Biol Reprod Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


BOR - Papers in Press, published online ahead of print July 19, 2006.
Biol Reprod 2006, 10.1095/biolreprod.106.053439
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
75/5/697    most recent
biolreprod.106.053439v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.
Agricola
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.
BIOLOGY OF REPRODUCTION 75, 697–704 (2006)
DOI: 10.1095/biolreprod.106.053439
© 2006 by the Society for the Study of Reproduction, Inc.


Research Article

The Interleukin 1beta-Induced Expression of Human Prostaglandin F2alpha Receptor Messenger RNA in Human Myometrial-Derived ULTR Cells Requires the Transcription Factor, NFkappaB1

Dean B. Zaragoza 2 3, Robyn R. Wilson 3 , Bryan F. Mitchell 3, and David M. Olson 345 

Departments of Obstetrics & Gynecology,3 Pediatrics,4 Physiology,5 Perinatal Research Centre, University of Alberta, Edmonton, Alberta, Canada T6G 2S2

ABSTRACT

Themolecular mechanisms that regulate the expression of genes involved in parturition are poorly understood. The mRNA expression of the prostaglandin F2alpha receptor (PTGFR), a uterine activating gene, is increased at labor and is required for uterine contractile activity in numerous animal models, although the signaling pathways responsible for this increased expression have not been identified. Proinflammatory cytokines have been proposed to regulate the expression of the uterine activating genes via activation of the nuclear transcription factor, NFkappaB, and initiate labor. However, it is uncertain whether uterine PTGFR is regulated this way. In this report, we demonstrate for the first time that treatment of immortalized human myometrial-derived ULTR cells with the proinflammatory cytokine IL1beta causes an increase in PTGFR mRNA levels. Furthermore, IL1beta treatment increased the nuclear levels of the RELA subunit of NFkappaB and increased binding of RELA to the NFkappaB DNA-binding site. Inhibition of NFkappaB activation with either the proteasome inhibitor MG132 or phenethyl caffeiate reducedPTGFRmRNA levels, which indicates that this transcription factor is important for basal transcription. Furthermore, this inhibition prevented IL1beta induction ofPTGFRmRNA, which confirms that NFkappaB is required for the IL1beta-induced increase inPTGFR. These results are consistent with the proposal that proinflammatory cytokines directly regulate uterine activation genes and that the transcription factor NFkappaB is involved in both basal and IL1beta-stimulated transcription of thePTGFRgene.

cytokines, gene regulation, parturition, signal transduction, uterus

INTRODUCTION

Prostaglandin F2{alpha} (PGF2{alpha}) is involved in several reproductive processes, including a number of physiological events associated with parturition. Noort et al. [1] have reported an association between elevated human PGF2{alpha} plasma levels and placental separation. In cows with retained fetal membranes due to the non-separation of the fetal and maternal cotyledons, placental tissue concentrations of PGF2{alpha} were found to be significantly lower than in normally separated cotyledons at 6 h after parturition [2]. In the human deciduas, PGF2{alpha} stimulates the production of MMP2 and MMP9 and decreases the production of the progesterone receptor isoforms A, B, and C [3, 4], and these actions indirectly lead to the termination of pregnancy. Uterine involution is very closely associated with plasma levels of PGF2{alpha} in cows and sheep [5, 6], and the administration of PGF2{alpha} promotes uterine involution in cows [7]. However, its best known function is to stimulate the contractions of labor, since the myometrium contracts in response to exogenous PGF2{alpha} both in vivo and in vitro [810].

PGF2{alpha} action is mediated by its receptor, PTGFR, which is a seven transmembrane, G{alpha}q protein-coupled receptor. PTGFR is one of several uterine-activating genes involved in preparing the uterus for the contractions of labor and other labor-associated functions. It is found in all the intrauterine tissues [11], which suggests different biological roles in each tissue, and in line with that notion, recent studies have revealed considerable regulation of the levels of PTGFR in the non-pregnant, pregnant, and parturient uterus. In human, rat, and mouse studies, myometrial PTGFR mRNA was found to be elevated at term and/or preterm birth, and specific antagonism of its action in sheep and mice delayed preterm birth and prolonged gestation [1216]. Interestingly, studies have shown that PTGFR mRNA expression is decreased in the myometrium of nonlaboring pregnant women compared to nonpregnant women. This result is consistent with both the presence of repressor and enhancer regions in the promoter [17], and suggests that PTGFR plays a role in pregnancy maintenance and termination. In the mouse, elevated levels of PTGFR mRNA without a concomitant increase in PGF2{alpha} are associated with preterm birth [14, 18, 19]. However, these changes are not exclusive to the myometrium; recently, we observed an increase in PTGFR mRNA and protein expression in human decidua at term delivery [20]. Therefore, the uterine tissue levels of PTGFR mRNA are related to pregnancy maintenance and termination. The question remains as to how PTGFR expression is regulated.

The finding that the levels of proinflammatory cytokines increase in the amniotic fluid and maternal serum at the onset of term and preterm labor [2126] has led to studies showing their involvement in the regulation of uterine gene expression at the time of labor [27, 28]. Only one paper has suggested a link between a cytokine and PTGFR by showing that interleukin (IL) 1B stimulates PTGFR mRNA expression after 24 h of exposure to cultured human granulosa-luteal cells [29].

Considerable evidence accumulated since 1999 has shown that the nuclear transcription factor nuclear factor kappa B (NFKB) is involved in many aspects of PG synthesis and action in intrauterine tissues. The NFKB family of transcription factors is associated with inflammation and can be activated by the pro-inflammatory cytokines associated with labor to affect PG synthesis in uterine-derived tissues and cells. This process may be mediated by tumor necrosis factor [30, 31], IL1B [27], and lipopolysaccharide [32], although this latter effect is not always consistent [33]. It appears that NFKB mediates IL1B action at several levels of the PG synthesis-receptor cascade, including secretory type II phospholipase A2 [33] and PG endoperoxide H synthase (PTGS, cyclooxygenase)-2 [27, 31, 34].

The possibility that a proinflammatory cytokine can regulate PTGFR transcriptional regulation via NFKB is high, since we have identified NFKB-binding sites at four separate positions in the human PTGFR promoter: at –3835 and –3017 (unpublished) and within intron 1 at positions 744 and 777 [17]. The purpose of this present study was to test the possibility that the proinflammatory cytokine IL1B regulates PTGFR mRNA expression through NFKB activation in the immortalized human myometrial-derived ULTR cell line, which has been previously utilized for studying IL1B signaling [27, 30].

MATERIALS AND METHODS

Cell Culture

ULTR cells were provided by Dr. J.K. McDougall's laboratory (Fred Hutchison Cancer Research Centre, Seattle, WA) [35]. Cells were cultured in Dulbecco Modified Eagle Medium (DMEM) that contained 10% fetal bovine serum (Invitrogen, Burlington, ON, Canada) and 1x antimycotic (100 U/ml penicillin G sodium, 100 µg/ml streptomycin sulfate, 0.25 µg/ml amphotericin B) at 37°C in 5% CO2. Cells were grown in either T75 flasks for RNA and nuclear extractions or in 8-chamber slides for immunofluorescence. All the cell culture experiments utilized cells from passage 17 to 25. Following growth to 80% confluence, the growth medium was aspirated and the cells were washed three times with phosphate-buffered saline (PBS). For treatments, the cells were cultured in serum-free medium (DMEM with 1x antimycotic) for an additional 24 h at 37°C in 5% CO2. Following starvation, the cells were cultured in serum-free medium that contained either 0.6 nM (10 ng/ml) IL1B or vehicle (H2O). The inhibition experiments involved pretreating cells with or without 17.6 µM (5 µg/ml) phenethyl caffeiate (CAPE) or 5 and 10 µM MG132 (EMD Biosciences, Calbiochem, San Diego, CA) 1 h prior to treatment with IL1B (0.585 nM) or vehicle control (H2O). The duration of IL1B or vehicle treatment is indicated (1, 3, 6, 12 or 24 h) in the figure legends.

RNA Extraction

Total RNA was extracted with Trizol reagent (Invitrogen, Burlington, ON, Canada) as per the manufacturer's instructions. Cells were lysed with Trizol (3.5 ml/flask) and incubated at room temperature for 5 min. To assess variation introduced by the RNA extraction procedure, each flask was divided into three separate RNA isolations by transferring 1 ml of the lysed cells into three separate microfuge tubes. Following the addition of 200 µl chloroform, the samples were shaken vigorously by hand for 30 sec, incubated at room temperature for 2 min, and centrifuged at 12 000 x g for 15 min at 4°C. The aqueous layer was transferred to new tubes and RNA was precipitated with an equal volume of isopropanol. RNA was precipitated by incubation for 1 h at –20°C, followed by centrifugation at 12 000 x g for 10 min at 4°C. The RNA pellets were washed with 75% ethanol (1 ml) and resuspended in 1 mM sodium citrate solution (pH 6.4) (Ambion, Austin, TX). The RNA was treated with DNase using the Turbo DNAfree Kit (Ambion), to remove contaminating genomic DNA. RNA purity and concentration were determined by A260 and A280 measurements, and sample integrity was verified by denaturing agarose electrophoresis.

Nuclear Protein Extractions

Following treatment, nuclear proteins were extracted as described by Schreiber et al [36]. Cells were washed three times with PBS and scraped into 1.5-ml microfuge tubes. Cells were pelleted by centrifugation at 1500 x g for 3 min at 4°C. The supernatant was removed and the pellet was gently resuspended in 400 µl of ice-cold buffer A [10 mM Hepes (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1mM DTT, 0.5 mM PMSF, 10 µl protease inhibitor cocktail (Sigma-Aldrich Canada Ltd., Oakville, ON, Canada) per 107 cells]. Resuspended cells were incubated on ice for 15 min, 10% NP-40 was added, and the sample was vortexed for 10 sec. Samples were centrifuged for 30 sec at 14 000 x g. The pellet was resuspended in 50 µl of ice-cold buffer C [20 mM Hepes (pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, and 25 µl/ml protease inhibitor cocktail]. Samples were placed on an orbital shaker for 20 min at 4°C. Following centrifugation at 12 000 x g for 10 min, the supernatants were removed and assayed for protein concentration by the Bradford Assay (Bio-Rad Laboratories, Mississauga, ON, Canada). Nuclear extracts were stored at –80°C.

Immunofluorescence

Following treatment, cells were washed three times with PBS and fixed with 500 µl/well fixation and permeabilization solution (3.7% formaldehyde, 0.5% Triton X-100) for 15 min at room temperature. Each chamber was washed twice with 500 µl PBS and blocked in 1% BSA in 1x PBS for 30 min. The cells were then incubated with the anti-RELA polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) at a dilution of 1:100 in blocking buffer for 2 h at room temperature. Following two washes with PBS, the cells were incubated with a 1:200 dilution of anti-rabbit IgG (rhodamine-conjugated) in blocking buffer for 30 min at room temperature in the dark. After PBS washing three times in the dark, the gasket was removed from the slide and 50 µl of a 1:3 dilution of Vectashield mounting solution with DAPI (Vector Laboratories, Burlingame, CA) was applied to the top edge of the slide. A coverslip uniformly distributed the solution across the slide. Images were acquired with an Olympus BX40 fluorescent microscope equipped with a SPOT2 color digital camera.

Western Blotting

Nuclear extracts (5 µg) and a prestained protein ladder (MBI Fermentas, Burlington, ON, Canada) were electrophoresed on a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane by the standard methods. The membrane was incubated overnight with blocking buffer (7% dried milk in 0.1% TBS-Tween) at 4°C on a platform rocker. The anti-NFKB polyclonal antibody (Santa Cruz Biotechnology) was diluted 1:1000 in blocking buffer (5% dried milk in 0.1% TBS-Tween) and incubated with the membrane for 2 h at room temperature with gentle rocking. The membrane was washed three times (10 min each) with 0.1% TBS-Tween and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG at a dilution of 1:4000 in blocking buffer for 1.5 h at room temperature. The membrane was washed four times (15 min each) with 0.1% TBS-Tween and proteins were detected with the ECL detection reagents (Amersham Biosciences, Baie d'Urfé, QC, Canada) and exposure to Fuji RX x-ray film.

Electrophoretic Mobility Shift Assay (EMSA)

Binding of nuclear protein to the RELA DNA-binding site was analyzed using the Nushift Kit (ActiveMotif, Carlsbad, CA). Each labeling reaction contained 50 ng (2 µl) of wild-type oligonucleotide (5'-AGCTTGGGGTATTTCCAGCCG-3'; the NFKB site is underlined), 2 µl of 10x kinase buffer, 4 µl (40 µCi) of {gamma}[-32P]ATP (3000 Ci/mM), 1 µl (10 U) of T4 polynucleotide kinase, and 11 µl of water. The reaction was incubated for 30 min at 37°C and stopped with the addition of 5 µl of 1% SDS/100 mM EDTA. The labeled probe was gel-purified on a 10% polyacrylamide gel and specific activity was determined by scintillation counting. For each binding reaction, an extract/antibody premix was prepared that contained 11 µg nuclear extracts, 4 µl Binding Buffer B (4x), 2 µl Stabilizing Solution D, with or without 4 µl anti-RELA antibody, with or without 2 µl NFKB peptide, and water to a total volume of 16 µl. The mix was incubated for 30 min on ice. During the incubation, a probe premix was prepared for each reaction that contained 2 µl Binding Buffer C2 (4x), 1 µl Stabilizing Solution D, 100 000 cpm of labeled probe, with or without 2 µl of cold wild-type oligonucleotide, with or without 2 µl of mutant oligonucleotide (5'-AGCTTGGCATAGGTCCAGCCG-3' (the mutated NFKB site is underlined), and water to 8 µl. After 30 min of extract/antibody premix incubation, 8 µl of probe premix was added and the entire reaction was incubated for 30 min at 4°C. The binding reaction was then loaded onto a 5% native polyacrylamide gel and electrophoresed in 1x TGE (25 mM Tris base per 190 mM glycine per 1mM EDTA; pH 8.3) at 200 V for 2 h at 4°C. Following electrophoresis, the gel was dried and analyzed by autoradiography.

Real-Time RT-PCR

Total RNA (1000 ng) was reverse-transcribed using Supercript II reverse transcriptase (Invitrogen) in a volume of 20 µl, using the protocol supplied by the manufacturer. The cDNA obtained was used in subsequent PCR reactions. To exclude contamination of cDNA samples with genomic DNA, corresponding reactions, in which Superscript II was replaced with water (the No RT controls), were performed with randomly chosen samples. The following human PTGFR-specific primers were designed from the sequence with accession no. L24470: forward primer, 5'-(1009)TCCTGTATTTGTTGGAGCCCATTTCTGGTTAC(1040)-3'; and reverse primer, 5'-(1123) TCCATGTTGCCATTCGGAGAGCAAAAAG(1096)-3'. The HPLC-purified hGAPDH primers were the same as those found in the Applied Biosystems (Foster City, CA) GAPDH TaqMan Gold RT-PCR kit (P/N N808-0233; forward primer: 5'-(1457)GAAGGTGAAGGTCGGAGTC(1476)-3'; reverse primer: 5'-(3412)GAAGATGGTGATGGGATTTC(3392)-3'.

Each 50-µl reaction contained 2 µl of cDNA, 25 µl of 2x SYBR green Master Mix (Applied Biosystems), 1 µl of forward primer and 1 µl of reverse primer, 1 µl AmpErase (to control for PCR product contamination), and water to a total reaction volume of 50 µl. Real time RT-PCR (iCycler; Bio-Rad Laboratories) was performed under the following conditions: 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 20 sec at 95°C and 1 min at 60°C. To control for the amplification of non-specific products, melt curve analysis was performed following amplification by measuring fluorescence while increasing the temperature every 12 sec by 0.5°C, from 55°C to 95°C. No amplification of non-specific products was observed with any set of primers. The PCR products of each sample were checked by gel electrophoresis, and sequenced to verify that the correct product was amplified.

Human PTGFR mRNA measurements were normalized to GAPDH mRNA. Standard curves for both PTGFR and GAPDH were generated by serial dilutions of pooled cDNA samples. The amplification efficiency for each primer set was determined by converting the slope of the standard curve using the algorithm E = 10–1/slope. For each gene, the mean threshold cycle (from triplicate reactions) was corrected for the efficiency of the reaction and expressed relative to a control sample for each experiment [37]. The human PTGFR levels were then expressed relative to the GAPDH levels using the following formula:

Formula

The mean of each treatment group was determined. The number of samples (N) for each treatment group is stated in the figure legends. The results for all the mRNA measurements were analyzed by either a two-way analysis of variance (post-hoc test using the Holm-Sidak method) or the Student t-test when only two groups were compared. Significance was achieved at P < 0.05.

RESULTS

Treatment of ULTR Cells with IL1B Increases PTGFR mRNA Levels

To examine whether IL1B regulates PTGFR mRNA levels, ULTR cells were first treated with IL1B (0.06 nM or 0.6 nM) for 24 h and analyzed for PTGFR mRNA abundance by real-time RT-PCR. Both doses of IL1B resulted in an increase in PTGFR expression, but the greatest effect was seen with the 0.6 nM dose (data not shown). For this reason, the remaining experiments used this dose. The levels of human PTGFR mRNA over 24 h in ULTR cells treated with 0.6 nM IL1B are shown in Figure 1. Two-way ANOVA indicated significant effects of both time (P < 0.001) and treatment (P = 0.002) on PTGFR mRNA levels. Pairwise multiple comparisons procedures (Holm-Sidak method) indicated that the 12 h controls were significantly different from the 0 h controls (P < 0.05) but not the 6 h controls. The 24 h controls were significantly different from both the 0 h and 6 h controls (both P < 0.05). Furthermore, the 12 h and 24 h treatments were significantly different from both the 0 h controls (P < 0.001) and 6 h treatment (P < 0.001). Finally, the PTGFR mRNA levels were significantly higher in the treated cells at both 12 h and 24 h than in the time-matched controls. Thus, IL1B positively regulates human PTGFR mRNA levels.


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. Human PTGFR mRNA levels in ULTR cells treated with vehicle or 0.6 nM (10 ng/ml) IL1B for 0, 1, 3, 6, 12, and 24 h (N = 3 for each group, mean ± SEM). *, P < 0.001 compared with time-matched controls; **, P < 0.05 compared with 0 h controls; ***, P < 0.05 compared to 6 h within the same treatment group

The RELA Subunit of NFKB Translocates to the Nucleus in ULTR Cells Treated with IL1B

We examined potential mediators of the IL1B effect on PTGFR expression. Previous studies have demonstrated that NFKB is a primary mediator of the effects of this cytokine. In addition, we have previously identified potential NFKB sites within the PTGFR promoter, which suggests that this family of transcription factors plays a role in modulating PTGFR transcription in myometrial cells. Therefore, we examined by immunofluorescence the localization of the RELA subunit of NFKB in ULTR cells in response to IL1B treatment. Treatment of ULTR cells with IL1B resulted in an increase in nuclear RELA at both 12 h and 24 h compared to control cells. Figure 2a illustrates that the RELA fluorescent signal (red) matched the DAPI nuclear fluorescence (blue) (Fig. 2a, panels 5 and 6). In contrast, control cells had very little nuclear fluorescence but had a rather strong cytoplasmic signal (Fig. 2a, panel 1). This result was verified by analyzing the RELA protein levels by Western blotting of nuclear extracts derived from control and IL1B-treated ULTR cells (Fig. 2b). The nuclear RELA levels were higher in IL1B-treated ULTR cells (0.6 nM) than in control cells. Taken together, these results demonstrate that treatment of ULTR cells with IL1B results in nuclear translocation of the RELA subunit of NFKB.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. Immunofluorescence of ULTR cells. A) Fluorescent signals for RELA (red) and nucleus (blue) in ULTR cells treated with vehicle (panels 1–4) or 0.6 nM (panels 5–8) IL1B for 24 h. Panels 1, 2, 5, and 6 represent immunofluorescence in the presence of the anti-RELA antibody, while panels 3,4, 7 and 8 represent negative controls, in which the anti-RELA antibody was omitted. B) Western blot of RELA protein levels in nuclear extracts of ULTR cells treated with vehicle or 0.6 nM (10 ng/ml) IL1B for 24 h (N = 3 for each group)

Binding of RELA to the NFKB Response Element is Higher in ULTR Cells Treated with IL1B

We used the electrophoretic mobility shift assays (EMSA) to determine whether IL1B treatment of ULTR cells also resulted in increased binding of RELA to the NFKB response element. Validation of the assay is shown in Figure 3a. Labeled unbound probe that corresponded to the wild-type NFKB site is shown at the bottom of each gel in all the lanes. Nuclear extracts from both IL1B-treated ULTR cells and TPA-treated Jurkat cells (control provided with the kit) exhibited binding activity to the labeled NFKB probe, as shown by decreased mobility (shifted band, Fig. 3a, lanes 1 and 6). In addition, while this shifted band was eliminated by including unlabeled wild-type probe in the binding reaction (Fig. 3a, lane 2), it was not eliminated when unlabeled mutant NFKB-binding site was included (Fig. 3a, lane 3). These results indicate that the binding activity is specific for the wild-type NFKB site. To identify RELA as part of the binding complex, a polyclonal antibody to the RELA subunit of NFKB was included in the binding reaction. This resulted in a further decrease in mobility (supershifted band, Fig. 3a, lanes 4 and 7). Finally, a peptide that corresponds to the eptitope of the RELA antibody was included in the binding reaction. This peptide competed with the shifted complex for the anti-RELA antibody and eliminated the supershifted band (Fig. 3a, lane 5). Therefore, the binding activity of the ULTR nuclear extracts consists of a complex that contains RELA.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 3. A) Verification of EMSA of nuclear extracts from ULTR cells treated with 0.6 nM IL1B for 24 h (lanes 1–5) and a control extract isolated from Jurkat cells treated with TPA (lanes 6 and 7). B) DNA-binding activity of RELA in ULTR cells treated with vehicle (lanes 1–4) or 0.6 nM IL1B for 24 h (lanes 5–10). Binding reactions were performed with or without the anti-RELA antibody for each nuclear extract

Nuclear extracts from control and IL1B-treated (0.6 nM for 24 h) ULTR cells were compared for binding to the wild-type NFKB probe (Fig. 3b). Although there were no apparent differences in the intensities of the shifted bands between the two groups, there was a large increase in the anti-RELA antibody-shifted complex in the nuclear extracts derived from treated cells (supershifted band is undetectable in Fig. 3b, lanes 2 and 4 compared with Fig. 3b, lanes 6, 8, and 10), which indicates increased binding of RELA to the NFKB site following IL1B treatment. The fact that inclusion of the anti-RELA antibody did not completely eliminate the shifted complex may indicate some nonspecific binding activity in the extracts, an inadequate amount of anti-RELA antibody in the binding reaction, or the presence of other non-RELA-containing NFKB complexes. Nevertheless, these results demonstrate that RELA binding to the NFKB response element is elevated in ULTR cells treated with IL1B.

The Proteasome Inhibitor MG132 Prevents Increased RELA Nuclear Abundance with IL1B Treatment, and Reduces the PTGFR mRNA levels in Both Control and IL1B-Treated ULTR Cells

To test whether the activation of the NFKB pathway by IL1B is responsible for the increase in PTGFR mRNA levels, we used the proteasome inhibitor MG132 to prevent nuclear translocation of RELA. Inhibition of the 26S proteasome prevents the degradation of NFKBI, thereby keeping the nuclear localization signal of the NFKB subunits masked [38]. ULTR cells were pretreated with either MG132 (5 or 10 µM) or vehicle control for 1 h prior to treatment with either 0.6 nM IL1B or control for 24 h. Nuclear extracts were prepared and analyzed for RELA abundance (Fig. 4a). While the IL1B-induced increase in RELA was observed without MG132 treatment (Fig. 4a, lanes 1, 2, 5, and 6), preincubation of ULTR cells with 5 µM MG132 partially prevented this increase, and preincubation with 10 µM MG132 completely prevented this increase (Fig. 4a, lanes 3, 4, 7, and 8). These results suggest that MG132 prevents IL1B-induced nuclear translocation of the RELA subunit of NFKB.


Figure 4
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. The effect of the MG132 and CAPE on NFKB activation and PTGFR mRNA levels in ULTR cells treated with IL1B. A) Western blot of RELA protein levels in nuclear extracts of ULTR cells pretreated with or without 5 µM or 10 µM MG132 1 h prior to treatment with or without 0.6 nM IL1B for 24 h. B) PTGFR mRNA levels (mean ± SEM) in nuclear extracts of ULTR cells pretreated with or without 0.6 nM (10 µM) MG132 or 17.6 µM (5 µg/ml) CAPE 1 h prior to treatment with or without 0.6 nM (10 ng/ml) IL1B for 12 and 24 h. The results shown are a compilation of all the experiments, where N = 11 for the control and IL1B groups control at 12 h, N = 7 for the control and IL1B groups control at 24 h; and N = 3 for all the MG132- and CAPE-pretreated groups. *, P < 0.05 compared to time-matched controls. C) Western blot of RELA protein levels in nuclear extracts of ULTR cells pretreated for 1h with or without 17.6 µM CAPE and then treated with or without 0.6 nM IL1B for 12 h or 24 h. D) EMSA for RELA binding in nuclear extracts of ULTR cells pretreated for 1 h with or without 17.6 µM CAPE and then with or without 0.6 nM IL1B for 12 or 24 h

We next examined whether inhibiting the IL1B-induced increase in nuclear RELA levels with MG132 also prevented the IL1B-induced increase in PTGFR mRNA levels. ULTR cells were pretreated with either 10 µM MG132 or vehicle control for 1 h prior to treatment with either 0.6 nM IL1B or control for 12 or 24 h. RNA was extracted and the PTGFR mRNA levels were measured by real-time RT-PCR (Fig. 4b). Once again in the absence of MG132, IL1B treatment increased the PTGFR mRNA levels 2-fold at 12 and 24 h, whereas pretreatment with the proteasome inhibitor decreased the PTGFR mRNA levels in both the control and IL1B-treated cells. Furthermore, there was no significant difference between the control and IL1B-treated cells when the cells were pretreated with MG132. This suggests that inhibition of the NFKB pathway decreases PTGFR mRNA levels in control cells and prevents IL1B induction of PTGFR mRNA levels. The reduction in PTGFR mRNA levels observed with MG132 was not due to cell death, as trypan blue staining confirmed that treatment of ULTR cells with either 5 or 10 µM MG132 did not significantly alter cell viability (data not shown).

Phenethyl Caffeiate (CAPE) Inhibits RELA Binding to the NFKB Response Element in ULTR Cells Treated with IL1B and Reduces PTGFR mRNA Levels in Both Control and IL1B-Treated Cells

In order to address specifically the role of NFKB in the IL1B-induced upregulation of PTGFR, ULTR cells were pretreated with 17.6 µM (5 µg/ml) CAPE prior to treatment with IL1B, and assayed for RELA nuclear abundance, RELA binding activity, and PTGFR mRNA levels. Figure 4c illustrates the nuclear RELA protein levels in these cells. Once again, the nuclear RELA levels increased with IL1B treatment at both 12 h (Fig. 4c, lanes 1 and 2) and 24 h (Fig. 4c, lanes 5 and 6). Pretreatment of ULTR cells with CAPE had no effect on these increases at either 12 h (Fig. 4c, lanes 3 and 4) or 24 h (Fig. 4c, lanes 7 and 8).

CAPE inhibited RELA binding to the NFKB response element at 12 h of IL1B treatment (Fig. 4d). Increases in the amount of the anti-RELA antibody supershifted complex were detected with IL1B treatment at both 12 h (Fig. 4d, lanes 1 and 2) and 24 h (Fig. 4d, lanes 5 and 6). However, pretreatment with CAPE prevented the IL1B-induced increase in the supershifted complex at 12 h (Fig. 4d, lanes 3 and 4) but not 24 h (Fig. 4d, lanes 7 and 8).

We next examined whether pretreatment with CAPE also prevented the IL1B-induced increase in PTGFR mRNA levels, as was the case with MG132. ULTR cells were pretreated with either 17.6 µM (5 µg/ml) CAPE or vehicle control for 1 h prior to treatment with either 0.6 nM IL1B or control for 12 or 24 h. Again, in the absence of inhibitor, IL1B treatment increased the PTGFR mRNA levels 2-fold at 12 and 24 h, whereas pretreatment with the binding inhibitor decreased the PTGFR mRNA levels in both the control and IL1B-treated cells (Fig. 4b). In addition, there was no significant difference between the control and IL1B-treated cells at either 12 h or 24 h when the cells were pretreated with CAPE. This suggests that inhibition of NFKB binding decreases PTGFR mRNA levels in control cells and prevents IL1B induction of PTGFR mRNA levels. Furthermore, the reduction in PTGFR mRNA levels observed with CAPE was not due to cell death, as trypan blue staining confirmed that treatment of ULTR cells with 17.6 µM CAPE did not significantly alter cell viability (data not shown).

DISCUSSION

Several immortalized cell lines have been developed to aid in the study of uterine gene expression and function. The ULTR cell line maintains smooth muscle morphology, expresses smooth muscle {alpha}-actin [35], and retains many of the features of primary human myometrial cells. For example, these cells possess Ca2+-activated K+ channels, and similar to primary cultured human myometrial cells and intact tissue, increase [Ca2+]i and inositol phosphate formation in response to the uterotonin oxytocin [3942]. These cells are well suited to the study of cytokine signaling, as they have similar response as primary myometrial cells. For instance, IL1B and TNF stimulate the production of both PGE2 and 6-keto-PGF1{alpha} in ULTR cells and in primary myometrial cells [4345]. The use of this cell line has also uncovered important details of how IL1B and interferon-{gamma} (IFNG) regulate PG synthesis through NFKB [27, 30]. Based on these observations, as well as our own observations that ULTR cells express many factors thought to be important for regulating myometrial contractility (estrogen and progesterone receptors, oxytocin receptors, connexin-43), it is evident that ULTR cells provide a reasonable first model for investigating the role of NFKB in the regulation of PTGFR expression by IL1B in uterine tissues.

In amnion cells, the NFKB sites on the PTGS2 promoter are critical for IL1B-stimulated PTGS2 expression [46], and in the myometrium, NFKB is necessary for the IL1B-induced increase in PTGS2 expression [27, 47]. Furthermore, labor has been shown to be associated with increased NFKB activity in the amnion, where it is proposed to act as an antagonist of the progesterone receptor [34]. An inhibitor of NFKB, SN-50, was able to delay preterm birth when administered into the amniotic fluid of mice [48], and infusion of sulfasalazine, an anti-inflammatory agent and NFKB inhibitor, decreased uterine electromyographic activity in pregnant ewes induced to enter preterm labor with RU486, the progesterone receptor blocker (I.R. Young, personal communication). These studies demonstrate the participation of NFKB in preterm and term labor.

Although NFKB is composed of dimeric complexes formed from the REL family of proteins, it is classically detected as the NFKB1/RELA heterodimer [49]. In unstimulated cells, NFKB is sequestered in the cytoplasm through binding to NFKBI (previously known as I{kappa}B), which masks the nuclear localization signal of the particular NFKB subunit [49]. Treatment with cytokines leads to phosphorylation of NFKBI, which causes its ubiquitination and degradation by the 26S proteasome, thereby unmasking the nuclear translocation signal that allows nuclear translocation of the NFKB subunit, where it modulates gene expression through binding to various NFKB response elements [49]. Activation of the NFKB pathway is commonly blocked through the use of either the 26S proteasome inhibitor MG132, which prevents the degradation of NFKBI, or phenethyl caffeiate (CAPE), which prevents binding of NFKB subunits to their DNA response elements [38, 50].

PTGFR is one of several genes involved in activating the uterus for the contractions of labor. This has been demonstrated in mouse, rat, and human studies [1214, 19]. In sheep, although PTGFR expression does not change with the onset of labor in every study, antagonism of PTGFR expression prevents RU486-induced preterm labor [16, 51, 52]. Taken together, these studies suggest that PTGFR plays a prominent role in the process of labor, and that understanding its regulation is an important step toward understanding the initiation of the uterine contractions of labor.

Our results show that IL1B increases the expression of the uterine activating gene PTGFR in an immortalized human myometrial cell line, and are consistent with studies in human granulosa-luteal cells, in which IL1B induces both PTGS2 and PTGFR mRNAs in time- and concentration-dependent manners [29]. PTGS2, which is another uterine activation gene, is also upregulated in human myometrial cells by IL1B, which suggests that this cytokine coregulates both prostaglandin synthesis and contractile prostaglandin responsiveness in uterine myocytes [27, 47]. These findings are consistent with the notion that proinflammatory cytokines stimulate labor through increased expression of uterine activation genes. Although, the increase in PTGFR mRNA reported in the present study is modest compared to PTGS2 induction, a 2-fold increase may still have significant effects in the myometrium. In fact, mouse studies illustrate that a 2-fold increase in PTGFR expression in the absence of an increase in PGF2{alpha} level is sufficient for labor to occur [14, 19].

Although the reason for the time-dependent increase in PTGFR mRNA levels is unclear, we do know that it is not due to growth arrest brought on by either serum withdrawal or confluence. Time course experiments in which control cells were not serum starved also show an increase in PTGFR mRNA levels at 12 h and 24 h (data not shown). Furthermore, differing cell densities (40–100%) at the start of a 24-h treatment had no effect on either the PTGFR mRNA levels in the controls or the magnitude of the IL1B-induced increase in PTGFR mRNA levels (data not shown).

We have shown that treatment of ULTR cells with IL1B results in nuclear translocation of the RELA subunit of NFKB, as well as increased binding activity of RELA to a consensus NFKB-binding site. This is consistent with previous studies of immortalized human myometrial cells, which show complete degradation of NFKBI within 30 min of IL1B treatment, thereby allowing nuclear translocation of the NFKB subunit [27, 47]. The NFKBI levels returned to baseline levels by 60 min, which suggests that IL1B-induced NFKB activation is short-lived. We also observed activation of NFKB after just 30 min of treatment with IL1B (data not shown). However, this activation lasted for up to 24 h of IL1B treatment, as the nuclear abundance and DNA-binding activity of RELA were still higher than those of the controls at 24 h of IL1B treatment (Figs. 2 and 3). Inhibition of the NFKB pathway by either preventing RELA nuclear translocation (with MG132) or inhibiting RELA DNA-binding activity (with CAPE) reduced the PTGFR mRNA levels to well below the control levels. This suggests that NFKB is either a part of the basal transcription machinery for PTGFR in ULTR cells or is required for the expression of basal transcription factors. In addition to the effect on basal PTGFR mRNA levels, both MG132 and CAPE prevented IL1B induction of PTGFR mRNA. This is consistent with the hypothesis that the increase in PTGFR mRNA levels induced by IL1B requires NFKB; however, it is possible that the lack of induction is secondary to the effect on basal transcription, i.e., the basal machinery might have been inhibited to an extent that no stimulation could occur.

MG132 affects several pathways in its role as a proteasome inhibitor. Therefore, it is possible that the effects on IL1B induction of PTGFR may not be specific to NFKB activation. However, the CAPE experiments strengthen our claim that the IL1B induction of PTGFR requires NFKB. In contrast to MG132, CAPE is a specific inhibitor of NFKB activation and does not appear to block nuclear translocation, since pretreatment of U937 cells with CAPE did not inhibit TNF-dependent phosphorylation and degradation of NFKBIA (previously known as I{kappa}B{alpha}) [50]. Our experiments indicate that although CAPE does not block RELA nuclear translocation in myometrial cells, it does inhibit RELA DNA-binding at 12 hours of IL1B treatment. Furthermore, the inhibition of NFKB binding is specific, as the binding of other transcription factors, including activator protein 1, POU2F1 (previously known as OCT-1), and TBP (TFIID), to their respective binding sites is not affected by CAPE treatment [50]. Our EMSA experiments also show that after 24 h treatment with IL1B, CAPE no longer had an inhibitory affect on RELA DNA-binding, yet the PTGFR mRNA levels were still reduced compared to untreated control ULTR cells (Fig. 4b and d). The reason for this result is unclear and it may simply reflect short-lived CAPE activity in culture. Alternatively, inhibition of NFKB may have affected the expression of certain genes that in turn regulate PTGFR expression. Despite the recovery of NFKB binding activity at 24 h of IL1B treatment, the return to control levels of PTGFR mRNA may require more time as other NFKB-regulated genes recover.

Since NFKB is known to influence the transcription of a large number of genes, the use of inhibitors makes it difficult to assess whether the NFKB-dependant induction of PTGFR mRNA with IL1B is direct or indirect [53]. Our results suggest that NFKB is required for IL1B induction of PTGFR, but as discussed above, it is possible that this induction occurs through other NFKB-regulated genes rather than through the direct binding of NFKB to the PTGFR promoter. However, the presence of NFKB-binding sites in the PTGFR promoter at positions –3835 and –3017 (Yamamoto et al. unpublished results), as well as within intron 1 at positions 744 and 777 suggests a direct effect [17].

The choice of NFKB subunit to examine in this study was an important consideration because it is the specific combination of subunits that determines the specificity of transcriptional activation [49]. Chapman et al have identified changes in NFKB subunit composition associated with pregnancy and labor, with NFKB1 homodimers predominating in non-pregnant myometrium samples and RELA:NFKB1 heterodimers predominating in pregnant and laboring samples [54]. They also found that all of the subunits were significantly reduced in laboring myometrial samples, while the spontaneous laboring levels of RELA, NFKB1, and REL were significantly higher in the upper uterine segment compared to the lower uterine segment, which suggests a possible role for these subunits in the contraction of the upper uterine segment during labor [54]. Furthermore, RELA was the only subunit that was not reduced in pregnant myometrium when compared to non-pregnant controls [54]. For these reasons, we believe we are justified in our choice of analyzing RELA in our experiments. Nevertheless, an examination of other NFKB subunits in IL1B-treated ULTR cells may be informative.

While the PTGFR regulatory mechanism identified here is a significant result, the in vivo situation is obviously more complicated. The EMSAs demonstrate only the in vitro protein DNA interaction and any selectivity provided when the site is within its native promoter is lost [55]. Therefore, any regulatory effects of chromatin structure are not accounted for in this study. Indeed, modification of chromatin structure has been found to play a prominent role in IL1-induced stimulation of PTGS2 in human myometrial cells [47]. Our study is only a first step towards understanding PTGFR regulation in human uterine cells, and future efforts should be directed towards specific uterine cells and a consideration of chromatin structure as well as other agonists.

ACKNOWLEDGMENTS

The authors thank Dr. J.K. McDougall (Fred Hutchison Cancer Research Centre, Seattle, WA) for the kind gift of ULTR cells, and Dr. Xin Fang for expert technical assistance.

FOOTNOTES

2 Correspondence: FAX: 780 492 1308; dzaragoz{at}ualberta.ca Back

1 Supported by the Canadian Institutes for Health Research (The Institute for Human Development, Child and Youth Health) and the CIHR Group for Perinatal Health and Disease. Back

Received: 25 April 2006.

First decision: 19 May 2006.

Accepted: 10 July 2006.

REFERENCES

  1. Noort WA, van Bulck B, Vereecken A, de Zwart FA, Keirse MJ, Changes in plasma levels of PGF2 alpha and PGI2 metabolites at and after delivery at term. Prostaglandins 1989 37:3-12[CrossRef][Medline]
  2. Takagi M, Fujimoto S, Ohtani M, Miyamoto A, Wijagunawardane MP, Acosta TJ, Miyazawa K, Sato K, Bovine retained placenta: hormonal concentrations in fetal and maternal placenta. Placenta 2002 23:429-437[CrossRef][Medline]
  3. Ulug U, Goldman S, Ben-Shlomo I, Shalev E, Matrix metalloproteinase (MMP)-2 and MMP-9 and their inhibitor, TIMP-1, in human term decidua and fetal membranes: the effect of prostaglandin F(2alpha) and indomethacin. Mol Hum Reprod 2001 7:1187-1193[Abstract/Free Full Text]
  4. Goldman S, Weiss A, Almalah I, Shalev E, Progesterone receptor expression in human decidua and fetal membranes before and after contractions: possible mechanism for functional progesterone withdrawal. Mol Hum Reprod 2005 11:269-277[Abstract/Free Full Text]
  5. Lindell JO, Kindahl H, Jansson L, Edqvist LE, Postpartum release of prostaglandin F2alpha and uterine involution in the cow. Theriogenology 1982 17:237-245[CrossRef][Medline]
  6. Thompson FN, Page RD, Cook CB, Caudle AB, Prostaglandin F2 alpha metabolite levels in normal and uterine-infected postpartum cows. Vet Res Commun 1987 11:503-507[CrossRef][Medline]
  7. Lindell JO, Kindahl H, Exogenous prostaglandin F2 alpha promotes uterine involution in the cow. Acta Vet Scand 1983 24:269-274[Medline]
  8. Senior J, Marshall K, Sangha R, Baxter GS, Clayton JK, In vitro characterization of prostanoid EP-receptors in the non-pregnant human myometrium. Br J Pharmacol 1991 102:747-753[Medline]
  9. Senior J, Sangha R, Baxter GS, Marshall K, Clayton JK, In vitro characterization of prostanoid FP-, DP-, IP- and TP-receptors on the non-pregnant human myometrium. Br J Pharmacol 1992 107:215-221[Medline]
  10. Senior J, Marshall K, Sangha R, Clayton JK, In vitro characterization of prostanoid receptors on human myometrium at term pregnancy. Br J Pharmacol 1993 108:501-506[Medline]
  11. Alfaidy N, Xiong ZG, Myatt L, Lye SJ, MacDonald JF, Challis JR, Prostaglandin F2alpha potentiates cortisol production by stimulating 11beta-hydroxysteroid dehydrogenase 1: a novel feedback loop that may contribute to human labor. J Clin Endocrinol Metab 2001 86:5585-5592[Abstract/Free Full Text]
  12. Brodt-Eppley J, Myatt L, Changes in expression of contractile FP and relaxatory EP2 receptors in pregnant rat myometrium during late gestation, at labor, and postpartum. Biol Reprod 1998 59:878-883[Abstract/Free Full Text]
  13. Brodt-Eppley J, Myatt L, Prostaglandin receptors in lower segment myometrium during gestation and labor. Obstet Gynecol 1999 93:89-93[Abstract/Free Full Text]
  14. Cook JL, Shallow MC, Zaragoza DB, Anderson KI, Olson DM, Mouse placental prostaglandins are associated with uterine activation and the timing of birth. Biol Reprod 2003 68:579-587[Abstract/Free Full Text]
  15. Peri KG, Quiniou C, Hou X, Abran D, Varma DR, Lubell WD, Chemtob S, THG113: a novel selective FP antagonist that delays preterm labor. Semin Perinatol 2002 26:389-397[CrossRef][Medline]
  16. Hirst JJ, Parkington HC, Young IR, Palliser HK, Peri KG, Olson DM, Delay of preterm birth in sheep by THG113.31, a prostaglandin F2alpha receptor antagonist. Am J Obstet Gynecol 2005 193:256-266[CrossRef][Medline]
  17. Zaragoza DB, Wilson R, Eyster K, Olson DM, Cloning and characterization of the promoter region of the human prostaglandin F2alpha receptor gene. Biochim Biophys Acta 2004 1676:193-202[Medline]
  18. Matsumoto T, Sagawa N, Yoshida M, Mori T, Tanaka I, Mukoyama M, Kotani M, Nakao K, The prostaglandin E2 and F2 alpha receptor genes are expressed in human myometrium and are down-regulated during pregnancy. Biochem Biophys Res Commun 1997 238:838-841[CrossRef][Medline]
  19. Cook JL, Zaragoza DB, Sung DH, Olson DM, Expression of myometrial activation and stimulation genes in a mouse model of preterm labor: myometrial activation, stimulation, and preterm labor. Endocrinology 2000 141:1718-1728[Abstract/Free Full Text]
  20. Makino S, Zaragoza DB, Mitchell BF, Yonemoto H, Olson DM, Decidual Activation: Abundance and localization of prostaglandin F2alpha (FP) mRNA and protein and uterine activation proteins in human decidua at preterm and term birth. Placenta 2006 (in press)
  21. Romero R, Yoon BH, Mazor M, Gomez R, Diamond MP, Kenney JS, Ramirez M, Fidel PL, Sorokin Y, Cotton D, Sehgal P, The diagnostic and prognostic value of amniotic fluid white blood cell count, glucose, interleukin-6, and gram stain in patients with preterm labor and intact membranes. Am J Obstet Gynecol 1993 169:805-816[Medline]
  22. Dudley DJ, Hunter C, Mitchell MD, Varner MW, Clinical value of amniotic fluid interleukin-6 determinations in the management of preterm labour. Br J Obstet Gynaecol 1994 101:592-597[Medline]
  23. Romero R, Mazor M, Sepulveda W, Avila C, Copeland D, Williams J, Tumor necrosis factor in preterm and term labor. Am J Obstet Gynecol 1992 166:1576-1587[Medline]
  24. Romero R, Brody DT, Oyarzun E, Mazor M, Wu YK, Hobbins JC, Durum SK, Infection and labor. III. Interleukin-1: a signal for the onset of parturition. Am J Obstet Gynecol 1989 160:1117-1123[Medline]
  25. Romero R, Manogue KR, Mitchell MD, Wu YK, Oyarzun E, Hobbins JC, Cerami A, Infection and labor. IV. Cachectin-tumor necrosis factor in the amniotic fluid of women with intraamniotic infection and preterm labor. Am J Obstet Gynecol 1989 161:336-341[Medline]
  26. Opsjln SL, Wathen NC, Tingulstad S, Wiedswang G, Sundan A, Waage A, Austgulen R, Tumor necrosis factor, interleukin-1, and interleukin-6 in normal human pregnancy. Am J Obstet Gynecol 1993 169:397-404[Medline]
  27. Belt AR, Baldassare JJ, Molnar M, Romero R, Hertelendy F, The nuclear transcription factor NF-kappaB mediates interleukin-1beta-induced expression of cyclooxygenase-2 in human myometrial cells. Am J Obstet Gynecol 1999 181:359-366[CrossRef][Medline]
  28. Sooranna SR, Engineer N, Loudon JA, Terzidou V, Bennett PR, Johnson MR, The mitogen-activated protein kinase dependent expression of prostaglandin H synthase-2 and interleukin-8 messenger ribonucleic acid by myometrial cells: the differential effect of stretch and interleukin-1beta. J Clin Endocrinol Metab 2005 90:3517-3527[Abstract/Free Full Text]
  29. Narko K, Ritvos O, Ristimaki A, Induction of cyclooxygenase-2 and prostaglandin F2alpha receptor expression by interleukin-1beta in cultured human granulosa-luteal cells. Endocrinology 1997 138:3638-3644[Abstract/Free Full Text]
  30. Hertelendy F, Molnar M, Romero R, Interferon gamma antagonizes interleukin-1beta-induced cyclooxygenase-2 expression and prostaglandin E(2) production in human myometrial cells. J Soc Gynecol Investig 2002 9:215-219[CrossRef]
  31. Kniss DA, Rovin B, Fertel RH, Zimmerman PD, Blockade NF-kappaB activation prohibits TNF-alpha-induced cyclooxygenase-2 gene expression in ED27 trophoblast-like cells. Placenta 2001 22:80-89[CrossRef][Medline]
  32. Lappas M, Yee K, Permezel M, Rice GE, Lipopolysaccharide and TNF-alpha activate the nuclear factor kappa B pathway in the human placental JEG-3 cells. Placenta 2006 27:568-575[CrossRef][Medline]
  33. Lappas M, Permezel M, Georgiou HM, Rice GE, Regulation of phospholipase isozymes by nuclear factor-kappaB in human gestational tissues in vitro. J Clin Endocrinol Metab 2004 89:2365-2372[Abstract/Free Full Text]
  34. Allport VC, Pieber D, Slater DM, Newton R, White JO, Bennett PR, Human labour is associated with nuclear factor-kappaB activity which mediates cyclo-oxygenase-2 expression and is involved with the ‘functional progesterone withdrawal’. Mol Hum Reprod 2001 7:581-586[Abstract/Free Full Text]
  35. Perez-Reyes N, Halbert CL, Smith PP, Benditt EP, McDougall JK, Immortalization of primary human smooth muscle cells. Proc Natl Acad Sci U S A 1992 89:1224-1228[Abstract/Free Full Text]
  36. Schreiber E, Matthias P, Muller MM, Schaffner W, Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res 1989 17:6419[Free Full Text]
  37. Pfaffl MW, A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001 29:e45[Abstract/Free Full Text]
  38. Andela VB, Rosier RN, The proteosome inhibitor MG132 attenuates retinoic acid receptor trans-activation and enhances trans-repression of nuclear factor kappaB. Potential relevance to chemo-preventive interventions with retinoids. Mol Cancer 2004 3:8[CrossRef][Medline]
  39. Anwer K, Oberti C, Perez GJ, Perez-Reyes N, McDougall JK, Monga M, Sanborn BM, Stefani E, Toro L, Calcium-activated K+ channels as modulators of human myometrial contractile activity. Am J Physiol 1993 265:C976-985[Medline]
  40. Maher E, Bardequez A, Gardner JP, Goldsmith L, Weiss G, Mascarina M, Aviv A, Endothelin- and oxytocin-induced calcium signaling in cultured human myometrial cells. J Clin Invest 1991 87:1251-1258[Medline]
  41. Schrey MP, Read AM, Steer PJ, Oxytocin and vasopressin stimulate inositol phosphate production in human gestational myometrium and decidua cells. Biosci Rep 1986 6:613-619[CrossRef][Medline]
  42. Tasaka K, Masumoto N, Miyake A, Tanizawa O, Direct measurement of intracellular free calcium in cultured human puerperal myometrial cells stimulated by oxytocin: effects of extracellular calcium and calcium channel blockers. Obstet Gynecol 1991 77:101-106[Abstract/Free Full Text]
  43. Sato TA, Keelan JA, Mitchell MD, Regulation of prostaglandin production in an immortalized human myometrial cell line by cytokines and non-steroidal anti-inflammatory drugs. Eur J Obstet Gynecol Reprod Biol 2002 100:158-162[CrossRef][Medline]
  44. Grammatopoulos DK, Hillhouse EW, Basal and interleukin-1beta-stimulated prostaglandin production from cultured human myometrial cells: differential regulation by corticotropin-releasing hormone. J Clin Endocrinol Metab 1999 84:2204-2211[Abstract/Free Full Text]
  45. Pollard JK, Mitchell MD, Intrauterine infection and the effects of inflammatory mediators on prostaglandin production by myometrial cells from pregnant women. Am J Obstet Gynecol 1996 174:682-686[CrossRef][Medline]
  46. Allport VC, Slater DM, Newton R, Bennett PR, NF-kappaB and AP-1 are required for cyclo-oxygenase 2 gene expression in amnion epithelial cell line (WISH). Mol Hum Reprod 2000 6:561-565[Abstract/Free Full Text]
  47. Soloff MS, Cook DL, Jr. Jeng YJ, Anderson GD, In situ analysis of interleukin-1-induced transcription of cox-2 and il-8 in cultured human myometrial cells. Endocrinology 2004 145:1248-1254[Abstract/Free Full Text]
  48. Condon JC, Jeyasuria P, Faust JM, Mendelson CR, Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition. Proc Natl Acad Sci U S A 2004 101:4978-4983[Abstract/Free Full Text]
  49. Perkins ND, The Rel/NF-kappa B family: friend and foe. Trends Biochem Sci 2000 25:434-440[CrossRef][Medline]
  50. Natarajan K, Singh S, Burke TR, Jr. Grunberger D, Aggarwal BB, Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear transcription factor NF-kappa B. Proc Natl Acad Sci U S A 1996 93:9090-9095[Abstract/Free Full Text]
  51. Gyomorey S, Lye SJ, Gibb W, Challis JR, Fetal-to-maternal progression of prostaglandin H(2) synthase-2 expression in ovine intrauterine tissues during the course of labor. Biol Reprod 2000 62:797-805[Abstract/Free Full Text]
  52. Palliser HK, Hirst JJ, Ooi GT, Rice GE, Dellios NL, Escalona RM, Parkington HC, Young IR, Prostaglandin e and f receptor expression and myometrial sensitivity at labor onset in the sheep. Biol Reprod 2005 72:937-943[Abstract/Free Full Text]
  53. Verma IM, Stevenson JK, Schwarz EM, Van Antwerp D, Miyamoto S, Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 1995 9:2723-2735[Free Full Text]
  54. Chapman NR, Europe-Finner GN, Robson SC, Expression and deoxyribonucleic acid-binding activity of the nuclear factor kappaB family in the human myometrium during pregnancy and labor. J Clin Endocrinol Metab 2004 89:5683-5693[Abstract/Free Full Text]
  55. Saccani S, Pantano S, Natoli G, Modulation of NF-kappaB activity by exchange of dimers. Mol Cell 2003 11:1563-1574[CrossRef][Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
J. M. Willets, A. H. Taylor, H. Shaw, J. C. Konje, and R. A. J. Challiss
Selective Regulation of H1 Histamine Receptor Signaling by G Protein-Coupled Receptor Kinase 2 in Uterine Smooth Muscle Cells
Mol. Endocrinol., August 1, 2008; 22(8): 1893 - 1907.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Z. Liang, S.R. Sooranna, N. Engineer, M. Tattersall, S. Khanjani, P.R. Bennett, L. Myatt, and M.R. Johnson
Prostaglandin F2-alpha receptor regulation in human uterine myocytes
Mol. Hum. Reprod., April 1, 2008; 14(4): 215 - 223.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
G. Chevillard, A. Derjuga, D. Devost, H. H Zingg, and V. Blank
Identification of interleukin-1{beta} regulated genes in uterine smooth muscle cells
Reproduction, December 1, 2007; 134(6): 811 - 822.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
75/5/697    most recent
biolreprod.106.053439v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.
Agricola
Right arrow Articles by Zaragoza, D. B.
Right arrow Articles by Olson, D. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS