| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Departments of Physiology3
Anatomy,4
Centre of Reproduction, Development, and Growth,5
and Centre of Heart, Brain, Hormone, and Healthy Aging,6 Faculty of Medicine, The University of Hong Kong, Hong Kong
ABSTRACT
Adrenomedullin (ADM) has been shown to be present in the human and rat male reproductive systems. This study demonstrates the expression of ADM in the rat testis and its effect on the secretion of testosterone. Whole testicular extracts had 5.43 ± 0.42 fmol of immunoreactive ADM per milligram of protein and 84 ± 8 fg of ADM mRNA per picogram of Actb (ß-actin) mRNA. Immunocytochemical studies showed positive ADM immunostaining in the Leydig cells and in the Sertoli cells. Gel filtration chromatography of testicular extracts showed two peaks, with the predominant one eluting at the position of the ADM precursor. Furthermore, the testis was shown to coexpress mRNAs encoding the calcitonin receptor-like receptor and receptor activity modifying protein 1 (Ramp1), Ramp2, and Ramp3. These account for the specific binding of ADM to the testis, which was partially inhibited by human ADM (22–52) and by human calcitonin gene-related peptide (8–37), the ADM and calcitonin gene-related peptide receptor antagonists, respectively. Administration of ADM to testicular blocks in vitro resulted in a dose-dependent inhibition of hCG-stimulated release of testosterone, which was abolished by the administration of ADM (22–52). Our results suggest a paracrine effect of ADM on testicular steroidogenesis.
aging, human chorionic gonadotropin, testis, testosterone
INTRODUCTION
Adrenomedullin (ADM) is a pluripotent peptide first isolated from pheochromocytoma, eliciting a long-lasting vasorelaxant activity [1]. Human ADM and rat ADM consist of 52 and 50 amino acids, respectively [2, 3]. ADM has a 6-amino acid ring formed by an intramolecular disulphide bond and a C-terminal amide and shares approximately 27% similarity with the calcitonin gene-related peptide CALCA [4]. ADM can indeed bind to the CALCA receptor in several types of tissues [5, 6]. However, specific ADM receptors that are insensitive to CALCA receptor antagonist CALCA (8–37) have been identified [7]. It is well established that the calcitonin receptor-like receptor CALCRL accounts for the majority of ADM and CALCA binding, and whether it binds to ADM or to CALCA depends on the type of receptor activity modifying protein (RAMP) that is expressed [8], namely, RAMP1, RAMP2, or RAMP3.
Immunoreactive ADM and Adm mRNA have been identified in various tissues in the human and in the rat, including the neuroendocrine, cardiovascular, digestive, and respiratory systems [2, 3, 9–13]. Recent studies have also shown the gene expression or peptide of Adm in reproductive organs such as the ovary [13, 14], uterus [13, 15], testis [12], prostate [16, 17], and epididymis [18]. In addition, ADM inhibits endothelin 1 (EDN1)-induced contraction of seminiferous tubules [19], in which ADM receptors are found in testicular peritubular myoid cells [20]. These findings suggest that ADM may play a role in the male reproductive system. However, the expression of ADM was not demonstrated in the testis [3, 13], and there are no reports of Calcrl or Ramp in the testis, to our knowledge. Therefore, we studied the ADM level and the gene expression of Adm, Calcrl, and Ramp and characterized the specific binding site for iodine 125 (125I)-labeled ADM by receptor binding assay and Scatchard plot analysis. To establish a physiological role of ADM in the testis, the effect of ADM on testosterone secretion in vitro was investigated.
MATERIALS AND METHODS
Animals
Male Sprague-Dawley rats (age, 12–13 wk) were obtained from the Laboratory Animal Unit of the Faculty of Medicine. All procedures were approved by the Committee on the Use of Live Animals for Teaching and Research of the Faculty of Medicine and were carried out in accord with the Guide for the Care and Use of Laboratory Animals (National Academy of Science).
Extraction of ADM From the Testis
Whole testis of eight rats was homogenized in 2 N acetic acid for ADM immunoreactivity, followed by boiling for 10 min. A 50-µl aliquot was taken for protein assay, and the remaining homogenates were centrifuged at 18 600 x g for 20 min at 4°C (Beckman AJ-21, Fullerton, CA). The supernatants were lyophilized and stored at –20°C until assay.
Radioimmunoassay
The lyophilized tissue sample was reconstituted in RIA buffer (0.1% sodium phosphate [pH 7.4]), 0.1% heat-inactivated BSA, 0.05 M sodium chloride, 0.01% sodium azide, and 0.1% Triton X-100) for the determination of immunoreactive ADM concentration [9]. Rat ADM and ADM antiserum were purchased from Peninsula (Belmont, CA). The 125I-labeled ADM was from Phoenix (Belmont, CA). The sensitivity for the assay was 5 pg per tube. The intraassay and interassay coefficients of variation were 7% and 10%, respectively.
Protein Measurement
Fifty-microliter aliquots of tissue homogenate or standard (BSA) were boiled with 1 N NaOH for 10 min, and 50 µl of the boiled sample was mixed with 2.5 ml of protein assay reagent (BioRad, Hercules, CA). After 10 min of incubation at room temperature, the samples were measured spectrophotometrically at 595 nm (LKB Ultraspec II; Biochrom, Berlin, Germany). The immunoreactive ADM was expressed as femtomoles per milligram of protein.
Gel Filtration Chromatography
The lyophilized sample was reconstituted in distilled water, and the supernatant obtained after centrifugation at 18 600 x g for 20 min at 4°C was acidified with 96% glacial acetic acid to give a final concentration of 1 N acetic acid. The sample was chromatographed on a Biogel P30 (BioRad) column (0.9 x 60 cm), which was eluted with 1 N acetic acid at a flow rate of 1 ml per 10 min for 400 min. These 1-ml fractions were assayed for ADM immunoreactivities. The column was calibrated with authentic ADM, with blue dextran for void-volume determination, and with proteins from the gel filtration kit, carbonic anhydrase, cytochrome c, and vitamin B12 as molecular-weight markers.
Immunocytochemistry
To localize ADM in the testis, an avidin-biotin histochemical staining procedure using Vectastain ABC kit (Vector Laboratories, Burlingame, CA) was used. The rat was perfused via a cannula inserted into the heart with PBS and then with a fixative of PBS containing 4% paraformaldehyde. The whole testis was removed, postfixed overnight, and then transferred for 1 day each to 15% and 30% sucrose solutions. The tissue samples were embedded in paraffin, and 10-µm sections were cut on a microtome. The sections were treated for 60 min with 10% methanol and 3% hydrogen peroxide and then incubated with the primary antibody (1:2000) for ADM at 4°C overnight. The avidin-biotin-peroxidase complex in the sections was visualized with diaminobenzidine for 5 to 10 min.
Receptor Binding Assays
Membranes were prepared by differential centrifugation as described previously [21]. Whole testis was homogenized in ice-cold, 50 mM Hepes (pH 7.6), comprising 0.25 M sucrose, 10 µg/ml of pepstatin, 0.25 µg/ml each of leupeptin and antipain, 0.1 mg/ml each of benzamidine and bacitracin, and 30 µg/ml of aprotinin. The homogenates were centrifuged at 1500 x g for 20 min at 4°C, and the supernatants were centrifuged at 100 000 x g for 1 h at 4°C. The pellets were resuspended in 10 volumes of the already described buffer without sucrose and were centrifuged at 100 000 x g for 1 h at 4°C. The final pellets were resuspended, aliquoted, and stored at –70°C until assay. Testicular membranes (equivalent to 50 µg of protein) were incubated at 4°C for 30 min with 125I-labeled ADM (10–300 pM) in 0.3 ml of binding buffer (20 mM Hepes [pH 7.4], 5 mM MgCl2, 10 mM NaCl, 4 mM KCl, 1 mM EDTA, 1 µM phosphoramidon, 0.25 mg/ml of bacitracin, and 0.3% BSA. After incubation, membranes were filtered through a Brandel cell harvester (Biomedical Research and Development Laboratories, Gaithersburg, MD) using GF/B filter paper (Whatman, Clifton, NJ) that had been soaked overnight in 0.3% polyethylenimine and washed three times with 3 ml of ice-cold 50 mM Tris-HCl (pH 7.4). Radioactivity retained by the filters was counted using a gamma counter (Cobra II; Packard, Shelton, CT) at 75% efficiency. Specific binding was defined as total binding minus nonspecific binding, which was determined in the presence of 500 nM unlabeled rat ADM. The ratio of specifically bound to free radioligand concentration was plotted against specific binding (Scatchard plot), in which the Kd and Bmax values were obtained.
In addition, studies regarding the displacement of 125I-labeled ADM binding by human CALCA (8–37) (a CALCA receptor antagonist) and human ADM (22–52) (an ADM-receptor antagonist) were carried out. Specific binding is defined herein as the difference in binding in the presence and in the absence of the competitive ligand. All binding assays were carried out in duplicate.
Solution Hybridization Ribonuclease Protection Assay of Adm mRNA
Total RNA was prepared from freshly dissected tissue using Trizol reagent (Life Technologies, Carlsbad, CA) [18]. The details of the solution hybridization assay have been reported [9]. Plasmids containing cDNA for Adm (613 base pair [bp] in length) and Actb (ß-actin) (387 bp in length) were gifts from Dr. Dominic J. Autelitano (Cryptome Research Pty. Ltd., Melbourne, Australia). Standard or samples were hybridized with the phosphorus 32-labeled riboprobes, and after digestion with ribonuclease (RNase), the RNA hybrids were separated by polyacrylamide gel electrophoresis. After drying, the gel was exposed to an x-ray film that was used as a template to cut out the hybrid bands for the radioactivity counting by means of a liquid scintillation counter (Beckman LS 6500). The testicular Adm mRNA content was expressed as femtograms of mRNA per picograms of Actb mRNA.
RT-PCR of Adm, Calcrl, and Ramp
Total testicular RNA of eight rats was prepared using Trizol reagent [18] and subjected to RT-PCR [22]. RNA samples (5 µg) were reverse transcribed into cDNA with the SuperScript II reverse transcriptase according to the manufacturer's instructions (Life Technologies). The mRNA levels of Adm, Calcrl, Ramp, or TATA box-binding protein (Tbp) were then measured by PCR using HotStarTaq DNA polymerase (Qiagen, Valencia, CA) with the corresponding forward and reverse primers. The primers were designed on the basis of the sequences for Adm (forward, TTCAGCAGGGTATCGGAGC; reverse, CCGACTGTTCAATGCTGCC), Tbp (forward, ACCCTTCACCAATGACTCCTATG; reverse, ATGATGACTGCAGCAAATCGC), Calcrl (forward, CCAAACAGACTTGGGAGTCACTAGG; reverse, GCTGTCTTCTCTTTCTCATGCGTGC), Ramp1 (forward, CACTCACTGCACCAAACTCGTG; reverse, CAGTCATGAGCAGTGTGACCGTAA), Ramp2 (forward, AGGTATTACAGCAACCTGCGGT; reverse, ACATCCTCTGGGGGATCGGAGA), and Ramp3 (forward, ACCTGTCGGAGTTCATCGTG; reverse, ACTTCATCCGGGGGGTCTTC). The PCR conditions for Adm and Tbp were 94°C for 15 min and cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min (31 cycles for Adm; 28 cycles for Tbp). The PCR conditions for Calcrl and Ramp were 94°C for 15 min, followed by cycles of 94°C for 30 sec, 60°C for 30 sec, and 72°C for 90 sec (30 cycles for Calcrl and Ramp2, 26 cycles for Ramp1, and 34 cycles for Ramp3). The PCR products were analyzed on a 1.5% agarose gel with 0.5 µg/ml of ethidium bromide using gel documentation and analysis software (GeneGenius; Syngene Co., Cambridge, England). The mRNA expression level of the test gene was expressed in arbitrary units after normalizing the band intensity with that of the corresponding Tbp internal control.
In Vitro Testicular Block Experiments
The rats were injected with pentobarbital intraperitoneally (0.1 ml per 100 g of body weight). Each testis was decapsulated and cut into 4 pieces of approximately equal size. Testicular blocks (two blocks per tube) were incubated in 2 ml of Dulbecco modified Eagle medium F12 (1:1, Life Technologies) supplemented with 0.1 g/l of gentamicin (Life Technologies) in a Dubnoff shaker (60 cycles per minute) at 34°C under an atmosphere of 5% CO2-95% O2 for 1 h. The media were then replaced by fresh medium, medium with hCG (0.5 IU/ml; Sigma, St. Louis, MO), ADM (10–9 to 10–7 M), and hCG (0.5 IU/ml) plus ADM (10–9 to 10–7 M) or hCG (0.5 IU/ml) plus ADM (10–9 to 10–7 M) plus ADM (22–52) (10–7 M) (Phoenix), in which the media were primed for 30 min with ADM (22–52). After 90-min incubation, the media were centrifuged at 600 x g for 10 min. The supernatants were collected and stored at –20°C until analyzed for testosterone by enzyme immunoassay (EIA).
Testosterone Measurement by EIA
Testosterone was measured according to the manufacturer's instructions with a testosterone immunoassay kit (Diagnostic Systems Laboratories Inc., Webster, TX). The levels of testosterone in the media were expressed as percentage changes from the basal value.
Statistical Analysis
All data are expressed as mean ± SEM, and statistical significance was assessed by one-way ANOVA followed by Student-Newman-Keuls method test for post hoc comparisons, with P < 0.05 taken as significant.
RESULTS
ADM Immunoreactivity and mRNA Expression of Adm, Calcrl, and Ramp
The level of ADM in the rat testis was found to be 5.43 ± 0.42 fmol per milligram of protein. The Adm mRNA level was 84 ± 8 fg per picogram of Actb mRNA by solution hybridization RNase protection assay. An x-ray recording of the hybrids on a polyacrylamide gel is shown in Figure 1. The mRNA levels of Adm, Calcrl, and Ramp relative to Tbp were 96.82 ± 4.50, 47.07 ± 2.2, 49.65 ± 4.21 (Ramp1), 52.95 ± 4.47 (Ramp2), and 28.86 ± 2.01 (Ramp3), respectively. Figure 2 is a photograph of the gel showing the sizes of the PCR products.
|
|
Gel Filtration Chromatographic Analysis of Testicular ADM and Immunohistochemical Study
Two immunoreactive ADM peaks were seen on the gel filtration chromatogram (Fig. 3), with a predominant peak of rat ADM precursor and a smaller peak of authentic rat ADM (1–50). As shown in Figure 4, the positive immunostaining of ADM was localized in the Leydig cells and in the Sertoli cells.
|
|
ADM Receptor Binding Sites
The Scatchard plot of ADM (Fig. 5A) showed that the Kd and Bmax for ADM binding were 162.57 ± 7.09 pM and 21.32 ± 0.21 fmol per milligram of protein, respectively. The binding of 125I-labeled rat ADM (1–50) was displaced by unlabeled rat ADM (1–50) (50% inhibiting concentration [IC50] = 2.52 x 10–10 M), human ADM (22–52) (IC50 = 1.22 x 10–9 M), human CALCA receptor antagonist CALCA (8–37) (IC50 = 1.61 x 10–8 M). The 125I-labeled ADM competition curve is depicted in Figure 5B.
|
Effect of ADM on Testosterone Release In Vitro
ADM ranging from 10–9 to 10–7 M caused a dose-dependent inhibition of the hCG-stimulated release of testosterone, with no effect on the basal testosterone secretion (Fig. 6). The hCG effect was completely abolished at 10–7 M ADM, which was the highest dose used as there was no significant difference between the 10–7 M ADM groups with or without hCG. This inhibitory effect of ADM was completely blocked by the administration of 10–7 M ADM receptor antagonist human ADM (22–52).
|
DISCUSSION
In the present study, the ADM system in the rat testis was thoroughly examined. The peptide levels and the mRNA levels of Adm, Calcrl, and Ramp were measured by RIA and by semiquantitative RT-PCR, respectively. The tissue distribution was found by immunocytochemistry to be in the Leydig cells and in the Sertoli cells. Gel filtration chromatography was used to study the molecular species of ADM and the ADM:precursor ratio. In addition, ADM receptors on the rat testis were characterized by receptor binding study.
We confirmed the presence of Adm mRNA by solution hybridization RNase protection assay and by RT-PCR. Previously, Adm mRNA was undetected by Northern blot [3] or by in situ hybridization [13], probably because of the sensitivity of the methods used. This explanation is supported by the finding of Romano et al. [23], who reported Adm mRNA in the Sertoli cells but not in the testis sample.
The level of immunoreactive ADM in the testis is approximately 50-fold lower than that in the adrenal gland (5.4 ± 0.4 vs. 263.0 ± 33.7 fmol per milligram of protein) [10] and 7 times lower than that in the epididymis (35 ± 1 fmol per milligram of protein) [18], although the Adm mRNA levels in these tissues are similar (84 ± 8 [testis] vs. 92 ± 6 and 100 ± 20 fg of Adm mRNA per pictogram of Actb mRNA in the adrenal gland and epididymis, respectively) [10, 18]. This discrepancy between the peptide contents and mRNA levels suggests that ADM may be actively secreted by the testis, as has been suggested for other tissues [10, 18]. Gel filtration study illustrated that the major peak in the testis is the precursor. A ratio of the biologically active form to the precursor of much less than 1 suggests that ADM may be actively secreted, similar to the corpus region of the epididymis [18].
Specific binding sites for ADM are found in the rat testis based on results of the receptor binding study. The binding affinity is higher and the maximum binding (number of receptors) is lower than in the epididymis [18]. The displacement studies show that at least some of these ADM binding sites can also bind CALCA, although CALCA (8–37) was about 1 order of magnitude less potent than ADM (22–52) in displacing 125I-labeled ADM (Fig. 5B). This indicates that the testis has more ADM than CALCA receptors. The presence of specific ADM receptors has been documented in testicular peritubular myoid cells [20], in which CALCA displaced the binding of 125I-labeled ADM, although less effectively than ADM.
The presence of specific binding sites is further supported by data from the semiquantitative RT-PCR, which demonstrated the expression of Calcrl and Ramp (Fig. 2). McLatchie et al. [8] showed that CALCRL can function as a CALCA receptor or as an ADM receptor depending on the coexpression of one or more types of RAMP. RAMP1 coupled with CALCRL gives rise to a CALCA receptor, while a combination of RAMP2 or RAMP3 results in an ADM receptor [8, 24]. The specificity of CALCRL to CALCA or ADM is therefore modulated by the types of RAMP being expressed at the plasma membrane [24, 25]. Our results revealed that Ramp1, Ramp2, and Ramp3 are expressed in the testis, suggesting that ADM and CALCA receptors are present in this organ. Recent findings indicate the presence of mRNA of Adm receptor in peritubular myoid cells and in Leydig cells [23].
ADM was localized in the Leydig cells and in the Sertoli cells in the present study. Furthermore, in experiments with isolated rat Leydig cells and Sertoli cells in culture, Adm, Calcrl, and Ramp mRNAs were found in these cells, and ADM peptide was detected in the cells and in the culture medium (Tang, unpublished data). Previous evidence demonstrated that ADM is identified not only in the Leydig cells but also in the germ cells and peritubular myoid cells in the human testis [26], suggesting a role for ADM in the paracrine regulation of testicular function. The discrepancy of the cell types expressing ADM may be due to species differences. ADM may be one of the local factors controlling the contraction of seminiferous tubules as ADM is able to antagonize EDN1-induced contraction of testicular peritubular myoid cells [19]. In the present study, we found that ADM may regulate steroidogenesis as ADM significantly reduced hCG-stimulated testosterone release by acting on its specific receptors, an inhibitory effect that was abolished by ADM (22–52). The Leydig cells, and probably the Sertoli cells, are the source of this ADM in the testis.
It is well established that hCG stimulates testosterone secretion in vivo [27] and in vitro [28] via cAMP-mediated signaling pathways [29]. In the present study, we found that the stimulatory effect of hCG on testosterone production in vitro was diminished by ADM. It has been reported that CALCA inhibits testosterone secretion through a mechanism involving an increase in cAMP production [30]. Therefore, it is possible that ADM may also elicit its inhibitory effect of testosterone release through an induction of cAMP production. The cAMP produced in response to ADM may act through protein kinase A to block the Ras pathway and subsequently inhibit the release of testosterone [31]. Further investigation is required to verify this hypothesis.
In summary, ADM inhibits testosterone secretion by acting on its specific receptor. Together with the presence of ADM and the mRNAs of Adm, Calcrl, and Ramp, this suggests that ADM may act in a paracrine or an autocrine fashion in regulating steroidogenesis.
FOOTNOTES
1 Supported by grant HKU 7451/04M from the Research Grants Council of Hong Kong. 
2 Correspondence: Fai Tang, Department of Physiology and Centre of Heart, Brain, Hormone and Healthy Aging, Faculty of Medicine, The University of Hong Kong, 21 Sassoon Road, Pokfulam, Hong Kong. FAX: 852 2 855 9730; ftang{at}hkucc.hku.hk
Received: 8 March 2006.
First decision: 22 March 2006.
Accepted: 27 April 2006.
REFERENCES
This article has been cited by other articles:
|
|
 |
|
  Y.-Y. Li, L. Li, I. S.-S. Hwang, F. Tang, and W.-S. O Coexpression of Adrenomedullin and Its Receptors in the Reproductive System of the Rat: Effects on Steroid Secretion in Rat Ovary Biol Reprod, August 1, 2008; 79(2): 200 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-F. Chan, F. Tang, and W.-S. O Adrenomedullin in the Rat Testis. II: Its Production, Actions on Inhibin Secretion, Regulation by Follicle-Stimulating Hormone, and Its Interaction with Endothelin 1 in the Sertoli Cell Biol Reprod, April 1, 2008; 78(4): 780 - 785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-F. Chan, W.-S. O, and F. Tang Adrenomedullin in the Rat Testis. I: Its Production, Actions on Testosterone Secretion, Regulation by Human Chorionic Gonadotropin, and Its Interaction with Endothelin 1 in the Leydig Cell Biol Reprod, April 1, 2008; 78(4): 773 - 779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-Y. Li, W.-S. O, and F. Tang Effect of Aging on the Expression of Adrenomedullin and Its Receptor Component Proteins in the Male Reproductive System of the Rat J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2007; 62(12): 1346 - 1351. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
X174 DNA/Bsu RI marker
P < 0.01;