| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Division of Animal Science,4
National Swine Resource and Research Center,5
Office of Animal Resources,6 Department of Veterinary Pathobiology,7
Department of Veterinary Biomedical Sciences,8 University of Missouri–Columbia, Columbia, Missouri 65211
Department of Epidemiology,9 GSPH, University of Pittsburgh, Pittsburgh, Pennsylvania 15261
Department of Medicine,10 Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114
Thomas Starzl Transplantation Institute,11 Department of Surgery, University of Pittsburgh, Pittsburgh, Pennsylvania 15261
ABSTRACT
Ithas been notoriously difficult to successfully cryopreserve swine embryos, a task that has been even more difficult for in vitro-produced embryos. The first reproducible method of cryopreserving in vivo-produced swine embryos was after centrifugation and removal of the lipids. Here we report the adaptation of a similar process that permits the cryopreservation of in vitro-produced somatic cell nuclear transfer (SCNT) swine embryos. These embryos develop to the blastocyst stage and survive cryopreservation. Transfer of 163 cryopreserved SCNT embryos to two surrogates produced 10 piglets. Application of this technique may permit national and international movement of cloned transgenic swine embryos, storage until a suitable surrogate is available, or the long-term frozen storage of valuable genetics.
assisted reproductive technology, early development
INTRODUCTION
It has been difficult to successfully cryopreserve swine embryos, as they are sensitive to chilling and conventional methods of freezing [1, 2]. Nagashima et al. [3] were the first to show that this sensitivity may be due to the high intracellular lipid content of the swine embryo. Freeze-thaw tolerance could be conferred if the embryos were centrifuged and the lipids removed with a micropipette. More recently, several groups [4–6] have had success cryopreserving in vivo-derived swine embryos. In the final of a series of experiments that polarized the lipids prior to vitrification, 60%–90% postwarming survival was noted, but they obtained only 17.7% (36/203) survival of the embryos when transferred to surrogates [7]. By using a microdroplet method of vitrification without prior lipid polarization, Misumi et al. [6] reported that 9.9% (17/171) of the vitrified embryos produced healthy offspring. A third group produced 13% offspring based on the number of embryos vitrified [8]. In addition to the difficulties with cryopreservation of in vivo-produced swine embryos, cryopreservation of in vitro-produced cattle embryos has also been more difficult than cryopreservation of in vivo-produced embryos [9]. Although there are no reports of successful cryopreservation of in vitro-produced swine embryos, because of the difficulties encountered with in vitro-produced cattle embryos, in vitro-produced swine embryos were expected to be even more difficult to successfully cryopreserve than in vivo-produced swine embryos.
The ability to successfully cryopreserve swine embryos will facilitate the long-term storage of valuable genetics as well as the national and international movement of embryos. Cryopreservation of cloned transgenic embryos will, in addition, permit accumulation of a suitable number of embryos for embryo transfer. Currently large numbers of cloned embryos are transferred to surrogates to obtain offspring [10–12]. If a surrogate at the correct stage of the estrous cycle is not available, then the cloned embryos go to waste. Swine are becoming an important biomedical model of the human condition [13, 14]. Thus, it is important to define conditions that will permit the successful cryopreservation of their embryos for both scientific and commercial purposes. Here we present one method whereby we polarize and remove the lipids in the oocyte prior to somatic cell nuclear transfer (SCNT) using a transgenic (hfat-1; it should be noted that since a similar gene does not exist in mammals, we will use the C. elegans nomenclature) donor cell to serve as a genetic marker. These embryos are cultured to the blastocyst stage and vitrified prior to embryo transfer.
MATERIALS AND METHODS
Animal use has been reviewed and approved by the local ACUC as well as the IBC. Offspring of the animals that contain hfat-1 may be used only for noncommercial purposes and will be distributed via the National Swine Resource and Research Center.
Chemicals
All chemicals were purchased from Sigma (St. Louis, MO) unless otherwise indicated.
Preparation of Donor Cells
Fibroblasts were derived from the muscle of a pig that contained the hfat-1 gene [15] as previously described [16]. The cells were thawed at 37°C and cultured overnight in Dulbecco modified Eagle medium with 15% fetal calf serum (FCS).
Lipid Removal and Nuclear Transfer
Sow-derived oocytes were purchased from BioMed, Inc. (Madison, WI), and shipped overnight in their commercial maturation medium #1. Twenty-four hours after being placed in the maturation medium #1, the oocytes were moved to medium #2. After a total of 44 h of maturation, the cumulus cells were removed from the oocytes by vortexing for 4 min in TL-Hepes supplemented with 0.1% PVA and 0.1% hyaluronidase [16]. Oocytes were denuded, and the first polar body and adjacent cytoplasm were aspirated while in manipulation medium (25 mM Hepes-buffered TCM199 with 3 mg/ml BSA and 7.5 µg/ml cytochalasin B) with a glass pipette 25 µm in diameter. The oocytes were then centrifuged (5 min at 9300 x g) in manipulation medium to polarize the lipid droplets. This was followed by removing the polarized lipid droplets and transfer of a donor fibroblast cell into the perivitelline space with the same pipette that had been used for removal of the polar body and underlying cytoplasm. The lipid clump was removed as completely as possible [17]. Fusion/activation was accomplished with 2 DC pulses (1-sec interval) of 1.2 kV/cm for 30 µsec provided by a BTX Electro-cell Manipulator 200 (BTX, San Diego, CA). The medium used for fusion and activation consisted of 0.3 M mannitol, 1.0 mM CaCl2, 0.1 mM MgCl2, and 0.5 mM Hepes [11]. Normal nuclear transfer embryos derived from oocytes that were not centrifuged or subjected to lipid removal served as controls. After fusion/activation, the embryos were cultured in PZM-3 medium supplemented with 4 mg/ml BSA [18].
Vitrification and Embryo Transfer
Vitrification of embryos was carried out by using the open pulled straw (OPS) method [19, 20]. The OPS straws were purchased from LEC Instruments P/L. All solutions used during vitrification were prepared with holding medium (25 mM Hepes-buffered TCM199 containing 20% FCS). Day 5 and Day 6 blastocysts (manipulation was considered Day 0) were placed in equilibration solution (10% ethylene glycol, 10% dimethyl sulfoxide [DMSO]) for 2 min, followed by exposure to vitrification solution (20% ethylene glycol, 20% DMSO). Embryos were loaded into an OPS straw and immediately plunged into liquid nitrogen. The time from exposure to the vitrification solution to plunging was 25–30 sec.
Embryos were warmed by immersing the end of the OPS straw into 0.3 M sucrose for 5 min at 38.5°C, then transferring them to 0.2 M sucrose for 5 min, and then holding medium for 5 min. After rehydration some embryos were cultured in PZM-3, as described previously, for 12 h to determine the percentage of embryos that had reexpanded and to determine the number of nuclei in each embryo (4 µg/ml Hoechst 33342 was used to stain the nuclei, which were examined by epifluorescent microscopy). Most embryos were surgically transferred into the ampullary-isthmic junction of the oviduct of a surrogate 4 days after observed estrus. Gestation was monitored weekly via ultrasound.
Fatty Acid Analysis
Lipids were extracted from the tissue of offspring according to the general technique of Bligh and Dyer [21]. Briefly, the samples are homogenized in 4 ml of methanol, 2 ml of chloroform, and 1.5 ml of water. After 15 min, 2 ml of chloroform and 2 ml of water were added and the samples vortexed. Then the tubes were centrifuged at 1200 x g for 30 min at 16°C, and the upper phase was discarded. The lower phase was dried under nitrogen and resuspended in 1.5 ml 14% boron trifluoride methanol. The samples were heated at 90°C for 30 min and after cooling extracted with 4.0 ml pentane and 1.5 ml water. The mixtures were vortexed, and the organic (upper) phase was recovered [22]. The extracts were dried under nitrogen and resuspended in 50 µl heptane, and 2 µl were injected into a capillary column (SP-2380, 105 m x 53 mm inner diameter, 0.20 µm film thickness). The gas chromatograph was a Perkin Elmer Clarus 500 equipped with a flame ionization detector, an autosampler, and an HP Pentium 4 with a data handling system. The oven temperatures were 140°C for 35 min, 8°C/min to 220°C, hold for 12 min. Injector and detector temperatures were both at 260°C, and helium, the carrier gas, was at 15 psi. Identification of components was by comparison of retention time with those of authentic standards (Sigma, St. Louis, MO).
PCR Analysis of Genomic DNA
Tail tissue (100 mg) was placed in 300 µl of lysis buffer (50 mM Tris pH 8.0, 0.15 M NaCl, 0.01 M EDTA, 1% SDS, 25% sodium perchlorate, and 1% of ß-mercaptoethanol and proteinase K) and incubated at 50°C for 30 min. The samples were crushed by using a microcentrifuge pestle and extracted once with 300 µl of phenol:chloroform and once with 300 µl of chloroform and precipitated with isopropanol. The pig genomic DNA was washed once by 70% ethanol, air-dried, and resuspended in 100 µl of TE. A 626-bp PCR product of hfat-1 gene was detected by primers FAT24-F 5'GTGTGGATACAGGATAAGGATTGG 3' and FAT24-R 5' CTTGTGAACGA GATAGTCGAGCTT 3' in Platinum PCR Supermix High Fidelity system (Invitrogen).
Statistical Analysis
The cleavage and blastocyst percentages were compared by using the chi-square test. The Student t-test was used to compare the number of nuclei in the different groups of embryos. The t-test and Mann-Whitney test were used for analysis of n-3 and n-6 fatty acids results.
RESULTS
Donor Cells and Nuclear Transfer
To begin to develop a technique for the successful cryopreservation of in vitro-produced SCNT swine embryos, we started with muscle-derived fibroblast cells from a male transgenic piglet containing the hfat-1 gene [15] and sow-derived in vitro-matured oocytes. Cumulus cells were removed by vortexing, and chromosomes were removed from denuded oocytes [16] (Fig. 1, a and b) and oocytes were centrifuged (5 min at 9300 x g) in manipulation medium to polarize the lipid droplets. This was followed by removing the lipid droplets with a micropipette and transferring a donor cell into the perivitelline space (Fig. 1, c–e). In preliminary trials (data not shown), we tried to centrifuge the oocyte first and then remove the lipids by using the same hole in the zona pellucida. Unfortunately, the relative position of the polar body and the metaphase spindle can change after centrifugation, and the chromosomes are not always in a location from which they can be removed with the stratified lipids. So we chose to remove the chromosomes from the oocyte, centrifuge the oocyte, and then remove the lipids. Controls for this experiment were oocytes that were not subjected to the lipid removal. Surprisingly, we found that a higher percentage of the delipidized SCNT embryos cleaved (Table 1) and developed to the blastocyst stage as compared to the control SCNT embryos. The delipidized embryos were more translucent than the control embryos, and it was easy to distinguish between the two types of embryos when they were placed in the same culture droplet (Fig. 1, g and h).
|
|
Vitrification and Embryo Transfer
Since the lipid removal did not adversely affect the development of the SCNT embryos, control and delipidized SCNT embryos were subjected to vitrification. Vitrification was carried out by using the OPS method [19, 20]. Day 5 and 6 blastocysts were vitrified and warmed as described previously and were subsequently cultured (Fig. 1h). The blastoceole cavity collapsed after vitrification, and the percentage of embryos where the blastoceole cavity reexpanded after 12 h was higher for the delipidized embryos (14/21, 66.7% versus 9/42, 21.9%, chi-square P < 0.01) than for the control group, but the number of nuclei per blastocyst was not different (31.2 ± 7.7 versus 33.6 ± 14.1, respectively).
Since the in vitro-produced delipidized SCNT embryos appeared to survive the vitrification, we first transferred 40, 41, and 51 embryos to the uterus of three gilts 4 days after estrus. None established a pregnancy. Next we transferred 82 and 81 vitrified embryos to the oviducts of two surrogate gilts 4 days after estrus. Two litters were derived: one by cesarean section on Day 116 (two piglets, litter #66) and one by natural delivery on Day 115 (eight piglets, litter #67; Fig. 1i).
All 10 piglets were males and alive, and PCR confirmed that they carried the hfat-1 gene construct (Fig. 2). The average birth weight was 1.210 kg. To confirm that these pigs also expressed the hfat-1 gene similar to their founder (#4), tail samples were subjected to analysis for n-6 and n-3 fatty acids [15]. The ratio of n-6 to n-3 fatty acids in the tails of the cloned pigs was 1.65 ± 0.27 versus 8.13 ± 0.65 in eight age-matched controls (see Supplemental Table 1, available online at http://www.biolreprod.org). The ratio of n-6 to n-3 fatty acids in the other tissues of the pigs that died or were killed also shows a high content of n-3 fatty acids (Table 2).
|
|
DISCUSSION
Application of numerous biotechnologies has lagged in swine because of unique properties that make in vitro maturation, fertilization, and embryo culture more challenging [23]. While it took a few years to obtain somatic cell clones [24], a number of groups have since made transgenic swine via SCNT [10] as well as heterozygous [11, 12] and homozygous knockouts [25, 26]. However, one procedure that was still necessary for the widespread dissemination of swine embryos, and hence genetics, was that of cryopreservation.
Development of cryopreservation techniques for swine also lagged behind many species because of the thermosensitivity of the swine embryo. The first breakthrough came with the removal of the lipids via micromanipulation [3]. While the technique is somewhat cumbersome, it does result in live offspring. Indeed, while we would have been pleased with an equal percentage of development as compared to controls, we found that a higher percentage of SCNT embryos developed to the blastocyst stage if the lipids were removed. The functional importance of lipids in the early swine embryo is not known. A pig oocyte typically contains 156 ng lipid [27] as compared to the sheep (89 ng) [28] and the cow (58 ng) [29]. The lipid droplets are abundant in one- to eight-cell stage swine embryos but decline markedly at the perihatching stage [30]. Interestingly, it is at this stage that the embryos become more tolerant to conventional freezing techniques [3]. Prior to our current report, such success has been reported only in vivo-derived embryos.
Here we reported the production of piglets from the transfer of 
81 embryos to the oviduct of the surrogates. We also transferred 40–51 embryos to the uterus of three other surrogates and did not establish a pregnancy. It is difficult to draw any conclusions from the result, as there are two confounding factors: both the number of embryos transferred and the location of the transfer. Since these embryos are at the blastocyst stage, we had assumed that they would be most likely to establish a pregnancy if transferred to the uterus, but this was not the case. It may be that the oviduct transfer is a less traumatic procedure than a uterine transfer or that more than 50 SCNT embryos are needed to establish a pregnancy. Additional experiments will be required to sort out these confounding factors.
The founder pig (#4) for these studies had an atrial septal defect that resulted in its death at 3 weeks of age [15]. Interestingly, the clones were evaluated by ultrasound or at necropsy, and only one of the 10 clones had this same phenotype. This represents another example of how abnormal phenotypes in clones are not necessarily passed on to the next generation [26, 31, 32]. Two of the clones from #4's cohort (clones in the sense that they were produced by nuclear transfer and have the same base genetics but potentially different sites of integration of the hfat-1 gene) had a connective tissue abnormality that appeared to be osteochondrodystrophy. Interestingly, while #4 did not exhibit this phenotype, two of the animals cloned from #4 had osteochondrodystrophy.
Since cryopreservation of in vitro-produced porcine embryos is more difficult than in vivo-produced embryos, we expected that it would be even more difficult to successfully cryopreserve in vitro-produced SCNT blastocyst stage embryos. However, the procedure that we report here appears to work quite well. The ability to use in vitro-matured oocytes greatly reduces the time, effort, and cost of obtaining oocytes as compared to in vivo-matured oocytes. It should be noted that this is an initial report and that further studies will be needed to clearly demonstrate the utility of these procedures as compared to other less labor-intensive procedures. Nevertheless, because of the success of this procedure, we anticipate that it will become commonplace to produce cryopreserved transgenic SCNT embryos for widespread distribution.
ACKNOWLEDGMENTS
The authors would also like to acknowledge the technical support from Angela van Dyke, Lonnie Dowell, and Sarah R. Dellinger and the untiring efforts of the baby pig feeding crew: Lee Spate, Kristin Whitworth, Lacey Griesbaum, Aaron Bonk, Eric Walters, Hongsheng Men, Trista Strauch, Emily Fergason, Jin-Geol Kim, Hawn Yul Yong, and Courtney McHughes.
FOOTNOTES
1 Supported by the National Center for Research Resources (RR18877, R.S.P.) and other Institutes at the NIH via the University of Iowa (HL51670, R.S.P.) and directly to Pittsburgh (DK64207, Y.D.), an unrestricted gift to the Thomas E. Starzl Transplantation Institute from the Robert E. Eberly Program for Transplant Innovation (Y.D.), a Missouri Life Sciences Fellowship (S.K.), and Food for the 21st Century (R.S.P.). 
2 Correspondence: Randall S. Prather, 920 East Campus Dr., E125E ASRC, University of Missouri, Columbia, MO 65211. FAX: 573 884 7827; pratherr{at}missouri.edu
3 These authors contributed equally to this work.
Received: 28 March 2006.
First decision: 13 April 2006.
Accepted: 20 April 2006.
REFERENCES
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
