Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print March 14, 2007.
Biol Reprod 2007, 10.1095/biolreprod.106.058230
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
77/1/18    most recent
biolreprod.106.058230v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.
Agricola
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.
BIOLOGY OF REPRODUCTION 77, 18–27 (2007)
DOI: 10.1095/biolreprod.106.058230
© 2007 by the Society for the Study of Reproduction, Inc.

Insulin-Like Growth Factor (IGF) 2 Stimulates Steroidogenesis and Mitosis of Bovine Granulosa Cells Through the IGF1 Receptor: Role of Follicle-Stimulating Hormone and IGF2 Receptor1

L.J. Spicer 2, and P.Y. Aad 

Department of Animal Science, Oklahoma State University, Stillwater, Oklahoma 74078

ABSTRACT

Little is known regarding the role of insulin-like growth factor 2 (IGF2) and the regulation of the IGF2 receptor (IGF2R) during follicular development. Granulosa cells were collected from small (1–5 mm) and large (8–22 mm) bovine follicles and were treated with IGF2 for 1–2 days in serum-free medium, and steroid production, cell proliferation, specific 125I-IGF2 binding, and gene expression were quantified. IGF2 increased both estradiol and progesterone production by granulosa cells, and cells from large follicles were more responsive to the effects of IGF2 than those from small follicles. Abundance of aromatase (CYP19A1) mRNA was stimulated by IGF2 and IGF1. The effective dose (ED50) of IGF2 stimulating 50% of the maximal estradiol production was 63 ng/ml for small follicles and 12 ng/ml for large follicles, and these values were not affected by FSH. The ED50 of IGF2 for progesterone production was 20 ng/ml for both small and large follicles. IGF2 also increased proliferation of granulosa cells by 2- to 3-fold, as determined by increased cell numbers and 3H-thymidine incorporation into DNA. Treatment with IGF1R antibodies reduced the stimulatory effect of IGF2 and IGF1 on estradiol production and cell proliferation. Specific receptors for 125I-IGF2 existed in granulosa cells, and 2-day treatment with estradiol, FSH, or cortisol had no significant effect on specific 125I-IGF2 binding. Also, FSH treatment of small- and large-follicle granulosa cells had no effect on IGF2R mRNA levels, whereas IGF1 decreased IGF2R mRNA and specific 125I-IGF2 binding. Granulosa cell IGF2R mRNA abundance was 3-fold greater in small than in large follicles. These findings support the hypothesis that both IGF2 and its receptor may play a role in granulosa cell function during follicular development. In particular, increased free IGF1 in developing follicles may decrease synthesis of IGF2R, thereby allowing for more IGF2 to be bioavailable (free) for induction of steroidogenesis and mitogenesis via the IGF1R.

follicle, follicular development, granulosa cells, IGF2 receptor, insulin-like growth factor receptor, insulin-like growth factor 2

INTRODUCTION

Stimulatory effects of insulin and insulin-like growth factor 1 (IGF1) on estradiol production by mammalian granulosa cells are well documented (for review, see [1–4]), and are likely due in part to their ability to enhance the action of gonadotropins on ovarian follicular steroidogenesis [5–7]. Female IGF1-null mice that survive to adulthood have reduced FSHR mRNA levels in granulosa cells, have impaired ovarian steroidogenesis, and are infertile [8, 9], and this provides further support for the important role of IGF1 on ovarian function. Although the direct effects of IGF2 on granulosa cell function were discovered several years before IGF1 [10], little is known about the role of IGF2 and its receptor (IGF2R) in ovarian function. The present study was undertaken because in cattle, IGF2 is present in follicular fluid at concentrations greater than those of IGF1 [4, 11], thecal cell IGF2 mRNA levels are greater in dominant than in subordinate follicles [12], and both granulosa and theca cells have IGF2 mRNA [13]. The interaction between gonadotropins and IGF2 on granulosa cell steroidogenesis, studied to some extent in bovine theca cells [14] and in the granulosa cells of humans [2, 15, 16] and rats [1, 3], has not been examined in the granulosa cells of cattle. IGF2R exists in the granulosa and thecal cells of humans [17, 18], rats [19], and ewes [20], but IGF2 effects on granulosa cell steroidogenesis and mitogenesis are less than those of IGF1 [5, 21]. Based on previous studies in rat granulosa cells [5] and bovine theca cells [14], it appears that IGF2 acts through IGF1R, even though specific IGF2Rs exist in theca and granulosa cells. The function of these IGF2Rs in ovarian cell function is less clear, but it has been postulated that IGF2Rs may serve as a membrane-bound IGF-binding protein, inactivating IGF2 [14]. A similar role for IGF2R during embryonic development has been postulated [22].

Therefore, to determine the biologic function of IGF2 and its receptor in bovine granulosa cells, we set out first to evaluate the dose-response of IGF2 on granulosa cell proliferation and estradiol and progesterone production in the absence and presence of FSH, and then to evaluate the effect of various hormones on IGF2 responses as well as on specific 125I-IGF2 binding sites and IGF2R mRNA in bovine granulosa cells.

MATERIALS AND METHODS

Hormones and Reagents

Recombinant human IGF1 and IGF2 and anti-human IGF1R antibody for cell culture were obtained from R & D Systems (Minneapolis, MN); ovine FSH (FSH activity, 15x NIH-FSH-S1 U/mg) was obtained from Scripps Laboratories (San Diego, CA); methyl-3H-thymidine was obtained from GE Healthcare (Arlington Heights, IL), staurosporine was obtained from BIOMOL Research Laboratories Inc. (Plymouth Meeting, PA), testosterone was obtained from Steraloids (Wilton, NH), and estradiol, cortisol, trypsin, collagenase, DNase, and fetal calf serum (FCS) were obtained from Sigma Chemical Co. (St. Louis, MO).

Cell Culture

Ovaries of cattle obtained at slaughter from a nearby abattoir were brought to the laboratory on ice and processed as previously described for obtaining granulosa cells from small (1–5 mm) and large (≥8 mm) follicles [23, 24]. These follicle size categories were selected because: 1) previous studies indicate that granulosa cells from small follicles are less responsive to FSH and IGF1 than are cells from large follicles [7, 24], 2) the observations that follicles 8 mm and larger have much greater estradiol concentrations than small follicles [11, 25], 3) follicles that are destined to ovulate have an average surface diameter of 10 ± 2 mm [26], and 4) selection of the dominant follicle occurs at about 8 mm in diameter [27]. Medium was a 1:1 mixture of Dulbecco modified Eagle medium and Ham F12 containing gentamicin, glutamine, and sodium bicarbonate. Approximately 2 x 105 viable cells were seeded in each plastic multiwell containing 1 ml medium. Prior to plating, granulosa cells were resuspended in medium containing 1.25 mg/ml collagenase and 0.5 ml DNase. Using trypan blue exclusion method, granulosa cell viability averaged 77% ± 3% and 67% ± 6% for small and large follicles, respectively, at time of plating. Cultures were kept at 38.5°C in a 95% air:5% CO2 atmosphere, and for all experiments medium was changed every 24 h. This culture system uses serum-free medium so that specific effects of growth factors can be ascertained; FSH has little or no effect alone, but it consistently stimulates aromatase activity when it is concomitantly treated with insulin or IGF1 [7, 24, 28]. For experiment 1, cells were cultured in medium containing 10% FCS for the first 48 h, washed twice with 0.5 ml serum-free medium, and treated for an additional 48 h with various doses (0, 10, 30, or 100 ng/ml) of recombinant human IGF2, ovine FSH (0 or 30 ng/ml), and/or recombinant human IGF1 (0 or 30 ng/ml) in serum-free medium containing 500 ng/ml testosterone as an estrogen precursor. For experiment 2, cells were cultured as in experiment 1, except that after the first 48 h in culture, cells were treated for 24 h with serum-free medium with no additions, 100 ng/ml IGF2, or 100 ng/ml IGF1, after which cellular RNA was collected (see below). For experiment 3, cells from small follicles were cultured for 48 h in 10% FCS, then serum starved for 24 h by culture in serum-free medium. The medium was changed, and then cells were cultured for an additional 40 h in serum-free medium with either no treatment, 100 ng/ml IGF2, 100 ng/ml IGF1, or 10% FCS in the presence of 1 µCi 3H-thymidine to assess DNA synthesis, as previously described [29]. For experiment 4, granulosa cells were cultured from large follicles as described for experiment 1, except that treatments were control (no additions), FSH (30 ng/ml), IGF1 (30 ng/ml), or IGF2 (30 ng/ml), and viability was assessed using the trypan blue exclusion test. For experiment 5, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in serum-free medium for 24 h with either 0 or 25 ng/ml of IGF2 or IGF1 with 30 ng/ml of FSH and 500 ng/ml of testosterone. After 24 h, medium was replaced with medium containing FSH, testosterone, and 0 or 2.5 µg anti-IGF1R antibody without or with 0 or 25 ng/ml of IGF2 or IGF1 for an additional 24 h. The cells were exposed to the anti-IGF1R antibody for 1 h before addition of IGF2 or IGF1. For experiment 6, granulosa cells were cultured from small follicles as described for experiment 1, except that treatments were IGF1 (100 ng/ml) or IGF2 (100 ng/ml), along with FSH (30 ng/ml) and the protein kinase inhibitor, staurosporine (0 or 10 nM).

For experiments 1, 5, and 6, medium was collected and stored at –20°C until radioimmunoassays previously validated in our laboratory [23, 24] were conducted to quantify progesterone and estradiol concentrations. Numbers of cells in the same wells in which medium was collected were determined using a Coulter counter as previously described [23, 30], and were used to calculate steroid production on a nanogram or picogram per 105 cell basis.

For experiment 7, cells were maintained in 10% FCS for a total of 3 days. At the end of the culture period, 125I-IGF2 binding assays were conducted as previously described [14, 31, 32]. For experiment 8, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and treated in serum-free medium for an additional 48 h with either estradiol (300 ng/ml), FSH (30 ng/ml), or cortisol (30 ng/ml) in the absence or presence of 30 ng/ml IGF1, after which binding assays were conducted with 250 000 cpm of 125I-IGF2 or 125I-IGF1 in the absence or presence of 200 ng/well of IGF2 as previously described [14, 31, 33]. Briefly, the 125I-IGF2 and 125I-IGF1 assays were conducted directly in the culture wells, with an assay volume of 400 µl. Incubation was for 16 h at 4°C for 125I-IGF2 and 125I-IGF1, and 200 ng/well unlabeled IGF2 or IGF1 was used for determination of nonspecific binding [14, 31, 33].

For experiments 9 and 10, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated for 24 h in serum-free medium with 0 or 30 ng/ml IGF1 (experiment 9) or 100 ng/ml IGF2 with 0 or 30 ng/ml FSH (experiment 10). At the end of culture, RNA was collected, and real-time RT-PCR was used to quantify IGF2R and FSHR mRNAs, both of which were normalized to constitutively expressed 18S ribosomal RNA (see below). For experiment 11, aliquots of freshly collected granulosa and theca cells were treated with TRIzol, RNA was collected, and real-time RT-PCR was used to quantify IGF2R mRNA, which was normalized to constitutively expressed 18S ribosomal RNA (see below).

RNA Extraction and RT-PCR

For experiments 2, 9, 10, and 11, granulosa cells were lysed in 0.5 ml TRIzol Reagent (Life Technologies Inc., Gaithersburg, MD), RNA was extracted, and RNA quantity was determined spectrophotometrically at 260 nm, as previously described [34, 35]. The target gene primers (forward and reverse) and probe sequences for CYP19A1 (accession no. NM_174305) were TGCCAAGAATGTTCCTTACAGGTA, CACCATGGCGATGTACTTTCC, and CATTTGGCTTTGGGCCCCGG, respectively; for CYP11A1 (accession no. NM_176644): ACAGGGAGAAGCTTGGCAATT, GTAGGATCCCTCGAACTTGAAGA, and AGTTTATATCATTCACCCTGAAGACGTGGCCC, respectively; for IGF2R (accession no. AF342811): GCAATGCTAAGCTTTCGTATTACG, GGTGTACCACCGGAAGTTGTATG, and ACGCCGGAGTGGGTTTCCCC, respectively; and for FSHR (accession no L22319): AACCTGCTATACATCGACCCTGAT, GCTTAATACCTGTGTTGGATATTAACAGA, and CCTTCCAGAACCTTCCCAACCTCCG, respectively. A BLAST search (http://www.ncbi.nlm.nih.gov/BLAST) also was conducted to ensure the specificity of the designed primers and probe and to assure that they were not designed from any homologous regions, coding for other genes. Furthermore, the RT-PCR product was run on an agarose gel to verify the length and size of the expected target gene. Also, 6 µl of the same RT-PCR cDNA sample was treated with 0.5 µl shrimp alkaline phosphatase and 0.5 µl exonuclease I (both from Amersham Biosciences, Piscataway, NJ), incubated at 37°C for 30 min, and further incubated at 85°C for 15 min before sequencing to verify the sequence and specificity of the RT-PCR quantification of the desired target gene.

The differential expression of target gene mRNA in granulosa cells was quantified using the one-step, real-time RT-PCR reaction for Taqman Gold RT-PCR Kit (Applied Biosystems, Foster City, CA), as previously described [34, 35]. Briefly, based on preliminary optimization results, 50 or 100 ng total RNA was amplified in a total reaction volume of 25 µl consisting of 200 nM forward primer, 200 nM reverse primer, and 200 nM fluorescent (FAM/TAMRA) probe for each target gene; 10 nM of 18S rRNA primers and 100 nM of the 18S rRNA VIC-labeled probe, along with 12.5 µl TaqMan Master Mix without uracil N-glycosylase; and 1 unit Multiscribe with RNase inhibitor (Applied Biosystems). Thermal cycling conditions were set to 30 min at 48.8°C for reverse transcription and 95°C for 10 min for AmpliTaq Gold Activations, and were finished with 45 cycles at 95°C for 15 sec for denaturing and 60°C for 1 min for annealing and extension. The 18S rRNA values were used as internal controls to normalize samples for any variation in amounts of RNA loaded, as previously described [34, 35]. All samples were run in duplicate. Relative quantification of target gene mRNAs were expressed using the comparative threshold cycle method, as previously described [34–36]. Briefly, the {Delta}Ct was determined by subtracting the 18S Ct value from the target unknown value. For each target gene and within each experiment, the {Delta}{Delta}Ct was determined by subtracting the higher {Delta}Ct (the least expressed unknown) from all other {Delta}Ct values. Fold changes in target gene mRNA expression were calculated as being equal to 2–{Delta}{Delta}Ct.

Statistical Analyses

Experimental data are presented as means ± SEM of measurement from replicated experiments. Each experiment was replicated three or more times, and within each experiment treatments were applied in triplicate culture wells. Each experiment was conducted on a separate pool of granulosa cells obtained from 8 to 15 cows or heifers. The main effects and their interactions on the variables measured were assessed by the general linear models procedure of SAS [37]. To correct for heterogeneity of variance, estradiol production, CYP19A1 mRNA, IGF2R mRNA, and 125I-IGF1 binding were analyzed after transformation natural log (x + 1). Specific differences among treatments were tested using the Fisher protected least-significant difference procedure [38]. Significance was declared at P < 0.05 unless noted otherwise. Specific binding of 125I-IGF2 and 125I-IGF1 to granulosa cells was expressed as cpm/100 cells or as a percentage of total binding.

RESULTS

Experiment 1 was conducted to compare the dose-response of IGF2 on basal and FSH-induced steroid production by granulosa cells collected from small (experiment 1A) and large (experiment 1B) follicles. In experiment 1A, granulosa cells from small follicles treated with 10 and 30 ng/ml IGF2 in the absence of FSH had no effect (P > 0.10) on estradiol production, whereas 100 ng/ml increased estradiol production by 8-fold (Fig. 1A). In the presence of FSH, all doses of IGF2 tested increased (P < 0.05) estradiol production, with maximal effects observed in small-follicle granulosa cells (i.e., 24-fold increase; Fig. 1A) with 100 ng/ml IGF2, and in 30 ng/ml IGF2 in granulosa cells from large follicles (i.e., 7-fold; Fig. 1B). In small-follicle granulosa cells, 30 and 100 ng/ml IGF2 increased progesterone production by 2- to 3-fold, regardless of whether FSH was present (Fig. 2A). Similarly, granulosa cells from large follicles (experiment 1B) treated with 30 and 100 ng/ml IGF2 in the absence of FSH increased (P < 0.001) both estradiol (Fig. 1B) and progesterone (Fig. 2B) production by 2- to 4-fold above controls. The estimated effective dose (ED50) of IGF2 stimulating 50% of the maximal aromatase response (calculated from stimulation curves that were linearized using a semi-log plot) averaged 63 ng/ml and 12 ng/ml for small- and large-follicle granulosa cells, respectively, and these values were not affected by FSH. The estimated ED50 of IGF2 stimulating 50% of the maximal progesterone response averaged 20 ng/ml for both small- and large-follicle granulosa cells, and this value was not affected by FSH. Also, IGF2 increased (P < 0.05) cell numbers by 1.4- to 2.2-fold (Table 1).


Figure 01
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1. Effect of 2-day treatment of IGF2 on basal and FSH-induced estradiol production by small-follicle (A) and large-follicle (B) granulosa cells (experiment 1). Cells were cultured for 48 h in the presence of 10% FCS, and then treated in serum-free medium for an additional 48 h with 0, 10, 30, or 100 ng/ml IGF2 in the absence (solid circle, dashed line) or presence (filled box, solid line) of 30 ng/ml FSH. Values are means ± SEM of triplicate culture wells replicated in three separate experiments (n = 9). *Mean differs (P < 0.05) from its respective 0 ng/ml dose. **Mean differs (P < 0.05) from the immediately preceding value.


Figure 02
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2. Effect of 2-day treatment of IGF2 on basal and FSH-induced progesterone production by small-follicle (A) and large-follicle (B) granulosa cells (experiment 1). Cells were cultured for 48 h in the presence of 10% FCS, and then treated in serum-free medium for an additional 48 h with 0, 10, 30, or 100 ng/ml IGF2 in the absence (solid circle, dashed line) or presence (filled box, solid line) of 30 ng/ml FSH. Values are means ± SEM of triplicate culture wells replicated in three separate experiments (n = 9). *Mean differs (P < 0.05) from its respective 0 ng/ml dose. **Mean differs (P < 0.05) from the immediately preceding value.


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 1. Effect of recombinant human IGF2 on granulosa cell numbers (x105/well) in experiment 1.

Experiment 2 was conducted to compare the effects of IGF2 and IGF1 on CYP19A1 and CYP11A1 mRNA abundance in small- and large-follicle granulosa cells. Treatment of granulosa cells with 100 ng/ml of either IGF2 or IGF1 increased (P < 0.05) CYP19A1 mRNA abundance by 3-fold in small- and large-follicle granulosa cells (Fig. 3A). Although the increases induced by IGF2 and IGF1 were similar within each cell type, the amount of CYP19A1 mRNA was 8-fold greater (P < 0.05) in granulosa cells from large than small follicles (Fig. 3A). Neither IGF2 nor IGF1 affected CYP11A1 mRNA abundance in granulosa cells (Fig. 3B). The amount of CYP11A1 mRNA was 2.3-fold greater (P < 0.05) in granulosa cells of large than small follicles (Fig. 3B).


Figure 03
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3. Effect of IGF1 and IGF2 on CYP19A1 (A) and CYP11A1 (B) mRNAs in granulosa cells (experiment 2). Granulosa cells from small and large follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in the presence of 100 ng/ml of IGF2 or IGF1 for 24 h. Values are means ± SEM of three separate experiments and are normalized to constitutively expressed 18S ribosomal RNA. a,b,c,dWithin a panel, means without a common superscript differ (P < 0.05).

Experiment 3 was conducted to compare the effects of IGF2 and IGF1 on DNA synthesis as measured by 3H-thymidine incorporation. Treatment of granulosa cells from small follicles with 100 ng/ml of either IGF2 or IGF1 increased (P < 0.05) 3H-thymidine incorporation similarly (by 4-fold), but to a lesser extent than 10% FCS (13-fold increase; Fig. 4).


Figure 04
View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4. Comparison of the effect of IGF1 and IGF2 on DNA synthesis in bovine granulosa cells (experiment 3). Granulosa cells from small follicles were cultured for 48 h in 10% FCS, serum starved for 24 h in serum-free medium, and then cultured with various treatments for 40 h in the presence of 1 µCi 3H-thymidine. Values are means ± SEM of triplicate culture wells replicated in three separate experiments (n = 9). a,b,cMeans without a common superscript differ (P < 0.05).

Experiment 4 was conducted to compare the effects of FSH, IGF1, and IGF2 on viability of large-follicle granulosa cells. Compared with untreated controls, 2-day treatment of granulosa cells with 30 ng/ml FSH, 100 ng/ml IGF2, or 100 ng/ml IGF1 had no effect (P < 0.05) on cell viability, which averaged 63% (Table 2). FSH had no effect on cell numbers, whereas IGF1 and IGF2 increased (P < 0.05) cell numbers 1.8- and 1.6-fold above controls, respectively (Table 2). Also, IGF1 and IGF2 increased (P < 0.05) basal progesterone production by 7.3- and 5.9-fold above controls and basal estradiol production by 14.5- and 19.5-fold above controls. FSH increased (P < 0.05) progesterone production by 52% and tended to increase (P < 0.08) estradiol production by 69% (Table 2).


View this table:
[in this window]
[in a new window]
[Download PPT slide]
  		TABLE 2. Effect of FSH and recombinant human IGF1 and IGF2 on granulosa cell viability in experiment 4.

Experiment 5 was conducted to determine whether blocking the IGF1R reduced the stimulatory effects of IGF2 or IGF1 on granulosa cell steroidogenesis and cell proliferation. Treatment of large-follicle granulosa cells with 2.5 µg/ml anti-IGF1R antibody during the second 24-h treatment with IGF2 or IGF1 significantly decreased the stimulatory effect of 25 ng/ml of IGF2 and IGF1 on estradiol production (Fig. 5A) and cell proliferation (Fig. 5B). Anti-IGF1R antibody had no effect on estradiol production stimulated by FSH and had no effect on basal cell numbers (Fig. 5). The stimulatory effects of IGF2 and IGF1 on progesterone production was not significantly altered by concomitant treatment with the anti-IGF1R antibody (data not shown).


Figure 05
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5. Comparison of the effect of an anti-IGF1R antibody on IGF1- and IGF2-induced estradiol production (A) and proliferation (B) of bovine granulosa cells (experiment 5). Granulosa cells from large follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in serum-free medium for 24 h with 0 or 25 ng/ml of IGF2 or IGF1, with 30 ng/ml FSH. After 24 h, medium was replaced with medium containing 0 or 2.5 µg anti-IGF1R antibody without or with 0 or 25 ng/ml of IGF1 or IGF2 for an additional 24 h. The cells were exposed to the anti-IGF1R antibody for 1 h before addition of IGF1 or IGF2. Values are means ± SEM of triplicate culture wells replicated in three separate experiments (n = 9). a,b,c,d,eWithin a panel, means without a common superscript differ (P < 0.05).

Experiment 6 was conducted to compare the effects of a protein kinase inhibitor, staurosporine, on IGF1- and IGF2-induced steroid production and cell numbers. Two-day treatment of small-follicle granulosa cells with 10 nM staurosporine caused a reduction (P < 0.05) in the aromatase (Fig. 6A) and cell proliferation (Fig. 6B) responses to both IGF1 and IGF2. IGF1 increased estradiol and progesterone production to greater (P < 0.05) levels than IGF2. Staurosporine had no effect (P > 0.10) on progesterone production induced by IGF1 or IGF2, which averaged 156 ± 7 and 89 ± 5 ng/105 cells per 24 h, respectively.


Figure 06
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 6. Effect of 2-day treatment of staurosporine on IGF1- and IGF2-induced estradiol (A) and progesterone (B) production by bovine granulosa cells (experiment 6). Granulosa cells from small follicles were cultured for 48 h in the presence of 10% FCS, and then were treated in serum-free medium for an additional 48 h with FSH (30 ng/ml) and either 100 ng/ml IGF1 or 100 ng/ml IGF2 in the absence (hatched bar) or presence (solid bar) of 10 nM staurosporine. Values are means ± SEM of triplicate culture wells replicated in three separate experiments (n = 9). a,b,c,dWithin a panel, means without a common superscript differ (P < 0.05).

Experiment 7 was conducted to compare IGF1 and IGF2 competition for 125I-IGF1 and 125I-IGF2 binding sites on granulosa cells. In experiment 7A, 1 and 100 ng/well IGF2 inhibited binding of 125I-IGF2 to granulosa cells to a greater extent than did the same doses of IGF1 (Fig. 7A). In experiment 7B, 3, 10, and 100 ng/well of IGF1 and IGF2 inhibited granulosa 125I-IGF1 binding, whereas 1 ng/well of IGF1 or IGF2 had no effect on 125I-IGF1 binding (Fig. 7B). These and additional ligand binding experiments revealed that IGF1 cross-reactivity with granulosa IGF2R averaged 0.3%, whereas cross-reactivity of IGF2 with granulosa IGF1R averaged 53%.


Figure 07
View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 7. Comparison of IGF1 and IGF2 on competing for 125I-IGF2 (A) and 125I-IGF1 (B) binding by granulosa cells (experiment 7). Granulosa cells were cultured for 3 days in the presence of 10% FCS, and then cells were washed and incubated with 60 000 dpm of 125I-IGF1 or 125I-IGF2 in the absence or presence of 0, 1, 3, 10, or 100 ng/well of IGF1 or IGF2. Values are means of three to four separate experiments and are expressed as a percentage of control total 125I-IGF2 and 125I-IGF1 binding, which averaged 5621 and 6622 cpm/105cells, respectively. *Mean (±SEM) differs (P < 0.05) from control (0 ng/well).

Experiment 8 was conducted to determine whether various hormones can alter specific 125I-IGF2 binding sites on granulosa cells. Two-day treatment of small-follicle granulosa cells with estradiol (300 ng/ml), FSH (30 ng/ml), or cortisol (30 ng/ml) in the presence or absence of 30 ng/ml IGF1 had no significant effect on specific binding of 125I-IGF2 to granulosa cells (Fig. 8A). However, 2-day treatment with IGF1 decreased (P < 0.05) specific 125I-IGF2 binding to granulosa cells (Fig. 8A).


Figure 08
View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 8. Hormonal control of IGF2R in granulosa cells. A) Effect of IGF1, estradiol, FSH, and cortisol on specific binding of 125I-IGF2 to granulosa cells (experiment 8). Granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and treated in serum-free medium for an additional 48 h with either estradiol (300 ng/ml), FSH (30 ng/ml), or cortisol (30 ng/ml) in the absence or presence of 30 ng/ml IGF1 before binding assays were conducted. Binding assays were conducted with 250 000 cpm 125I-IGF2 in the absence or presence of 200 ng/well IGF2. Values are means of three separate experiments and are expressed as cpm of specific 125I-IGF2 binding per 100 granulosa cells. *Within a treatment, mean differs (P < 0.05) from its respective control without IGF1. B) Effect of IGF1 on FSHR and IGF2R mRNA levels in granulosa cells (experiment 9). Granulosa cells from small follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated without or with 30 ng/ml IGF1 for 24 h. Values are means ± SEM of three separate experiments and are normalized to constitutively expressed 18S ribosomal RNA. *Within mRNA type, mean differs from its respective control.

Experiment 9 was conducted to determine the effects of IGF1 on IGF2R and FSHR mRNA levels in small-follicle granulosa cells. Granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated with 0 or 30 ng/ml IGF1 for 24 h, and RNA was collected. Real-time PCR revealed that levels of IGF2R mRNA were decreased (P < 0.05) by 29%, whereas the level of FSHR mRNA was increased (P < 0.05) by 3.3-fold with IGF1 treatment (Fig. 8B).

Experiment 10 was conducted to determine the effects of FSH on IGF2R mRNA and FSHR mRNA abundance in granulosa cells. Granulosa cells from small and large follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in the presence of 30 ng/ml IGF2 without or with 30 ng/ml FSH for 24 h. Real-time PCR revealed that FSH had no effect on FSHR (Fig. 9A) or IGF2R (Fig. 9B) mRNA levels in granulosa cells collected from small or large follicles.


Figure 09
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 9. Effect of FSH on FSHR mRNA (A) and IGF2R mRNA (B) in granulosa cells (experiment 10). Granulosa cells from small and large follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in the presence of 30 ng/ml IGF2 without or with 30 ng/ml FSH for 24 h. Cellular RNA was extracted, and real-time RT-PCR was conducted. Values are means ± SEM of three separate experiments and are normalized to constitutively expressed 18S ribosomal RNA. No significant differences were observed.

Experiment 11 was conducted to determine whether theca and granulosa cells collected from small and large follicles differed in IGF2R mRNA levels. Real-time RT-PCR revealed that granulosa cells from small follicles had 3-fold greater (P < 0.05) IGF2R mRNA abundance than granulosa cells from large follicles (Fig. 10). In contrast, theca cells from large follicles had 14-fold greater (P < 0.01) IGF2R mRNA abundance than theca cells from small follicles (Fig. 10).


Figure 10
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 10. Effect of follicle size and cell type on IGF2R mRNA abundance (experiment 11). Granulosa and theca cells from small and large follicles were collected, RNA was extracted, and real-time PCR was conducted. Values are means of six separate pools of cells and are normalized to constitutively expressed 18S ribosomal RNA. a,b,cMeans ± SEM without a common superscript differ (P < 0.05). Note log scale on y-axis.

DISCUSSION

For the first time, developmental and hormonal regulation of IGF2R gene expression and its function in granulosa cells was documented. In particular, results of the present study revealed that: 1) IGF2 increased both estradiol and progesterone production by granulosa cells, and cells from large follicles were more responsive than those from small follicles to the effects of IGF2; 2) IGF2 also increased cell numbers and DNA synthesis; 3) IGF2 and IGF1 increased abundance of CYP19A1 mRNA but did not affect abundance of CYP11A1 mRNA in granulosa cells; 4) the stimulatory effects of IGF2 and IGF1 on estradiol production and cell proliferation were inhibited by addition of antibodies against IGF1R; 5) IGF2 and IGF1 competed for both IGF1R and IGF2R; 6) 2-day treatment with IGF1 inhibited 125I-IGF2 binding and IGF2R mRNA levels, whereas FSH had no effect; and 7) granulosa cell IGF2R mRNA levels were greater in small than in large follicles, whereas theca cell IGF2R mRNA levels were greater in large than in small follicles. Thus, IGF2 appears to increase proliferation and stimulate differentiation in granulosa cells via the IGF1R, and the IGF2R may be hormonally regulated and associated with decreased granulosa cell responses by acting as a type of decoy receptor for IGF2.

Previously, little evidence existed that characterized the interaction between FSH and IGF2 on granulosa cell steroidogenesis and mitogenesis in cattle. We observed that aromatase activity in granulosa cells from large follicles was much more sensitive to the effects of IGF2 than aromatase activity in the granulosa cells from small follicles, and that FSH and IGF2 synergized to induce steroidogenesis in bovine granulosa cells. This synergism likely involves IGF-induced upregulation of the FSHR, as shown in this study and in previous studies [39], but it likely does not involve FSH-induced downregulation of the IGF2R, since FSH did not alter IGF2-specific binding or IGF2R mRNA in the present study. Alternatively, differences in cellular responses to IGF2 and FSH may depend on the interactions among intracellular cascade mechanisms (e.g., protein kinase C and cAMP pathways) that may coexist within a particular cell type. Such differences for IGF1 signaling exist between small- and medium-follicle granulosa cells in pigs [40]. Specific intracellular signaling systems that contribute to aromatase and progesterone production in FSH-responsive cells include MAP kinase [41], phosphatidylinositol 3-kinase [42], and protein kinases A and B [43, 44]. Inhibition of IGF1- and IGF2-induced aromatase activity by the protein kinase inhibitor, staurosporine, supports the role of protein kinases in both IGF2 and IGF1 signal transduction. However, the determination of which specific intracellular protein kinases are activated by IGF1 and IGF2 in granulosa cells will require further study.

Gene expression studies revealed that granulosa cells from large follicles had a greater abundance of CYP19A1 mRNA than those from small follicles, and in both cell types IGF2 and IGF1 induced CYP19A1 mRNA similarly. The ED50 for IGF2-stimulated steroid production by bovine granulosa cells from the present study (i.e., 12–63 ng/ml) is within the range of those reported for rat [1] and human [15, 45] granulosa cells and bovine theca cells [14]. Also, consistent with a previous report [7], estradiol production by small-follicle granulosa cells was less sensitive than large-follicle granulosa cells to the stimulatory effects of FSH on estradiol production. As previously suggested [46], it is likely that in the presence of elevated FSH, only a small amount of "free" IGF2 or IGF1 is needed to increase estradiol production by the early dominant follicle as the level of IGFBP decreases in follicular fluid. A similar conclusion was made regarding the role of IGF1 in stimulating aromatase activity of granulosa cells in an elevated FSH environment [7]. The present study revealed that the ED50 of IGF2 (i.e., 12–63 ng/ml) for bovine granulosa cell progesterone and estradiol production is about 2-fold greater than that of IGF1 (5–36 ng/ml; [7]), and that the maximal effect of IGF2 (i.e., 7- to 24-fold increases) is similar to or slightly less than that of IGF1 (i.e., 13- to 37-fold increases; [7, 24]). In the present study, the maximal effect of IGF2 on estradiol production was usually less than IGF1 in granulosa cells of small follicles, but estradiol responses were similar for IGF1 and IGF2 in granulosa cells of large follicles. Previous reports using human [16] and rat [5, 6] granulosa cells and bovine theca cells [14] indicated that the maximal effect of IGF2 on steroidogenesis was less than that of IGF1. Because bovine theca cells from large follicles do not respond to IGF2 as well as granulosa cells and have a greater abundance of IGF2R mRNA than granulosa cells, perhaps the relative maximal effects of IGF2 versus IGF1 are dependent on the relative proportions of IGF1R and IGF2R present, which may be influenced by cell type and(or) species.

In the present study, IGF2 competed half as well as IGF1 with 125I-IGF1 binding sites, and anti-IGF1R antibodies attenuated the stimulatory effects of IGF2 and IGF1 on estradiol production and cell proliferation, and thus we speculate that the stimulatory effect of IGF2 on granulosa steroidogenesis and cell proliferation is mediated via IGF1R. Although not reported previously for bovine granulosa cells, a similar conclusion was reached using bovine adrenocortical cells [47] and bovine theca cells [14]. Previous studies have documented the presence of 125I-IGF1 and 125I -IGF2 binding sites in the granulosa cells of cattle [11, 24, 32, 33] and sheep [20], as well as IGF1R and/or IGF2R mRNA in the granulosa cells of sheep [48, 49], pigs [50], rats [19, 51], and humans [17, 18, 52, 53]. We further speculate that because IGF2Rs are present on granulosa cells, and the ED50 of IGF2 on granulosa cell steroidogenesis is appreciably less than IGF1, IGF2R may act as a type of decoy receptor via binding and inactivation of IGF2. This latter suggestion was made for bovine theca cells [14], and is further supported by studies of Adashi et al. [6], which reported that granulosa cell IGF2R does not participate in transmembrane IGF signaling. Similarly, in human MCF-7 breast cancer cells, IGF2R is thought to operate as an IGF2 antagonist, suppressing IGF2-induced cellular proliferation [54]. In the present study, IGF2 receptors (IGF2R mRNA and specific 125I-IGF2 binding) were decreased by IGF1 but not affected by FSH, estradiol, or cortisol. This suggests that as free IGF1 increases within the growing follicle, it suppresses IGF2R in granulosa cells, thereby reducing the attenuating effect that IGF2R may have on IGF2-stimulated differentiation. Consistent with the present study, FSH and estrogen treatment had no effect on ovarian IGF2R mRNA levels in rats [19]. Physiologic changes in IGF2R in granulosa cells have not been studied previously in cattle, but IGF2R mRNA levels significantly increased during the mid and late cycles in bovine corpora lutea [55, 56]. In ewes, follicular IGF2R mRNA levels measured using in situ hybridization were greater in atretic than in healthy follicles and were greater in small than in large follicles [49]. A greater number of IGF2Rs in small follicles compared with large follicles measured in the present study, along with a less sensitive steroid response to IGF2 is consistent with the notion that IGF2R reduces the biologic effect of IGF2. It should be noted that IGF2R may serve other functions in addition to acting as a negative regulator of IGF2 ligand bioavailability [57]. For example, in other cell types IGF2R can bind urokinase-type plasminogen activator receptor and plasminogen [58, 59], and it may be a receptor for retinoic acid [60]. Whether these other functions of the IGF2R are operative in ovarian tissue or granulosa cells in particular will require further elucidation.

The present study has shown for the first time a stimulatory effect of IGF2 on bovine granulosa cell proliferation as measured by increased cell numbers and increased 3H-thymidine incorporation. These observations agree with previous reports in which treatment with IGF2 increased 3H-thymidine incorporation and numbers of porcine granulosa [61, 62] and human granulosa-lutein [63] cells. Moreover, the stimulatory effect of IGF2 on cell numbers was significantly reduced with concomitant treatment with anti-IGF1R antibodies or a protein kinase inhibitor, staurosporine. The lack of an effect of IGF1 or IGF2 on cell viability suggests that IGF1 and IGF2 may be targeting cell cycle events more than antiapoptotic events to induce proliferation of granulosa cells. Collectively, these studies indicate that IGF2 acting through IGF1R may be involved in growth of the granulosa layer within ovarian follicles in addition to its stimulatory effect on steroidogenesis.

Because IGF2-induced increases in estradiol production (i.e., <2 ng/105 cells per 24 h) represented no more than 10% of the progesterone produced by granulosa cells in the present study, it is likely that IGF2 also acts to enhance de novo steroidogenesis from cholesterol in bovine granulosa cells. In support of this suggestion, inhibition of HMG-CoA reductase, a key enzyme for de novo cholesterol synthesis, dramatically reduces IGF1-induced progesterone production by bovine granulosa cells [64]. Although IGF2 stimulates CYP11A1 mRNA by several-fold in porcine granulosa cells [21], IGF2 had no effect on CYP11A1 mRNA in bovine granulosa cells in the present study, suggesting that species differences may exist in terms of IGF2 responsiveness. Interestingly, the anti-IGF1R antibody inhibited estradiol production but not progesterone production, suggesting that cholesterol stores that can serve as progestin precursors were increased during the first 24 h of treatment with IGF2 and IGF1 so that sufficient progestin precursor existed to maintain progesterone production during the second 24-h treatment period. It is unlikely that the granulosa cells luteinized with time in culture in the present study because: 1) progesterone production remains constant or does not increase with time using this culture paradigm [23, 24], 2) the morphology of the granulosa cells retains a fibroblastic appearance [65], 3) aromatase activity of granulosa cells remains responsive to FSH and IGF1, and their responses increase between Days 3 and 4 of culture [7, 24], and 4) granulosa cells from small and large follicles have little or no progesterone response to LH [7].

In conclusion, this study is first to demonstrate expression and function of IGF2R in bovine granulosa cells, indicating that the IGF2R may serve as a type of decoy receptor to modulate IGF2 action. Moreover, IGF2 and IGF1 may share common intracellular cascade mechanisms in bovine granulosa cells, in spite of the fact that specific receptors for each hormone exist in this cell type. Additional studies will be required to further characterize the hormonal regulation of IGF2R in granulosa cells and whether changing levels of granulosa IGF2R are involved in the control of follicle growth.

ACKNOWLEDGMENTS

The authors gratefully acknowledge Dustin Allen, Alberto Grado, Laura Hulsey, and Dana Lagaly for technical assistance, and Creekstone Farms (Arkansas City, KS) for its generous donations of bovine ovaries.

FOOTNOTES

1Supported by National Research Initiative Competitive Grant 2005-35203-15334 from the United States Department of Agriculture Cooperative State Research, Education, and Extension Service. Approved for publication by the director of the Oklahoma Agricultural Experimental Station, and supported in part under project H-2510. Back

Correspondence: 2Leon J. Spicer, 114 Animal Science Bldg., Department of Animal Science, Oklahoma State University, Stillwater, OK 74078. FAX: 405 744 7390; e-mail: leon.spicer{at}okstate.edu

Received: 18 October 2006.

First decision: 13 November 2006.

Accepted: 27 February 2007.

REFERENCES

  1. Adashi EY, Resnick CE, D'Ercole AJ, Svoboda ME, Van Wyk JJ. Insulin-like growth factors as intraovarian regulators of granulosa cell growth and function. Endocr Rev 1985; 6:400–420[Abstract/Free Full Text]
  2. Giudice LC. Insulin-like growth factors and ovarian follicular development. Endocr Rev 1992; 13:641–669[Abstract/Free Full Text]
  3. Hsueh AJ, Adashi EY, Jones PB, Welsh TH Jr. Hormonal regulation of the differentiation of cultured ovarian granulosa cells. Endocr Rev 1984; 5:76–127[Abstract/Free Full Text]
  4. Spicer LJ and Echternkamp SE. The ovarian insulin and insulin-like growth factor system with an emphasis on domestic animals. Domest Anim Endocrinol 1995; 12:223–245[CrossRef][Medline]
  5. Davoren JB, Kasson BG, Li CH, Hsueh AJ. Specific insulin-like growth factor (IGF)-I and II-binding sites on rat granulosa cells: relation to IGF action. Endocrinology 1986; 119:2155–2162[Abstract/Free Full Text]
  6. Adashi EY, Resnick CE, Rosenfeld RG. Insulin-like growth factor-I (IGF-I) and IGF-II hormonal action in cultured rat granulosa cells: mediation via type I but not type II IGF receptors. Endocrinology 1990; 126:216–222[Abstract/Free Full Text]
  7. Spicer LJ, Chamberlain CS, Maciel SM. Influence of gonadotropins on insulin- and insulin-like growth factor-I (IGF-I)-induced steroid production by bovine granulosa cells. Domest Anim Endocrinol 2002; 22:237–254[CrossRef][Medline]
  8. Baker J, Hardy MP, Zhou J, Bondy C, Lupu F, Bellve AR, Efstratiadis A. Effects of an Igf1 gene null mutation on mouse reproduction. Mol Endocrinol 1996; 10:903–918[Abstract/Free Full Text]
  9. Nakae J, Kido Y, Accili D. Distinct and overlapping functions of insulin and IGF-I receptors. Endocrine Rev 2001; 22:818–835[Abstract/Free Full Text]
  10. Veldhuis JD and Hammond JM. Multiplication stimulating activity regulates ornithine decarboxylase in isolated porcine granulosa cells in vitro. Endocr Res Commun 1979; 6:299–309[Medline]
  11. Stewart RE, Spicer LJ, Hamilton TD, Keefer BE, Dawson LJ, Morgan GL, Echternkamp SE. Levels of insulin-like growth factor (IGF) binding proteins, luteinizing hormone and IGF-I receptors, and steroids in dominant follicles during the first follicular wave in cattle exhibiting regular estrous cycles. Endocrinology 1996; 137:2842–2850[Abstract]
  12. Yuan W, Bao B, Garverick HA, Youngquist RS, Lucy MC. Follicular dominance in cattle is associated with divergent patterns of ovarian gene expression for insulin-like growth factor (IGF)-I, IGF-II, and IGF binding protein-2 in dominant and subordinate follicles. Domest Anim Endocrinol 1998; 15:55–63[CrossRef][Medline]
  13. Schams D, Berisha B, Kosmann M, Amselgruber WM. Expression and localization of IGF family members in bovine antral follicles during final growth and in luteal tissue during different stages of estrous cycle and pregnancy. Domest Anim Endocrinol 2002; 22:51–72[CrossRef][Medline]
  14. Spicer LJ, Voge JL, Allen DT. Insulin-like growth factor-II stimulates steroidogenesis in cultured bovine thecal cells. Mol Cell Endocrinol 2004; 227:1–7[CrossRef][Medline]
  15. Nahum R, Thong KJ, Hillier SG. Metabolic regulation of androgen production by human thecal cells in vitro. Hum Reprod 1995; 10:75–81[Abstract/Free Full Text]
  16. Willis DS, Mason HD, Watson H, Franks S. Developmentally regulated responses of human granulosa cells to insulin-like growth factors (IGFs): IGF-I and IGF-II action mediated via the type-I IGF receptor. J Clin Endocrinol Metab 1998; 83:1256–1259[Abstract/Free Full Text]
  17. el-Roeiy A, Chen X, Roberts VJ, LeRoith D, Roberts CT Jr, Yen SS. Expression of insulin-like growth factor-I (IGF-I) and IGF-II and the IGF-I, IGF-II, and insulin receptor genes and localization of the gene products in the human ovary. J Clin Endocrinol Metab 1993; 77:1411–1418[Abstract]
  18. el-Roeiy A, Chen X, Roberts VJ, Shimasakai S, Ling N, LeRoith D, Roberts CT Jr, Yen SS. Expression of the genes encoding the insulin-like growth factors (IGF-I and II), the IGF and insulin receptors, and IGF-binding proteins-1–6 and the localization of their gene products in normal and polycystic ovary syndrome ovaries. J Clin Endocrinol Metab 1994; 78:1488–1496[Abstract]
  19. Hernandez ER. Regulation of the genes for insulin-like growth factor (IGF) I and II and their receptors by steroids and gonadotropins in the ovary. J Steroid Biochem Mol Biol 1995; 53:219–221[CrossRef][Medline]
  20. Teissier MP, Monget P, Monniaux D, Durand P. Changes in insulin-like growth factor-II/mannose-6-phosphate receptor during growth and atresia of ovine ovarian follicles. Biol Reprod 1994; 50:111–119[Abstract]
  21. Garmey JC, Day RN, Day KH, Veldhuis JD. Mechanisms of regulation of ovarian sterol metabolism by insulin-like growth factor type II: in vitro studies with swine granulosa cells. Endocrinology 1993; 133:800–808[Abstract/Free Full Text]
  22. Ludwig T, Eggenschwiler J, Fisher P, D'Ercole AJ, Davenport ML, Efstratiadis A. Mouse mutants lacking the type 2 IGF receptor (IGF2R) are rescued from perinatal lethality in Igf2 and Igf1r null backgrounds. Dev Biol 1996; 177:517–535[CrossRef][Medline]
  23. Langhout DJ, Spicer LJ, Geisert RD. Development of a culture system for bovine granulosa cells: effects of growth hormone, estradiol, and gonadotropins on cell proliferation, steroidogenesis, and protein synthesis. J Anim Sci 1991; 69:3321–3334[Abstract]
  24. Spicer LJ and Chamberlain CS. Influence of cortisol on insulin-like growth factor I (IGF-I)-induced steroid production and on IGF-I receptors in cultured bovine granulosa cells and thecal cells. Endocrine 1998; 9:153–161[CrossRef][Medline]
  25. Spicer LJ, Chamberlain CS, Morgan GL. Proteolysis of insulin-like growth factor binding proteins during preovulatory follicular development in cattle. Domest Anim Endocrinol 2001; 21:1–15[CrossRef][Medline]
  26. Marion GB, Gier HT, Choudary JB. Micromorphology of the bovine ovarian follicular system. J Anim Sci 1968; 27:451–465[Abstract/Free Full Text]
  27. Ginther OJ, Bergfelt DR, Kulick LJ, Kot K. Selection of the dominant follicle in cattle: role of two-way functional coupling between follicle-stimulating hormone and the follicles. Biol Reprod 2000; 62:920–927[Abstract/Free Full Text]
  28. Spicer LJ and Francisco CC. The adipose obese gene product, leptin: evidence of a direct inhibitory role in ovarian function. Endocrinology 1997; 138:3374–3379[Abstract/Free Full Text]
  29. Spicer LJ and Hammond JM. Catecholestrogens inhibit proliferation and DNA synthesis of porcine granulosa cells in vitro: comparison with estradiol, 5 {alpha}-dihydrotestosterone, gonadotropins and catecholamines. Mol Cell Endocrinol 1989; 64:119–126[CrossRef][Medline]
  30. Stewart RE, Spicer LJ, Hamilton TD, Keefer BE. Effects of insulin-like growth factor I and insulin on proliferation and on basal and luteinizing hormone-induced steroidogenesis of bovine thecal cells: involvement of glucose and receptors for insulin-like growth factor I and luteinizing hormone. J Anim Sci 1995; 73:3719–3731[Abstract]
  31. Spicer LJ, Alpizar E, Vernon RK. Insulin-like growth factor-I receptors in ovarian granulosa cells: effect of follicle size and hormones. Mol Cell Endocrinol 1994; 102:69–76[CrossRef][Medline]
  32. Spicer LJ and Stewart RE. Interactions among basic fibroblast growth factor, epidermal growth factor, insulin, and insulin-like growth factor-I (IGF-I) on cell numbers and steroidogenesis of bovine thecal cells: role of IGF-I receptors. Biol Reprod 1996; 54:255–263[Abstract]
  33. Spicer LJ. Receptors for insulin-like growth factor-I and tumor necrosis factor-{alpha} are hormonally regulated in bovine granulosa and thecal cells. Anim Reprod Sci 2001; 67:45–58[CrossRef][Medline]
  34. Voge JL, Santiago CA, Aad PY, Goad DW, Malayer JR, Spicer LJ. Quantification of insulin-like growth factor binding protein mRNA using real-time PCR in bovine granulosa and theca cells: effect of estradiol, insulin, and gonadotropins. Domest Anim Endocrinol 2004; 26:241–258[CrossRef][Medline]
  35. Voge JL, Santiago CA, Aad PY, Goad DW, Malayer JR, Spicer LJ. Effect of insulin like growth factors (IGF), FSH, and leptin on IGF-binding-protein mRNA expression in bovine granulosa and theca cells: quantitative detection by real-time PCR. Peptides 2004; 25:2195–2203[CrossRef][Medline]
  36. Aad PY, Voge JL, Santiago CA, Malayer JR, Spicer LJ. Real-time RT-PCR quantification of pregnancy-associated plasma protein-A mRNA abundance in bovine granulosa and theca cells: effects of hormones in vitro. Domest Anim Endocrinol 2006; 31:357–372[CrossRef][Medline]
  37. SAS User's Guide. SAS. 1985:Cary, NC: SAS Institute Inc;17–19. In:
  38. An Introduction to Statistical Methods and Data Analysis. 1977.In Ott L (Ed.). North Scituate, MA: Duxbury Press;
  39. Zhou J, Kumar TR, Matzuk MM, Bondy C. Insulin-like growth factor I regulates gonadotropin responsiveness in the murine ovary. Mol Endocrinol 1997; 11:1924–1933[Abstract/Free Full Text]
  40. Hylka VW, Kaki MK, diZerega GS. Steroidogenesis of porcine granulosa cells from small and medium-sized follicles: effects of follicle-stimulating hormone, forskolin, and adenosine 3,'5'-cyclic monophosphate versus phorbol ester. Endocrinology 1989; 124:1204–1209[Abstract/Free Full Text]
  41. Amsterdam A, Tajima K, Frajese V, Seger R. Analysis of signal transduction stimulated by gonadotropins in granulosa cells. Mol Cell Endocrinol 2003; 202:77–80[CrossRef][Medline]
  42. Cunningham MA, Zhu Q, Unterman TG, Hammond JM. Follicle-stimulating hormone promotes nuclear exclusion of the forkhead transcription factor FoxO1a via phosphatidylinositol 3-kinase in porcine granulosa cells. Endocrinology 2003; 144:5585–5594[Abstract/Free Full Text]
  43. Zeleznik AJ, Saxena D, Little-Ihrig L. Protein kinase B is obligatory for follicle-stimulating hormone-induced granulosa cell differentiation. Endocrinology 2003; 144:3985–3994[CrossRef][Medline]
  44. Cottom J, Salvador LM, Maizels ET, Reierstad S, Park Y, Carr DW, Davare MA, Hell JW, Palmer SS, Dent P, Kawakatsu H, Ogata M, et al. Follicle-stimulating hormone activates extracellular signal-regulated kinase but not extracellular signal-regulated kinase kinase through a 100-kDa phosphotyrosine phosphatase. J Biol Chem 2003; 278:7167–7179[Abstract/Free Full Text]
  45. Erickson GF, Magoffin DA, Cragun JR, Chang RJ. The effects of insulin and insulin-like growth factors-I and -II on estradiol production by granulosa cells of polycystic ovaries. J Clin Endocrinol Metab 1990; 70:894–902[Abstract/Free Full Text]
  46. Spicer LJ. Proteolytic degradation of insulin-like growth factor binding proteins by ovarian follicles: a control mechanism for selection of dominant follicles. Biol Reprod 2004; 70:1223–1230[Abstract/Free Full Text]
  47. Weber MM, Simmler P, Fottner C, Engelhardt D. Insulin-like growth factor II (IGF-II) is more potent than IGF-I in stimulating cortisol secretion from cultured bovine adrenocortical cells: interaction with the IGF-I receptor and IGF-binding proteins. Endocrinology 1995; 136:3714–3720[Abstract]
  48. Perks CM, Denning-Kendall PA, Gilmour RS, Wathes DC. Localization of messenger ribonucleic acids for insulin-like growth factor I (IGF-I), IGF-II, and the type 1 IGF receptor in the ovine ovary throughout the estrous cycle. Endocrinology 1995; 136:5266–5273[Abstract]
  49. Hastie PM and Haresign W. Expression of mRNAs encoding insulin-like growth factor (IGF) ligands, IGF receptors and IGF binding proteins during follicular growth and atresia in the ovine ovary throughout the oestrous cycle. Anim Reprod Sci 2006; 92:284–299[CrossRef][Medline]
  50. Zhou J, Adesanya OO, Vatzias G, Hammond JM, Bondy CA. Selective expression of insulin-like growth factor system components during porcine ovary follicular selection. Endocrinology 1996; 137:4893–4901[Abstract]
  51. Hernandez ER, Roberts CT Jr, Hurwitz A, LeRoith D, Adashi EY. Rat ovarian insulin-like growth factor II gene expression is theca-interstitial cell-exclusive: hormonal regulation and receptor distribution. Endocrinology 1990; 127:3249–3251[Abstract/Free Full Text]
  52. Hernandez ER, Hurwitz A, Vera A, Pellicer A, Adashi EY, LeRoith D, Roberts CT Jr. Expression of the genes encoding the insulin-like growth factors and their receptors in the human ovary. J Clin Endocrinol Metab 1992; 74:419–425[Abstract]
  53. Voutilainen R, Franks S, Mason HD, Martikainen H. Expression of insulin-like growth factor (IGF), IGF-binding protein, and IGF receptor messenger ribonucleic acids in normal and polycystic ovaries. J Clin Endocrinol Metab 1996; 81:1003–1008[Abstract]
  54. Ellis MJC, Leav BA, Yang Z, Rasmussen A, Pearce A, Zweibel JA, Lippman ME, Cullen KJ. Affinity for the insulin-like growth factor-II (IGF-II) receptor inhibits autocrine IGF-II activity in MCF-7 breast cancer cells. Mol Endocrinol 1996; 10:286–297[Abstract/Free Full Text]
  55. Neuvians TP, Pfaffl MW, Berisha B, Schams D. The mRNA expression of insulin receptor isoforms (IR-A and IR-B) and IGFR-2 in the bovine corpus luteum during the estrous cycle, pregnancy, and induced luteolysis. Endocrine 2003; 22:93–100[CrossRef][Medline]
  56. Hastie PM and Haresign W. A role for LH in the regulation of expression of mRNAs encoding components of the insulin-like growth factor (IGF) system in the ovine corpus luteum. Anim Reprod Sci 2006; 96:196–209[CrossRef][Medline]
  57. Braulke T. Type-2 IGF receptor: a multi-ligand binding protein. Horm Metab Res 1999; 31:242–246[Medline]
  58. Kreiling JL, Byrd JC, Deisz RJ, Mizukami IF, Todd RF 3rd, MacDonald RG. Binding of urokinase-type plasminogen activator receptor (uPAR) to the mannose 6-phosphate/insulin-like growth factor II receptor: contrasting interactions of full-length and soluble forms of uPAR. J Biol Chem 2003; 278:20628–20637[Abstract/Free Full Text]
  59. Veugelers K, Motyka B, Goping IS, Shostak I, Sawchuk T, Bleackley RC. Granule-mediated killing by granzyme B and perforin requires a mannose 6-phosphate receptor and is augmented by cell surface heparan sulfate. Mol Biol Cell 2006; 17:623–633[Abstract/Free Full Text]
  60. Kang JX, Li Y, Leaf A. Mannose-6-phosphate/insulin-like growth factor-II receptor is a receptor for retinoic acid. Proc Natl Acad Sci U S A 1997; 94:13671–13676[Abstract/Free Full Text]
  61. Kamada S, Kubota T, Taguchi M, Ho WR, Sakamoto S, Aso T. Effects of insulin-like growth factor-II on proliferation and differentiation of ovarian granulosa cells. Horm Res 1992; 37:141–149[Medline]
  62. Kolodziejczyk J, Gregoraszczuk EL, Leibovich H, Gertler A. Different action of ovine GH on porcine theca and granulosa cells proliferation and insulin-like growth factors I- and II-stimulated estradiol production. Reprod Biol 2001; 1:33–41[Medline]
  63. Di Blasio AM, Vigano P, Ferrari A. Insulin-like growth factor-II stimulates human granulosa-luteal cell proliferation in vitro. Fertil Steril 1994; 61:483–487[Medline]
  64. Spicer LJ, Hamilton TD, Keefer BE. Insulin-like growth factor I enhancement of steroidogenesis by bovine granulosa cells and thecal cells: dependence on de novo cholesterol synthesis. J Endocrinol 1996; 151:365–373[Abstract/Free Full Text]
  65. Spicer LJ and Chamberlain CS. Hormonal control of ovarian cell production of insulin-like growth factor binding proteins. Mol Cell Endocrinol 2001; 182:69–81[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J ANIM SCIHome page
J. A. Grado-Ahuir, P. Y. Aad, G. Ranzenigo, F. Caloni, F. Cremonesi, and L. J. Spicer
Microarray analysis of insulin-like growth factor-I-induced changes in messenger ribonucleic acid expression in cultured porcine granulosa cells: Possible role of insulin-like growth factor-I in angiogenesis
J Anim Sci, June 1, 2009; 87(6): 1921 - 1933.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
M A Velazquez, J Zaraza, A Oropeza, R Webb, and H Niemann
The role of IGF1 in the in vivo production of bovine embryos from superovulated donors
Reproduction, February 1, 2009; 137(2): 161 - 180.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
L K Doyle, C O Hogg, E D Watson, and F X Donadeu
Seasonal effects on the response of ovarian follicles to IGF1 in mares
Reproduction, November 1, 2008; 136(5): 589 - 598.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
L. J Spicer, P. Y Aad, D. T Allen, S. Mazerbourg, A. H Payne, and A. J Hsueh
Growth Differentiation Factor 9 (GDF9) Stimulates Proliferation and Inhibits Steroidogenesis by Bovine Theca Cells: Influence of Follicle Size on Responses to GDF9
Biol Reprod, February 1, 2008; 78(2): 243 - 253.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
77/1/18    most recent
biolreprod.106.058230v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.
Agricola
Right arrow Articles by Spicer, L.J.
Right arrow Articles by Aad, P.Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS