ovine Uterus: Regulation by Interferon Tau and Progesterone
Biol Reprod, August 1, 2008; 79(2): 376 - 386.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
T. E Spencer, O. Sandra, and E. Wolf
Genes involved in conceptus-endometrial interactions in ruminants: insights from reductionism and thoughts on holistic approaches
Reproduction, February 1, 2008; 135(2): 165 - 179.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. O. Burney, S. Talbi, A. E. Hamilton, K. C. Vo, M. Nyegaard, C. R. Nezhat, B. A. Lessey, and L. C. Giudice
Gene Expression Analysis of Endometrium Reveals Progesterone Resistance and Candidate Susceptibility Genes in Women with Endometriosis
Endocrinology, August 1, 2007; 148(8): 3814 - 3826.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
74/5/913    most recent
biolreprod.106.050807v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.
Agricola
Right arrow Articles by Song, G.
Right arrow Articles by Spencer, T. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS