Biol Reprod
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print November 1, 2006.
Biol Reprod 2006, 10.1095/biolreprod.106.054619
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
76/2/303    most recent
biolreprod.106.054619v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hoshii, T.
Right arrow Articles by Yamamura, K.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoshii, T.
Right arrow Articles by Yamamura, K.-i.
Agricola
Right arrow Articles by Hoshii, T.
Right arrow Articles by Yamamura, K.-i.
BIOLOGY OF REPRODUCTION 76, 303–313 (2007)
DOI: 10.1095/biolreprod.106.054619
© 2007 by the Society for the Study of Reproduction, Inc.

research-article

LGR4 Regulates the Postnatal Development and Integrity of Male Reproductive Tracts in Mice1

Takayuki Hoshii 3, Toru Takeo 4, Naomi Nakagata 4, Motohiro Takeya 5, Kimi Araki 2, and Ken-ichi Yamamura 2 3

Division of Developmental Genetics,3 Institute of Molecular Embryology and Genetics, and Division of Reproductive Engineering,4 Institute of Resource Development and Analysis, Kumamoto University, Kumamoto 860-0811, Japan Department of Cell Pathology,5 Kumamoto University School of Medicine, Kumamoto 860-8556, Japan

ABSTRACT

The roles of the leucine-rich repeat domain containing G protein-coupled receptor (GPCR) 4 (Lgr4), which is one of the orphan GPCRs, were analyzed with the Lgr4 hypomorphic mutant mouse line (Lgr4Gt). This homozygous mutant had only one-tenth the normal transcription level; furthermore, 60% of them survived to adulthood. The homozygous male was infertile, showing morphologic abnormalities in both the testes and the epididymides. In the testes, luminal swelling, loss of germinal epithelium in the seminiferous tubules, and rete testis dilation were observed. Cauda epididymidis sperm were immotile. Rete testis dilation was due to a water reabsorption failure caused by a decreased expression of an estrogen receptor (ESR1) and SLC9A3 in the efferent ducts. Although we found differential regulation of ESR1 expression in the efferent ducts and the epididymis, the role of ESR1 in the epididymis remains unclear. The epididymis contained short and dilated tubules and completely lacked its initial segment. In the caput region, we observed multilamination and distortion of the basement membranes (BMs) with an accumulation of laminin. Rupture of swollen epididymal ducts was observed, leading to an invasion of macrophages into the lumen. Male infertility was probably due to the combination of a developmental defect of the epididymis and the rupture of the epithelium resulting in the immotile spermatozoa. These results indicate that Lgr4 has pivotal roles to play in the regulation of ESR1 expression, the control of duct elongation through BM remodeling, and the regional differentiation of the caput epididymidis.

developmental biology, epididymis, estradiol receptor, male reproductive tract, steroid hormone receptors

INTRODUCTION

Posttesticular sperm transit through the efferent ducts and epididymis in vivo is essential for sperm maturation, protection, and storage [1, 2]. The epididymis develops from the wolffian duct and is finally formed as a highly elongated and convoluted tubule that links the efferent ducts to the vas deferens. The adult epididymis anatomically consists of the caput, the corpus, and the cauda epididymidis. On the basis of macroscopic, histologic, ultrastructural, and histochemical observations, the caput epididymidis can be divided into five distinct regions [3]. Most proximal regions of the caput epididymidis, named the initial segment, consist of taller epithelial cells than any other caput regions. These regional differentiations, with the different cellular structures, are achieved within 28 days after birth [4]. Epididymal regions, having different morphologies and functions, show highly restricted gene expression patterns: for example, Gpx5, Lcn2, and Etv4 are expressed in the whole caput epididymidis [5–7]. Cst11, Cst12, and Lcn8 (previously known as mEP17) are expressed in the initial segment [6, 8]. The expressions of Gpx5, Lcn2, Etv4, and Lcn8 are thought to be controlled by testicular fluid, which contains steroid hormones and growth factors such as fibroblast growth factors [5–7, 9, 10].

Steroid hormone receptors for androgen and estrogen are required for epididymal development and functioning. These roles were analyzed with mutant mice. The essential role of the androgen receptor (Ar), for early male development, was analyzed by examining the testicular feminization mutation (ArTfm) in mice [11]. The ArTfm/Y mice completely lack both the epididymis and the vas deferens. In addition to the Ar, two estrogen receptors (Esr1 and Esr2) are expressed in the posttesticular tracts [12]. ESR1 (previously known as ERalpha) is mainly expressed in the efferent ducts; the Esr1–/– mice showed a water reabsorption failure in the efferent ducts and had a reduced male fertility rate [13, 14]. Recent reports indicate that ESR1 controls water reabsorption via regulation of Slc9a3 (previously known as NHE3) and aquaporin 1 (Aqp1), which are both directly involved in the water reabsorption process [15]. In contrast to the Esr1–/– mice, the Esr2–/– mice did not show any abnormality in the development or function of either the efferent duct or the epididymis [16]. Production of double mutants of ESR1 and ESR2 confirms the pivotal role of ESR1, but not of ESR2, in the efferent ducts [17]. Although both of the estrogen receptors are expressed in the epididymis, their functions are not yet well understood.

Although it is clear that the AR is indispensable for the early development of the epididymis from the wolffian duct, other factors required for the development of the detailed regional compartmentalization are not well understood. When upper and middle wolffian duct epithelium is cultured on the seminal vesicle mesenchyme, this epithelium differentiates into the seminal vesicle epithelium [18]. This suggests that wolffian duct differentiation is controlled by the epithelial-mesenchymal interaction. Epithelial differentiation, induced by the mesenchyme, is well exemplified in ureteric bud branching of the developing kidneys. Since both kidneys and male reproductive tracts are developed from the same origin, the intermediate mesoderm, a similar set of signaling molecules may be involved in the development of both of these organs.

Possible factors accounting for this epithelial-mesenchymal interaction are bone morphogenetic protein (BMP) ligands and their related receptors. Disruption of Bmp4, Bmp7, Bmp8a, or Bmp8b shows that degeneration of the epididymal epithelium occurs in a region-specific manner [19–22]. Bmp4+/– mice especially showed epididymal degeneration in the corpus region. These results demonstrate that the BMP family ligands have a pivotal role in epididymal duct development and in maintaining its resulting integrity. Another possible factor that regulates the epithelial-mesenchymal interactions in the epididymis is ROS1, which is a member of the tyrosine kinase receptor family. In the developing kidneys, ROS1 is suggested as an upregulator of the expression of the extracellular matrix (ECM), which acts as a storage depot for various growth factors [23]. The Ros1–/– mice lack the initial segment [24]. These results suggest that detailed regional development is also dependent on highly regulated epithelial-mesenchymal interactions.

A recent study, by use of the Lgr4–/– mice obtained by the secretory trap approach, suggested an essential role for LGR4 in embryonic growth, especially for kidney and liver development [25]. In addition, Lgr4–/– mice with CD1 genetic backgrounds show the defective postnatal development of the epididymis [26]. This suggests that hypoplastic and dilated efferent ducts, as well as the epididymis, were all due to reduced cell proliferation rates and the blocking of the lumen by immune cell infiltrates, respectively. LGR family members are characterized by an extracellular domain with multiple leucine-rich repeats. The presence of a large extracellular domain is a remarkable feature that separates LGR family members from the other G protein-coupled receptors (GPCRs). Studies of LGRs from different species suggest that LGRs can be classified into three subtypes (A, B, and C) and that these three subtypes evolve during the early evolution of metazoans [27]. Type A LGRs include the FSH receptor, the LH receptor, and the thyroid-stimulating hormone receptor, in which the ligands are glycoprotein hormones. Type B LGR comprises three members: LGR4, also known as GPR48, LGR5, and LGR6. Type B LGR remains an orphan GPCR, and its physiological functions have not yet been determined. Type C LGRs, including LGR7 and LGR8, have recently been described as relaxin receptors. Following the identification of LGR7 and LGR8 as relaxin receptors, the closely related relaxin3 and INSL3 have been shown to function as selective agonists for LGR7 and LGR8, respectively.

We obtained an Lgr4 hypomorphic mutant (Lgr4Gt/Gt) with gene-trap insertional mutagenesis in embryonic stem cells with an exchangeable trap vector [28]. Contrary to the epididymides of the Lgr4–/– mice, by 8 wk after birth, the epididymides of Lgr4 hypomorphic mutant mice have testicular fluid and contain immotile spermatozoa. Thus, we hypothesize that the epididymal phenotype of the Lgr4Gt/Gt male is unrelated to the transit blockage of the testicular fluid. Our mutant mice showed a milder phenotype than the null mutant mice in terms of their growth and perinatal death rate. Adult males of our mouse line showed short, dilated, and much less convoluted ducts in the epididymides. In the postnatal development of the epididymis, we found a reduction of ESR1 expression and a lack of an initial segment in the epididymides; furthermore, electron microscopic and immunohistochemical studies of the epididymal tubule structure in Lgr4Gt/Gt males indicated the disruption of the ECM structure with an increase of laminin. Our results suggest that the Lgr4 gene regulates the postnatal epididymal morphogenesis via the maintenance of the ECM.

MATERIALS AND METHODS

Generation of Gene-Trap Mice

The Ayu21–127 embryonic stem clone was isolated in a gene-trap screening with the pU-21 vector. The pU-21 vector was generated by modifying the pU-17 vector [28]. This gene-trap mouse line was established by aggregating the embryonic stem cells with eight-cell embryos as described by Taniwaki et al. [28]. The chimeric male mice were crossed either with C57BL/6J or CBA/N Slc females. In this study, we used the F5 generation of mice. C57BL/6J mice were purchased from Charles River Japan Inc. (Yokohama, Japan). CBA/N Slc mice were purchased from Japan SLC Inc. (Hamamatsu, Japan). Mice were housed in the Center for Animal Resources and Development, Kumamoto University. All animal experiments were carried out with the approval of the Ethical Committee at the Center for Animal Resources and Development, Kumamoto University.

Cloning of Genomic DNA and Genotyping

Inverse PCR was performed to obtain flanking genomic DNA. DNA samples were isolated from the embryonic stem cells. After identification of the trap-vector insertion site, we set three PCR primers for genotyping. Genotyping was carried out by PCR with genomic DNA purified from a tail tip. To detect a wild-type allele, two primers were used: a 5' primer, G1 (ACATCTACCCTCTGCTTTCACC), and a 3' primer, G2 (ATCCACTTGTTCCTGACCTGAG). G1 and another 3' primer, G3 (AAGAACATAAAGTGACCCTCC), were used to detect a trapping allele. For PCR analysis, the DNA was subjected to 30 cycles (1 min at 94°C; 1 min at 62°C; and 1 min at 72°C) with 0.5 U of Taq polymerase (Perkin-Elmer, Foster City, CA).

Sperm Concentration and Motility Analysis

Sperm were collected from the cauda epididymidis at 8 wk of age and incubated in 200 µl of human tubal fluid (HTF) medium at 37°C for 1 h. The concentrations and motility rates were determined with a C-IMAGING C-MEN computerized semen analyzer (Compix Inc., Lake Oswego, OR). All counts were performed at 37°C. Motility was defined as linear direction at a speed of 50 µm/sec [29]. Viability of the incubated spermatozoa was assayed with the LIVE/DEAD Sperm Viability Kit (Invitrogen, Carlsbad, CA).

RNA Analysis

Rapid amplification of cDNA ends (RACE) by the 5' RACE system (Invitrogen) was used to characterize the trapped gene. Total RNAs were extracted from various tissues and were used for RT-PCR and real-time PCR analyses. For Northern blot analysis, 1 mg of poly(A)+ RNAs isolated from various tissues was purified with the Oligotex-dT30 mRNA Purification Kit (Takara Shuzo, Kyoto, Japan). For the Northern blotting analysis, a murine Lgr4 cDNA probe (probe A), a ß-galactosidase probe (probe B), and a glyceraldehyde-3-phosphate dehydrogenase (Gapdh) probe were prepared with digitoxin (DIG)-labeled antisense riboprobes (Roche Molecular Biochemicals, Mannheim, Germany). Each cDNA template was amplified by RT-PCR, and the PCR product was then linked to a pGEM-T Easy Vector (Promega, Madison, WI). Transcription from the template vector was performed with SP6 or T7 on RNA polymerase and then purified on Quick Spin Columns (Bio-Rad, Hercules, CA). Primers used in the RT-PCR included the following: R1 (CTTCACCCAAGCACTGGATATCAG) located in the second exon; R2 (TGCAAAGCACTCAGTCCACGAATG) located in the third exon; and R3 (ACAGTATCGGCCTCAGGAAG) located in the splice acceptor of the trap vector. Real-time PCR was performed with SYBR Green (Takara Shuzo), and each RNA quantity was normalized to its respective Gapdh mRNA quantity.

Fertility Tests

Lgr4Gt/Gt mice 8–10 wk of age were used to mate with wild-type mice. +/Gt mice were also mated as a control. All mating completions were verified by examining vaginal plugs.

In Situ Hybridization

In situ hybridization analyses were performed on adult tissue sections with a VENTANA in situ hybridization machine (Ventana Medical Systems Inc., Tucson, AZ). All tissues were fixed with 4% paraformaldehyde in PBS for 48 h at room temperature and cryosectioned. The DIG-labeled Gpx5, Lcn2, Cst12, and Lcn8 antisense and sense riboprobes (Roche) were prepared as described above.

Measurement of Serum Estradiol and Testosterone

Serum estradiol and testosterone concentrations were measured commercially by RIA (SRL Inc., Tokyo, Japan) when the mice were 8 wk of age. To measure the serum estradiol and testosterone levels, blood was withdrawn from the retro-orbital sinus by penetrating the retro-orbital sinus/plexus with a glass capillary tube after the mice were anesthetized with ether.

Detection of ß-galactosidase Activities

To detect LGR4 expression levels, we determined the ß-galactosidase activity produced by the trapped allele. Samples were fixed for 30–60 min at room temperature in 1% formaldehyde, 0.2% glutaraldehyde, and 0.02% NP-40. Fixed samples were washed two times in PBS and incubated for 16 h at 37°C in a staining solution of 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl2, and 0.5% X-gal in PBS. Samples were washed twice in PBS and then postfixed in 4% paraformaldehyde.

Immunohistochemical Staining

Epididymal tissues were fixed with 4% paraformaldehyde in PBS for 24 h at 4°C. Paraffin-embedded tissues were sectioned, dewaxed, and rehydrated. Frozen sections were used to determine type IV collagen and laminin expression levels. Sections were incubated with the primary antibody in 3% BSA in PBS for 16 h at 4°C. In the present study, the following antibodies and dilutions were used: diluted anti-ESR1 (DAKO, Carpinteria, CA), 1:2; anti-ESR2 (Chemicon, Temecula, CA), 1:500; anti-AR (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), 1:500; anti-type IV collagen (Southern Biotech, Birmingham, AL), 1:8000; anti-laminin (DAKO), 1:6000; anti-CD68 (Serotec), 1:100; and anti-MSR1 (unpublished results). After washing, sections were incubated with the corresponding secondary antibodies (all in 1:200 dilutions) for 1 h at room temperature. To detect with anti-mouse antibody, sections were blocked with a commercially available reagent and detected with a commercial kit (Vector Laboratories, Burlingame, CA). The Vectastain ABC Kit (Vector Laboratories) was used for the avidin-biotin complex method according to the manufacturer's instructions and detected with diaminobenzidine. Immunofluorescent signals were observed with a TCS-SP2 AOBS confocal microscope (Leica Microsystems).

Western Blot Analysis

The epididymides were homogenized in a lysate buffer and purified with acetone precipitation. Extracts were applied to 8% polyacrylamide gel electrophoresis and transferred to an Immobilon polyvinylidene difluoride filter (Millipore, Billerica, MA). Primary antibodies for the following antigens were used at the indicated dilutions: anti-type IV collagen (LSL, Tokyo, Japan), 1:500; anti-laminin (DAKO), 1:500; anti-AR (Santa Cruz Biotechnology), 1:500; and anti-actin (Santa Cruz Biotechnology), 1:500. Anti-rabbit (Amersham Biosciences) or anti-goat (Santa Cruz Biotechnology) immunoglobulin G antibody conjugated with horseradish peroxidase was used for detection purposes.

Electron Microscopy

Spermatozoa collected from cauda epididymidis were incubated in HTF medium for 30 min and fixed in HTF medium with 2% glutaraldehyde for 20 min. The samples were postfixed in an unbuffered 2% osmium tetroxide solution for 3 h and then dehydrated in ascending grades of alcohol. Subsequently, they were critically point dried, osmium plasma coated, and examined by a Jeol JSM 6320 F scanning electron microscope (Jeol Ltd., Tokyo, Japan). The caput epididymides in 5-wk-old males were fixed with 2.5% glutaraldehyde and postfixed with 1% osmium tetroxide. After dehydration in a graded series of ethanol and propylene oxide, the samples were embedded in epoxy resin. Ultrathin sections were stained with uranyl acetate and lead citrate and then imaged with an H-7500 electron microscope (Hitachi, Tokyo, Japan).

RESULTS

Establishment of Ayu21–127 Line and Identification of Trapped Genes

We performed gene-trap mutagenesis in embryonic stem cells with pU-21 trap vectors (Fig. 1A) and thereby isolated 88 gene-trap embryonic stem clones. We identified trapped genes by the 5' RACE. Several mutant mouse lines were established through the production of chimeric mice with these trapped embryonic stem clones. Among these lines, we selected the 127 line, termed the B6;CB-Lgr4GtAyu21-127Imeg (Lgr4Gt) in which the Lgr4 is trapped, to further analyze the physiological functions of LGR4. Southern blot analysis, with a vector fragment as a probe, indicated a single-copy integration of the vector (data not shown). Analysis of the genomic region around the insertion site revealed that the trap vector was integrated into the second intron of the Lgr4 gene (Fig. 1A). We confirmed that the trap-vector integration event resulted in either a 628- or 562-bp deletion in the 5' or 3' region of the trap vector, respectively. No deletion occurred in the genomic region around the insertion site. Genotyping was done with G1 and G2 primers for a wild-type (+) allele and G1 and G3 primers for the gene-trap (Gt) allele (Fig. 1B).


Figure 76030201
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1. Hypomorphic mutant of the Lgr4 gene. A) The trap vector, pU-21, was inserted into the second intron of the Lgr4 gene. G1–3 primers (red arrowheads) were used for the genotyping, and R1–3 primers (blue arrowheads) were used for RT-PCR to detect endogenous Lgr4 mRNA or fusion mRNA. DIG-labeled RNA probes (probes A and B) were used for the Northern blot analysis. B) PCR genotyping. The wild-type (+) or trap (Gt) allele is detected with G1 and G2 or G1 and G3 primer sets, respectively. C) Northern blotting analyses (upper) and RT-PCR analyses (lower) with various tissues +/+ and Gt/+ mice, respectively. Br, Brain; He, heart; Lu, lung; Li, liver; Sp, spleen; Ki, kidneys; St, stomach; In, intestine; Ut, uterus; Te, testes; Ep, epididymides. D) Northern blot analyses with kidney extracts to detect Lgr4 and fusion mRNA in each genotype. E) Quantitative RT-PCR analysis with newborn brain extracts to detect Lgr4 mRNA in each genotype.

Northern blot analysis, with various adult tissues of wild-type mice, indicated the broad expression of the Lgr4 gene as described by Mazerbourg et al. [25] and Schoore et al. [30]. RT-PCR analyses, with tissues of Lgr4+/Gt mice the same as in Northern blot analyses, showed that all tissues had the fusion mRNA composed of exons 1 and 2 in the Lgr4 gene and of a ß-geo gene of the trap vector (Fig. 1C). Mating between Lgr4+/Gt parents generated Lgr4Gt/Gt mice. Northern blot analysis and quantitative RT-PCR showed that the Lgr4Gt/Gt mice had 10% mRNA expression of the Lgr4 gene (Fig. 1, D and E). These results prove that the Lgr4Gt/Gt mouse is a hypomorphic mutant.

Growth Retardation

We investigated the ratio of each genotype among the newborn mice obtained by the mating of the Lgr4+/Gt parents, and the resulting ratio was consistent with the expected mendelian distribution. With the C57BL/6J genetic background, about 85% of the homozygous mice died during the postnatal development period (Fig. 2A); however, with the CBA genetic background, 60% of the offspring survived, but they showed growth retardation (Fig. 2, A and B). Offspring in the CBA background group were used in the following studies.


Figure 76030202
View larger version (62K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2. Lgr4Gt/Gt mice showed a male-sterile phenotype. A) Survival rate of each genotype. Homozygotes are measured on the CBA and C57BL/6J (B6) genetic background (n = 15). B) Growth curve of the +/+, +/Gt, and Gt/Gt mice from birth to adulthood (n = 10; mean ± SEM). C) Caudal sperm concentrations at 8 wk of age in each genotype. The sperm concentration in 200 µl of HTF medium, prepared in the same way as for the sperm for performing in vitro fertilization, was measured (n = 10; bar = mean). D) Percent motile of caudal sperm at 8 wk of age in each genotype. **P < 0.01 (unpaired Student t-test) vs. +/+ males; n = 10 in +/+ and +/Gt, n = 6 in Gt/Gt; mean ± SEM. E, F) Scanning electron microscope of the spermatozoa of +/+ and Gt/Gt males. Each inset indicates the higher magnification of cytoplasmic droplet (CD) and flagellum (Fl) at the midpiece-principal piece junction on the spermatozoa. Bar = 5 µm (E, F).

Male Infertility

To analyze fertility, we carried out a breeding test (Table 1). Lgr4Gt/Gt males exhibited normal copulative behaviors. Although we confirmed that the vaginal plug in all wild-type females mated with Lgr4Gt/Gt males, no pregnancies were observed. Although the pregnancy rate between wild-type males and Lgr4Gt/Gt females was reduced, the impregnated females sired and nursed their pups normally. These results indicate that the Lgr4 deficiency causes infertility in the male but not in the female.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 1. Fertility tests of Lgr4Gt/Gt mice.

Immotile Sperm

To examine the reason for the male infertility, we first analyzed sperm concentrations and motility in the cauda epididymidis of Lgr4Gt/Gt males. The concentration of spermatozoa in the cauda epididymidis of Lgr4Gt/Gt males was very variable, but there were no intragroup differences in sperm concentrations (Fig. 2C). However, almost all of the spermatozoa in the homozygous epididymides were either immotile or much less motile than normal (Fig. 2D). Sperm viability assay, by means of staining with SYBR14 and propidium iodide, demonstrated that the mean ± SD of live/dead spermatozoa in three individuals were 252.3 ± 67.0/147.0 ± 30.3 and 1.7 ± 1.5/317.0 ± 121.2 in +/Gt and Gt/Gt, respectively, indicating that the viability was significantly decreased in Lgr4Gt/Gt males. Electron microscopic studies showed a hairpin structure of spermatozoa at the midpiece-principal piece junction and large cytoplasmic droplet (Fig. 2, E and F). The boundary between sperm flagellum and cytoplasmic droplet was obscure (Fig. 2F). These data suggested that the male infertility of Lgr4Gt/Gt mice was caused by the immotility and abnormal structure of the sperm.

Rete Testis Dilation and ESR1 Reduction in Efferent Ducts

To examine the effect on spermatogenesis, we analyzed the testes. There were no significant differences in testis weight between wild types, heterozygotes, and homozygotes 8 wk of age; however, as shown in Figure 3A, there was a tendency of testis weight in homozygous mice to be slightly increased over that of the wild-type or heterozygous mice. Histologic analysis of the testes in Lgr4Gt/Gt males revealed rete testis dilation, luminal swelling, and atrophy of the germinal epithelium of the seminiferous tubules (Fig. 3, B and C). Rete testis dilation was previously reported in Esr1–/– or Slc9a3–/– mice [14, 15]. Furthermore, ESR1 and SLC9A3 are both now well-known key molecules that regulate water reabsorption in efferent ducts [13]. To examine the expression levels of ESR1 and SLC9A3, we performed immunohistochemical analyses with anti-ESR1 and anti-SLC9A3 antibodies. At 8 wk of age, both molecules were detected in the epithelial cells of the efferent ducts of the wild-type mice (Fig. 3, D and E). On the other hand, the levels of ESR1 and SLC9A3 expression in the efferent ducts of Lgr4Gt/Gt males 8 wk of age were lower than those in the wild-type males (Fig. 3, F and G).


Figure 76030203
View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3. Rete testis dilation and ESR1 reduction in the efferent ducts. A) Relative reproductive organ weight in each genotype. **P < 0.01 (unpaired Student t-test) vs. +/+ males; n = 8; mean ± SEM. Te, Testes; Ep, epididymides; Ki, kidneys; Sp, spleen. B, C) Testis histology of 8-wk-old males in +/+ and Gt/Gt males. Each inset indicates the higher magnification of the seminiferous tubules. Immunostaining for ESR1 (D, E) and SLC9A3 (F, G) in the efferent ducts of 8-wk-old males in +/+ and Gt/Gt males. Bar = 400 µm (B, C) and 50 µm (D–G).

Taken together, these results suggest that ESR1 reduction results in a water reabsorption failure, which leads to rete testis dilation and spermatogenesis impairment in Lgr4Gt/Gt males.

Developmental Defect in the Epididymis of Lgr4Gt/Gt Males

Weight of the epididymides in Lgr4Gt/Gt males was significantly lower than that of wild-type and heterozygous littermates (Fig. 3A). Macroscopically, the epididymides contained short and dilated tubules with uneven sperm distribution (Fig. 4A). As ESR1 and SLC9A3 expression was reduced in the efferent ducts, we also examined the expression of ESR1 and SLC9A3 in the epididymis. In the epithelial cells of the caput epididymidis, only ESR1 was detectable (Fig. 4, B and C). The expression level of ESR1 in Lgr4Gt/Gt males was much lower than in wild-type males (Fig. 4D). SLC9A3 staining was not detectable in the caput epididymidis of Lgr4Gt/Gt males (Fig. 4E). We further examined when the expression of ESR1 started to decrease during the postnatal epididymal development in Lgr4Gt/Gt males. The ESR1 expression level increased gradually up to 3 wk of age in the caput epididymidis of the control littermates (Fig. 4, F–I). In contrast, the ESR1 expression level decreased and disappeared by 3 wk of age in Lgr4Gt/Gt males (Fig. 4, J–M).


Figure 76030204
View larger version (88K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4. Decreased expression of ESR1 in mutant caput epididymidis. A) Morphology of the caput epididymidis of the +/+ and Gt/Gt males. White arrow indicates the clear region that lacks sperm in the tubule. B–E) Immunostaining for ESR1 and SLC9A3 in the caput epididymides of 8-wk-old males. F–M) Immunostaining for ESR1 in the caput epididymidis of +/+ and Gt/Gt males 0, 1, 3, and 5 wk of age. N–Q) Immunostaining for AR and ESR2 in the caput epididymidis of +/+ and Gt/Gt males 1 wk of age. R, S) Serum estradiol and testosterone levels of +/Gt and Gt/Gt males 8 wk of age. Bar = 1 mm (A) and 50 µm (B–Q).

Contrary to the sharp decrease of ESR1 expression level, the expression of AR and ESR2 was normal during the development of the epididymides (Fig. 4, N–Q). In addition, we measured the serum estradiol and testosterone levels in 8-wk-old mice; however, there were no significant differences in serum estrogen or testosterone levels between wild-type and Lgr4Gt/Gt mice (Fig. 4, R and S).

By 35 days after birth, the normal mature caput epididymidis can be subdivided into three regions: initial segment, proximal caput, and distal caput [31]. The initial segment in the epididymis of wild-type males is distinct from the other caput regions. To examine the differentiation of the epididymal region in Lgr4Gt/Gt males, we performed a section in situ hybridization with antisense riboprobes for marker mRNAs, Cst12 [8], and Lcn8, also known as mEP17 [6, 32], Gpx5 [7], and Lcn2 [6]. Cst12 and Lcn8 were shown to be expressed in the initial segments that differentiated first in the whole caput epididymidis. We could detect the expression of Cst12 and Lcn8 in wild-type mice (Fig. 5, A and C) but not in Lgr4Gt/Gt mice (Fig. 5, B and D). On the other hand, Gpx5 and Lcn2 were shown to be expressed in the proximal epididymis region. We detected the strong expression of Gpx5 and Lcn2 in the proximal epididymis regions in both wild-type and Lgr4Gt/Gt mice (Fig. 5, E–H). These results suggest that LGR4 has an essential role in the differentiation of the initial segment during the postnatal development period of the epididymis.


Figure 76030205
View larger version (106K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5. Section in situ hybridization of Cst12 (A, B), Lcn8 (C, D), Gpx5 (E, F), and Lcn2 (G, H) in the efferent ducts (ED), caput (Ca), and proximal corpus (Co) epididymidis of +/+ (A, C, E, G) and Gt/Gt males (B, D, F, H) 8 wk of age. Cst12 and Lcn8 signals indicate the initial segment (IS) in the caput epididymidis. Bar = 1.0 mm.

Electron Microscopic Analysis of Caput Epididymal Tubules

To determine the cause for the epididymal abnormal morphogenesis in Lgr4Gt/Gt males, we performed transmission electron microscopic analysis at 5 wk after birth. In wild-type males, epithelial cells in the caput epididymal tubules displayed numerous vesicles and coated pits indicative of active endocytosis, and they also displayed an expanded Golgi apparatus at the upper side of the nucleus (Fig. 6A). In Lgr4Gt/Gt males, epithelial cells showed less endocytosis and few secretion components (Fig. 6B). We also observed detachment of basal cells from adjacent epithelial cells in Lgr4Gt/Gt males (Fig. 6B). In some epithelial layers, we found macrophage-like cells, which have amoebic cell membranes and lysosomal granules, on the basal side (Fig. 6C), but not on the apical side, of the epithelial cell layer.


Figure 76030206
View larger version (142K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 6. Electron microscopy of the caput epididymidis of +/Gt and Gt/Gt males 5 wk of age. A) Normal epithelial and peripheral cell layers of the caput epididymal tubules in +/Gt males. B) Detachment of basal cells and thickening of the peripheral cell layer of the caput epididymal tubules in Gt/Gt males. C) Macrophage-like cell invasion into the epithelial cell layer in Gt/Gt males. D–F) Apical surface of the epithelial cells. Smooth surfaced secretory vesicles (open arrowheads) and small vesicles in +/Gt males are not seen in Gt/Gt males. Tight junctions (black arrows) at the apical surface between epithelial cells were observed in both genotypes. G–I) Basement membranes under the epithelial cell layers (black arrowheads). A consecutive thin layer was observed in +/Gt males. In Gt/Gt males, basement membranes with multilayers (H) or depositions (I) were observed. Bar = 5 µm (A–C) and 2.5 µm (D–I).

Normally, these epithelial cells form the blood-epididymal barrier (BEB), which regulates small substance transition into the lumen of the epididymal tubules and protects spermatozoa from attack by the self immune system, like the blood-brain barrier, blood-thymus barrier, and blood-testis barrier [33]. In the epididymis, formation of the BEB is accomplished by the tight junction between the apical sides of the epithelial cells [33]. Thus, we examined the tight junction formation at a higher magnification; however, we did not observe any abnormalities in the tight junctions (Fig. 6, D–F).

The basement membranes (BMs) of wild types appeared as a thin continuous layer closely in contact with basal cells, which usually form a monolayer (Fig. 6G). In Lgr4Gt/Gt males, the BMs showed multilamination and distortion (Fig. 6, H and I). In addition, an accumulation of ECM-like material was observed toward the mesenchymal cell layers (Fig. 6, H and I).

Laminin Accumulation in the Epididymis

To characterize the ECM-like deposits in the BM in detail, we performed periodic acid-methenamine-silver (PAM) staining. In the caput epididymidis of Lgr4Gt/Gt mice, the distribution of the ECM, as demonstrated by PAM staining, was more diffuse around the mesenchymal cell layer than it was in wild-type mice (Fig. 7, A–D). In the epididymis, the ECM is composed primarily of type IV collagen and laminin isoforms [34]. Immunohistochemical analysis for type IV collagen showed similar staining in the caput and cauda of both wild-type and Lgr4Gt/Gt mice (Fig. 7, E–H). On the other hand, immunohistochemical analysis for laminin showed intense staining in the caput epididymidis (Fig. 7, I and J) but not in the cauda epididymidis (Fig. 7, K and L) of Lgr4Gt/Gt mice. Laminin positive staining was observed, though in the lumen of the cauda epididymidis (Fig. 7L). As expected, the total amount of laminin in the epididymides was increased in Lgr4Gt/Gt males, as was verified by Western blot analysis (Fig. 7M). Double staining with DAPI (4',6'-diamidino-2-phenylindole), which can stain spermatozoal nuclei, and anti-laminin antibody indicated that the laminin bound to the sperm heads of Lgr4Gt/Gt males (Fig. 7, N–S). These results suggest that laminin accumulation in the BM contributes to the abnormal morphology of the epididymis and that the laminin is somehow leaked into the lumen.


Figure 76030207
View larger version (106K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 7. Alteration of ECM components in the epididymides of Gt/Gt males 8 wk of age. PAM staining (A–D) and immunostaining for type IV collagen (E–H) and laminin (I–L). Strong signals of laminin were detected at the caput epididymal tubules (black arrows in J) and at the lumen of the cauda epididymal tubules (asterisk in L). M) Western blotting analyses for type IV collagen (Col IV), laminin, AR, and actin. Polyclonal laminin antibody, which is used in immunohistochemistry, detected the 250-kDa laminin components as a single positive band. AR and actin were used as controls. N–S) Immunofluorescence staining for laminin with the spermatozoa in the cauda epididymidis of +/+ and Gt/Gt males. Bar = 100 µm (A–L) and 5µm (N–S).

Macrophages in the Lumen of the Epididymal Tubules

With electron microscopic analysis, we discovered macrophage-like cells in the epithelium. These macrophage-like cells were observed under the tight junctions of the epithelial cells. To confirm whether these cells were macrophages, we performed immunohistochemical staining for CD68 and MSR1 (known as CD204). In the wild-type mice, CD68, but not MSR1, was detected in the epithelial cells of segment III of the caput epididymidis; both of these molecules are well-known macrophage markers (Fig. 8, A and B). The CD68 staining, at the differentiated epididymal region, was not observed in the epithelium of the Lgr4Gt/Gt epididymides. This result was consistent with the previous result that an initial segment was missing in Lgr4Gt/Gt males. This was detected by a section in situ hybridization with the Cst12 and Lcn8 as probes. In the wild-type mice, except for segment III of the caput epididymidis, CD68 or MSR1 positive cells were seen only in the interstitial tissues of the caput epididymidis; they were not seen in either the lumen or epithelium (Fig. 8, C and D). On the other hand, CD68 and/or MSR1 positive cells were sparsely distributed in some areas of both the lumen and the epithelium of the Lgr4Gt/Gt epididymides (Fig. 8, E–H). All the positive macrophage marker cells between the epithelial cells were seen under the apical surface of the epithelial cell layer (Fig. 8, G and H). In a few Lgr4Gt/Gt males, we did not observe any macrophages in the lumen (Fig. 8, I and J). Massive macrophage intrusions were seen near the ruptured tubule structures (Fig. 8, K and L). These results suggest that dilation of the tubules, caused by water retention, disrupts the tubular structure, thereby leading to an intrusion of macrophages into the lumen.


Figure 76030208
View larger version (118K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 8. Immunostaining for CD68 (A–C and G–I) and MSR1 (D–F, J–L) in the caput (A–H, J, K) and the corpus (I, L) epididymidis. A) In the control, CD68 was positive in the epithelial cells at segment III of the caput epididymidis. A–D) Both CD68 and MSR1 were positive in some interstitial cells. E, F) In Gt/Gt males, CD68 and MSR1 positive signals showed macrophages in the lumens of the caput epididymal tubules. G, H) Most CD68 and MSR1 positive cells were detected in the interstitial tissues and basal sides of the epithelial cell layers. I, J) Contrary to E and F, some of the caput epididymides of the Gt/Gt males were negative. K, L) CD68 and MSR1 positive cells in the lumens of the epididymal tubules. Injured tubules were detected near a swarm of macrophages. Bar = 500 µm (A, B, E, F, I, J), 50 µm (C, D, G, H), and 200 µm (K, L).

LGR4 Expression in the Epididymis

As described previously, the integration of trap vectors resulted in the production of fusion mRNA encoding marker genes, ß-geo, which expression is directed by the Lgr4 endogenous promoter. Thus, we expect that the expression of the markers in heterozygotes is a reflection of LGR4 expression. We also analyzed the expression pattern of ß-geo in heterozygous mice. X-gal staining of fetal male reproductive tracts demonstrated that Lgr4 expression begins at 17.5 days postconception in the wolffian duct from the proximal region (data not shown). The initiation of Lgr4 expression precedes the initiation of extensive elongation and convolution of the epididymal tubules, which occurs during the first days after birth. We also observed that Lgr4 expression was detected in the ovaries at 17.5 days postconception (data not shown). Although Mazerbourg et al. [25] described infertility in females, our homozygous females were fertile (Table 1). One-tenth the normal expression level of Lgr4 may be sufficient to overcome the phenotype in females. At the newborn stage, ß-geo expression was higher in the testes than in the epididymides (Fig. 9A). At 1 wk of age, though, ß-geo expression level in the epididymides became similar to that in the testes (Fig. 9B). Strong signals were detected in the mesenchymal cells located directly below the epithelium of both the efferent ducts and caput epididymidis (Fig. 9, C–J).


Figure 76030209
View larger version (98K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 9. Lgr4 expressions levels in the male reproductive tracts. Lgr4 expression levels are detected in the epididymides from the perinatal stage, and most of them have been localized at the peritubular cells. Whole-mount X-gal staining of the testes, efferent ducts (ED), and epididymides in newborns (A) and 1 wk after birth (B). Sections of the X-gal-stained efferent ducts (C–F) and epididymides (G–J) of +/Gt males in newborns (C–E, H) and 1 wk after birth (E, F, I, J), respectively. D, F, H, J) Higher magnification of the area indicated by the boxes in C, E, G, and I, respectively. Arrows in D, F, and J indicate strong signals at the peritubular cells located directly below the epithelium. Bar = 1 mm (A, B), 100 µm (C, E, G, I), and 25 µm (D, F, H, J).

DISCUSSION

In this study, we demonstrated a role for Lgr4 in the development of the epididymis with the Lgr4 hypomorphic mutant mice generated by gene-trap insertional mutagenesis.

Mazerbourg et al. [25] reported that Lgr4–/– mice exhibited intrauterine growth retardation associated with embryonic and perinatal lethality in the C57BL/6 background, thus preventing analysis of either the postnatal or adult phenotype. Recently, Mendive et al. [26] showed that the same Lgr4–/– mice with the CD1 genetic background were viable and that most of them reached adulthood. They also demonstrated defective postnatal development of the male reproductive tract. We found that the Lgr4–/– and Lgr4Gt/Gt mice have overlapping phenotypes, as described by Mendive et al. There are, however, distinct differences between their Lgr4–/– and our Lgr4Gt/Gt mice.

First, our mutant mice line has 10% of the normal transcripts, suggesting that these 10% of transcripts skipped the splice acceptor in the trap vector. This residual activity may be the reason for the 15% survival rate to adulthood of Lgr4Gt/Gt mice with the C57BL/6 background. With this hypomorphic mutant line, we were able to reveal the hidden phenotypes that do not appear in the null mutant. Null mutant mice, which are embryonic lethal, sometimes become viable by changing their genetic background, thus making it possible to analyze these phenotypes in the adult stage. However, the phenotypes observed in these mutants might be a reflection of a modifier gene. On the other hand, we can analyze the phenotypes that are directly caused by the low level expression of Lgr4.

In the testes, luminal swelling, loss of germinal epithelium of the seminiferous tubules, and rete testis dilation were observed. The same phenotypes were also observed in Lgr4–/– mice. One reason for this is the decreased expression levels of ESR1 and SLC9A3 in the efferent ducts (Fig. 3, F and G), as both ESR1 and SLC9A3 are well-known key water reabsorption-regulating molecules in the efferent ducts [13]. In fact, similar phenotypes were observed in Esr1–/– mice [14] and Slc9a3–/– mice [15]. Another reason for the phenotypes may be a reduction in the epithelial surface areas available for fluid exchanges to occur, as the efferent duct is less convoluted and hypoplastic. The third reason suggested in Lgr4–/– mice is a physical blockade of the efferent ducts by immune cells; however, we did not observe such a blockade, suggesting that this possibility is not a plausible explanation in our case.

Transit through the epididymis is known to be essential for sperm maturation [35]. The spermatozoa of Lgr4Gt/Gt mice may also lack a sperm volume regulation, which was accomplished through the epididymis, as described in Ros1–/– mice [31, 36]. However, unlike the spermatozoa of Ros1–/– mice, most of the spermatozoa of Lgr4Gt/Gt mice showed a hairpin structure with tightly attached cytoplasms. In addition to the morphologic difference, we found laminin binding to the sperm surface in the cauda epididymidis of Lgr4Gt/Gt mice. All these changes could account for the infertility of Lgr4Gt/Gt mice. Taken together, the decrease of sperm motility and maturity seems to reflect the developmental defects of the epididymis in Lgr4Gt/Gt mice.

The expression of ESR1 was observed in the caput epididymidis of newborn mice of both wild-type and Lgr4Gt/Gt mice. This is consistent with the data reported by Zhou et al. [37]: ESR1 is detected in apical, narrow, and some basal cells of the initial segment; in principal cells of the caput; and in clear cells of the corpus and cauda epididymidis. In wild-type mice, the ESR1 expression gradually increases after birth and reaches a maximum level by 3 wk of age. In contrast, the ESR1 expression starts to disappear after birth in Lgr4Gt/Gt mice. On the other hand, low levels of ESR1 expression in the efferent ducts were kept constant during the postnatal development period, thereby suggesting that the regulation of ESR1 expression in the epididymis differs from that in the efferent ducts. Further investigation will be required to elucidate the role of ESR1 in the epididymis.

One surprising feature of the Lgr4Gt/Gt mouse is the lack of an initial segment in the caput epididymidis. Sonnenberg-Riethmacher et al. [24] reported that the Ros1–/– mice lacked the initial segment. Ros1 is shown to be highly expressed in tall columnar epithelial cells of the initial segment and intermediately expressed in distally located cells of the caput, but not of the corpus or of the cauda. Our data demonstrated that Lgr4 is mainly expressed in mesenchymal cells, but not in epithelial cells, during the postnatal development period. Altered expression of Ros1 was not observed by the RT-PCR analysis in the epididymides of Lgr4Gt/Gt mice 1 wk of age (data not shown). It is possible that the development of initial segments requires interaction between epithelial cells and mesenchymal cells that express Ros1 and Lgr4, respectively.

In addition to the lack of an initial segment, the epididymides of Lgr4Gt/Gt mice are less convoluted, suggesting a defect in the duct elongation. Well-known key molecules involved in epididymal development are steroid hormones and their receptors. Development of the male reproductive tract requires the regulation of testosterone and dihydrotestosterone through the AR. In addition to the AR and ESR1, ESR2 is expressed in the epididymis; however, we could not detect obvious differences in the expression of either AR or ESR2. Considering the data that serum concentrations of estrogen and testosterone are within normal ranges, these hormones may not be involved in the defect in the duct elongation of Lgr4Gt/Gt mice.

For elongation and convolution of the duct to occur, an extensive tissue remodeling, including cell proliferation and remodeling of the ECM, is required [38]. Mendive et al. [26] reported reduced cell proliferation in efferent ducts and in the caput epididymidis of Lgr4–/– mice. In the present study, we found a defect in mesenchymal cell layers and in ECMs. Multilamination suggests that the defect in elongation is due to a failure in the ECM remodeling process, in addition to a reduced level of proliferation. ECM remodeling is regulated by matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs). Some MMPs and TIMPs regulate the ureteric bud branching morphogenesis in renal development [39, 40]. In Mpv17–/– mice, the expression of MMP2 was increased [41], and an abnormal BM morphology, with transient lamination of the stria vascularis and the kidneys, was demonstrated [42]. This abnormal BM morphology is quite similar to the BMs of epididymal tubules in Lgr4Gt/Gt males. These observations suggest that the hyperactivated MMP causes the distorted BM in vivo. One abnormal BM morphology sign is an accumulation of laminin. Interestingly, an accumulation of laminin was also observed toward the mesenchymal cell layers, without the alteration of type IV collagen, in Lgr4Gt/Gt males. These facts support the notion that ECM remodeling and ECM-mediated signaling are necessary for postnatal growth and development of the epididymis. It is of interest that ECM components, including laminin-1 and type IV collagen, induce the ESR1 expression in nonmalignant mammary epithelial lines, SCp2 [43]. In addition, a reporter gene assay in SCp2 showed the regulatory element of Esr1 promoter that responds to laminin-rich reconstituted BM [44]. Thus, the ESR1 reduction in the epididymis of Lgr4Gt/Gt males may be caused by the distorted BM structure. In addition, aberrant BM structures, together with an accumulation of testicular fluid, may cause a rupture of the tubular structure, leading to a leakage of laminin into the lumen of the epididymal ducts.

Recent studies demonstrated that the DLGR2 ligand is composed of the BMP antagonist family proteins, burs and pburs in Drosophila melanogaster [45, 46]; however, no homolog in mammals has yet been found. Identification of ligands for LGR4 will facilitate studies of epithelial-mesenchyme interactions, which will in turn lead to an understanding of basic principles of tubular system development.

ACKNOWLEDGMENTS

We wish to thank M. Araki, K. Haruna, T. Imamura, K. Miike, K. Miyata, Y. Sakumura, K. Semba, and Y. Tsuruta for helpful discussions and technical help and M. Nakata for excellent technical assistance.

FOOTNOTES

1Supported in part by KAKENHI (grant-in-aid for scientific research) in Priority Areas "Integrative Research Toward the Conquest of Cancer" from the Ministry of Education, Culture, Sports, Science, and Technology of Japan; a grant from the Osaka Foundation For the Promotion of Clinical Immunology; and a grant from the Pancreas Research Foundation of Japan. Back

Correspondence: 2FAX: 81 96 373 6599; e-mail: yamamura{at}gpo.kumamoto-u.ac.jp

Received: 11 June 2006.

First decision: 30 June 2006.

Accepted: 24 October 2006.

REFERENCES

  1. Hinton BT, Palladino MA, Rudolph D, Lan ZJ, Labus JC. The role of the epididymis in the protection of spermatozoa. Curr Top Dev Biol 1996; 33:61–102[Medline]
  2. Jones RC. To store or mature spermatozoa? The primary role of the epididymis. Int J Androl 1999; 22:57–67[CrossRef][Medline]
  3. Abou-Haila A and Fain-Maurel MA. Regional differences of the proximal part of mouse epididymis: morphological and histochemical characterization. Anat Rec 1984; 209:197–208[CrossRef][Medline]
  4. Abou-Haila A and Fain-Maurel MA. Postnatal differentiation of the enzymatic activity of the mouse epididymis. Int J Androl 1985; 8:441–458[Medline]
  5. Drevet JR, Lareyre JJ, Schwaab V, Vernet P, Dufaure JP. The PEA3 protein of the Ets oncogene family is a putative transcriptional modulator of the mouse epididymis-specific glutathione peroxidase gene gpx5. Mol Reprod Dev 1998; 49:131–140[CrossRef][Medline]
  6. Suzuki K, Lareyre JJ, Sanchez D, Gutierrez G, Araki Y, Matusik RJ, Orgebin-Crist MC. Molecular evolution of epididymal lipocalin genes localized on mouse chromosome 2. Gene 2004; 339:49–59[CrossRef][Medline]
  7. Vernet P, Faure J, Dufaure JP, Drevet JR. Tissue and developmental distribution, dependence upon testicular factors and attachment to spermatozoa of GPX5, a murine epididymis-specific glutathione peroxidase. Mol Reprod Dev 1997; 47:87–98[CrossRef][Medline]
  8. Hsia N and Cornwall GA. Cres2 and Cres3: new members of the cystatin-related epididymal spermatogenic subgroup of family 2 cystatins. Endocrinology 2003; 144:909–915[Abstract/Free Full Text]
  9. Fox SA, Yang L, Hinton BT. Identifying putative contraceptive targets by dissecting signal transduction networks in the epididymis using an in vivo electroporation (electrotransfer) approach. Mol Cell Endocrinol 2006; 250:196–200[CrossRef][Medline]
  10. Ezer N and Robaire B. Gene expression is differentially regulated in the epididymis after orchidectomy. Endocrinology 2003; 144:975–988[Abstract/Free Full Text]
  11. Behringer RR, Finegold MJ, Cate RL. Mullerian-inhibiting substance function during mammalian sexual development. Cell 1994; 79:415–425[CrossRef][Medline]
  12. Yamashita S. Localization of estrogen and androgen receptors in male reproductive tissues of mice and rats. Anat Rec A Discov Mol Cell Evol Biol 2004; 279:768–778[CrossRef][Medline]
  13. Hess RA. Estrogen in the adult male reproductive tract: a review. Reprod Biol Endocrinol 2003; 1:52.[CrossRef][Medline]
  14. Hess RA, Bunick D, Lee KH, Bahr J, Taylor JA, Korach KS, Lubahn DB. A role for oestrogens in the male reproductive system. Nature 1997; 390:509–512[CrossRef][Medline]
  15. Zhou Q, Clarke L, Nie R, Carnes K, Lai LW, Lien YH, Verkman A, Lubahn D, Fisher JS, Katzenellenbogen BS, Hess RA. Estrogen action and male fertility: roles of the sodium/hydrogen exchanger-3 and fluid reabsorption in reproductive tract function. Proc Natl Acad Sci U S A 2001; 98:14132–14137[Abstract/Free Full Text]
  16. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O. Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc Natl Acad Sci U S A 1998; 95:15677–15682[Abstract/Free Full Text]
  17. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach KS. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science 1999; 286:2328–2331[Abstract/Free Full Text]
  18. Higgins SJ, Young P, Cunha GR. Induction of functional cytodifferentiation in the epithelium of tissue recombinants. II. Instructive induction of Wolffian duct epithelia by neonatal seminal vesicle mesenchyme. Development 1989; 106:235–250[Abstract]
  19. Zhao GQ, Liaw L, Hogan BL. Bone morphogenetic protein 8A plays a role in the maintenance of spermatogenesis and the integrity of the epididymis. Development 1998; 125:1103–1112[Abstract]
  20. Zhao GQ, Chen YX, Liu XM, Xu Z, Qi X. Mutation in Bmp7 exacerbates the phenotype of Bmp8a mutants in spermatogenesis and epididymis. Dev Biol 2001; 240:212–222[CrossRef][Medline]
  21. Hu J, Chen YX, Wang D, Qi X, Li TG, Hao J, Mishina Y, Garbers DL, Zhao GQ. Developmental expression and function of Bmp4 in spermatogenesis and in maintaining epididymal integrity. Dev Biol 2004; 276:158–171[CrossRef][Medline]
  22. Chen MY, Carpenter D, Zhao GQ. Expression of bone morphogenetic protein 7 in murine epididymis is developmentally regulated. Biol Reprod 1999; 60:1503–1508[Abstract/Free Full Text]
  23. Liu ZZ, Wada J, Kumar A, Carone FA, Takahashi M, Kanwar YS. Comparative role of phosphotyrosine kinase domains of c-ros and c-ret protooncogenes in metanephric development with respect to growth factors and matrix morphogens. Dev Biol 1996; 178:133–148[CrossRef][Medline]
  24. Sonnenberg-Riethmacher E, Walter B, Riethmacher D, Godecke S, Birchmeier C. The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis. Genes Dev 1996; 10:1184–1193[Abstract/Free Full Text]
  25. Mazerbourg S, Bouley DM, Sudo S, Klein CA, Zhang JV, Kawamura K, Goodrich LV, Rayburn H, Tessier-Lavigne M, Hsueh AJ. Leucine-rich repeat-containing, G protein-coupled receptor 4 null mice exhibit intrauterine growth retardation associated with embryonic and perinatal lethality. Mol Endocrinol 2004; 18:2241–2254[Abstract/Free Full Text]
  26. Mendive F, Laurent P, Van Schoore G, Skarnes W, Pochet R, Vassart G. Defective postnatal development of the male reproductive tract in LGR4 knockout mice. Dev Biol 2006; 290:421–434[CrossRef][Medline]
  27. Hsu SY. New insights into the evolution of the relaxin-LGR signaling system. Trends Endocrinol Metab 2003; 14:303–309[CrossRef][Medline]
  28. Taniwaki T, Haruna K, Nakamura H, Sekimoto T, Oike Y, Imaizumi T, Saito F, Muta M, Soejima Y, Utoh A, Nakagata N, Araki M, et al. Characterization of an exchangeable gene trap using pU-17 carrying a stop codon-beta geo cassette. Dev Growth Differ 2005; 47:163–172[CrossRef][Medline]
  29. Sztein JM, Farley JS, Mobraaten LE. In vitro fertilization with cryopreserved inbred mouse sperm. Biol Reprod 2000; 63:1774–1780[Abstract/Free Full Text]
  30. Schoore GV, Mendive F, Pochet R, Vassart G. Expression pattern of the orphan receptor LGR4/GPR48 gene in the mouse. Histochem Cell Biol 2005; 124:35–50[CrossRef][Medline]
  31. Avram CE and Cooper TG. Development of the caput epididymidis studied by expressed proteins (a glutamate transporter, a lipocalin and beta-galactosidase) in the c-ros knockout and wild-type mice with prepubertally ligated efferent ducts. Cell Tissue Res 2004; 317:23–34[Medline]
  32. Fouchecourt S, Lareyre JJ, Chaurand P, DaGue BB, Suzuki K, Ong DE, Olson GE, Matusik RJ, Caprioli RM, Orgebin-Crist MC. Identification, immunolocalization, regulation, and postnatal development of the lipocalin EP17 (epididymal protein of 17 kilodaltons) in the mouse and rat epididymis. Endocrinology 2003; 144:887–900[Abstract/Free Full Text]
  33. Agarwal A and Hoffer AP. Ultrastructural studies on the development of the blood-epididymis barrier in immature rats. J Androl 1989; 10:425–431[Abstract/Free Full Text]
  34. Timpl R and Brown JC. Supramolecular assembly of basement membranes. BioEssays 1996; 18:123–132[CrossRef][Medline]
  35. Cooper TG. Role of the epididymis in mediating changes in the male gamete during maturation. Adv Exp Med Biol 1995; 377:87–101[Medline]
  36. Yeung CH, Sonnenberg-Riethmacher E, Cooper TG. Infertile spermatozoa of c-ros tyrosine kinase receptor knockout mice show flagellar angulation and maturational defects in cell volume regulatory mechanisms. Biol Reprod 1999; 61:1062–1069[Abstract/Free Full Text]
  37. Zhou Q, Nie R, Prins GS, Saunders PT, Katzenellenbogen BS, Hess RA. Localization of androgen and estrogen receptors in adult male mouse reproductive tract. J Androl 2002; 23:870–881[Abstract/Free Full Text]
  38. Streuli C. Extracellular matrix remodelling and cellular differentiation. Curr Opin Cell Biol 1999; 11:634–640[CrossRef][Medline]
  39. Pohl M, Sakurai H, Bush KT, Nigam SK. Matrix metalloproteinases and their inhibitors regulate in vitro ureteric bud branching morphogenesis. Am J Physiol Renal Physiol 2000; 279:F891–900[Abstract/Free Full Text]
  40. Nee LE, McMorrow T, Campbell E, Slattery C, Ryan MP. TNF-alpha and IL-1beta-mediated regulation of MMP-9 and TIMP-1 in renal proximal tubular cells. Kidney Int 2004; 66:1376–1386[CrossRef][Medline]
  41. zum Gottesberge AM and Felix H. Abnormal basement membrane in the inner ear and the kidney of the Mpv17–/– mouse strain: ultrastructural and immunohistochemical investigations. Histochem Cell Biol 2005; 124:507–516[CrossRef][Medline]
  42. Reuter A, Nestl A, Zwacka RM, Tuckermann J, Waldherr R, Wagner EM, Hoyhtya M, Meyer zum Gottesberge AM, Angel P, Weiher H. Expression of the recessive glomerulosclerosis gene Mpv17 regulates MMP-2 expression in fibroblasts, the kidney, and the inner ear of mice. Mol Biol Cell 1998; 9:1675–1682[Abstract/Free Full Text]
  43. Novaro V, Roskelley CD, Bissell MJ. Collagen-IV and laminin-1 regulate estrogen receptor alpha expression and function in mouse mammary epithelial cells. J Cell Sci 2003; 116:2975–2986[Abstract/Free Full Text]
  44. Novaro V, Radisky DC, Ramos Castro NE, Weisz A, Bissell MJ. Malignant mammary cells acquire independence from extracellular context for regulation of estrogen receptor alpha. Clin Cancer Res 2004; 10:402S–409S[Abstract/Free Full Text]
  45. Mendive FM, Van Loy T, Claeysen S, Poels J, Williamson M, Hauser F, Grimmelikhuijzen CJ, Vassart G, Vanden Broeck J. Drosophila molting neurohormone bursicon is a heterodimer and the natural agonist of the orphan receptor DLGR2. FEBS Lett 2005; 579:2171–2176[CrossRef][Medline]
  46. Luo CW, Dewey EM, Sudo S, Ewer J, Hsu SY, Honegger HW, Hsueh AJ. Bursicon, the insect cuticle-hardening hormone, is a heterodimeric cystine knot protein that activates G protein-coupled receptor LGR2. Proc Natl Acad Sci U S A 2005; 102:2820–2825[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 IOVSHome page
C. Jin, F. Yin, M. Lin, H. Li, Z. Wang, J. Weng, M. Liu, X. Da Dong, J. Qu, and L. Tu
GPR48 Regulates Epithelial Cell Proliferation and Migration by Activating EGFR during Eyelid Development
Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4245 - 4253.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Weng, J. Luo, X. Cheng, C. Jin, X. Zhou, J. Qu, L. Tu, D. Ai, D. Li, J. Wang, et al.
Deletion of G protein-coupled receptor 48 leads to ocular anterior segment dysgenesis (ASD) through down-regulation of Pitx2
PNAS, April 22, 2008; 105(16): 6081 - 6086.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
76/2/303    most recent
biolreprod.106.054619v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal