|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Animal Science, Oklahoma State University, Stillwater, Oklahoma 74078
ABSTRACT
Little is known regarding the role of insulin-like growth factor 2 (IGF2) and the regulation of the IGF2 receptor (IGF2R) during follicular development. Granulosa cells were collected from small (1–5 mm) and large (8–22 mm) bovine follicles and were treated with IGF2 for 1–2 days in serum-free medium, and steroid production, cell proliferation, specific 125I-IGF2 binding, and gene expression were quantified. IGF2 increased both estradiol and progesterone production by granulosa cells, and cells from large follicles were more responsive to the effects of IGF2 than those from small follicles. Abundance of aromatase (CYP19A1) mRNA was stimulated by IGF2 and IGF1. The effective dose (ED50) of IGF2 stimulating 50% of the maximal estradiol production was 63 ng/ml for small follicles and 12 ng/ml for large follicles, and these values were not affected by FSH. The ED50 of IGF2 for progesterone production was 20 ng/ml for both small and large follicles. IGF2 also increased proliferation of granulosa cells by 2- to 3-fold, as determined by increased cell numbers and 3H-thymidine incorporation into DNA. Treatment with IGF1R antibodies reduced the stimulatory effect of IGF2 and IGF1 on estradiol production and cell proliferation. Specific receptors for 125I-IGF2 existed in granulosa cells, and 2-day treatment with estradiol, FSH, or cortisol had no significant effect on specific 125I-IGF2 binding. Also, FSH treatment of small- and large-follicle granulosa cells had no effect on IGF2R mRNA levels, whereas IGF1 decreased IGF2R mRNA and specific 125I-IGF2 binding. Granulosa cell IGF2R mRNA abundance was 3-fold greater in small than in large follicles. These findings support the hypothesis that both IGF2 and its receptor may play a role in granulosa cell function during follicular development. In particular, increased free IGF1 in developing follicles may decrease synthesis of IGF2R, thereby allowing for more IGF2 to be bioavailable (free) for induction of steroidogenesis and mitogenesis via the IGF1R.
follicle, follicular development, granulosa cells, IGF2 receptor, insulin-like growth factor receptor, insulin-like growth factor 2
Stimulatory effects of insulin and insulin-like growth factor 1 (IGF1) on estradiol production by mammalian granulosa cells are well documented (for review, see [1–4]), and are likely due in part to their ability to enhance the action of gonadotropins on ovarian follicular steroidogenesis [5–7]. Female IGF1-null mice that survive to adulthood have reduced FSHR mRNA levels in granulosa cells, have impaired ovarian steroidogenesis, and are infertile [8, 9], and this provides further support for the important role of IGF1 on ovarian function. Although the direct effects of IGF2 on granulosa cell function were discovered several years before IGF1 [10], little is known about the role of IGF2 and its receptor (IGF2R) in ovarian function. The present study was undertaken because in cattle, IGF2 is present in follicular fluid at concentrations greater than those of IGF1 [4, 11], thecal cell IGF2 mRNA levels are greater in dominant than in subordinate follicles [12], and both granulosa and theca cells have IGF2 mRNA [13]. The interaction between gonadotropins and IGF2 on granulosa cell steroidogenesis, studied to some extent in bovine theca cells [14] and in the granulosa cells of humans [2, 15, 16] and rats [1, 3], has not been examined in the granulosa cells of cattle. IGF2R exists in the granulosa and thecal cells of humans [17, 18], rats [19], and ewes [20], but IGF2 effects on granulosa cell steroidogenesis and mitogenesis are less than those of IGF1 [5, 21]. Based on previous studies in rat granulosa cells [5] and bovine theca cells [14], it appears that IGF2 acts through IGF1R, even though specific IGF2Rs exist in theca and granulosa cells. The function of these IGF2Rs in ovarian cell function is less clear, but it has been postulated that IGF2Rs may serve as a membrane-bound IGF-binding protein, inactivating IGF2 [14]. A similar role for IGF2R during embryonic development has been postulated [22].
Therefore, to determine the biologic function of IGF2 and its receptor in bovine granulosa cells, we set out first to evaluate the dose-response of IGF2 on granulosa cell proliferation and estradiol and progesterone production in the absence and presence of FSH, and then to evaluate the effect of various hormones on IGF2 responses as well as on specific 125I-IGF2 binding sites and IGF2R mRNA in bovine granulosa cells.
Recombinant human IGF1 and IGF2 and anti-human IGF1R antibody for cell culture were obtained from R & D Systems (Minneapolis, MN); ovine FSH (FSH activity, 15x NIH-FSH-S1 U/mg) was obtained from Scripps Laboratories (San Diego, CA); methyl-3H-thymidine was obtained from GE Healthcare (Arlington Heights, IL), staurosporine was obtained from BIOMOL Research Laboratories Inc. (Plymouth Meeting, PA), testosterone was obtained from Steraloids (Wilton, NH), and estradiol, cortisol, trypsin, collagenase, DNase, and fetal calf serum (FCS) were obtained from Sigma Chemical Co. (St. Louis, MO).
Ovaries of cattle obtained at slaughter from a nearby abattoir were brought to the laboratory on ice and processed as previously described for obtaining granulosa cells from small (1–5 mm) and large (
8 mm) follicles [23, 24]. These follicle size categories were selected because: 1) previous studies indicate that granulosa cells from small follicles are less responsive to FSH and IGF1 than are cells from large follicles [7, 24], 2) the observations that follicles 8 mm and larger have much greater estradiol concentrations than small follicles [11, 25], 3) follicles that are destined to ovulate have an average surface diameter of 10 ± 2 mm [26], and 4) selection of the dominant follicle occurs at about 8 mm in diameter [27]. Medium was a 1:1 mixture of Dulbecco modified Eagle medium and Ham F12 containing gentamicin, glutamine, and sodium bicarbonate. Approximately 2 x 105 viable cells were seeded in each plastic multiwell containing 1 ml medium. Prior to plating, granulosa cells were resuspended in medium containing 1.25 mg/ml collagenase and 0.5 ml DNase. Using trypan blue exclusion method, granulosa cell viability averaged 77% ± 3% and 67% ± 6% for small and large follicles, respectively, at time of plating. Cultures were kept at 38.5°C in a 95% air:5% CO2 atmosphere, and for all experiments medium was changed every 24 h. This culture system uses serum-free medium so that specific effects of growth factors can be ascertained; FSH has little or no effect alone, but it consistently stimulates aromatase activity when it is concomitantly treated with insulin or IGF1 [7, 24, 28]. For experiment 1, cells were cultured in medium containing 10% FCS for the first 48 h, washed twice with 0.5 ml serum-free medium, and treated for an additional 48 h with various doses (0, 10, 30, or 100 ng/ml) of recombinant human IGF2, ovine FSH (0 or 30 ng/ml), and/or recombinant human IGF1 (0 or 30 ng/ml) in serum-free medium containing 500 ng/ml testosterone as an estrogen precursor. For experiment 2, cells were cultured as in experiment 1, except that after the first 48 h in culture, cells were treated for 24 h with serum-free medium with no additions, 100 ng/ml IGF2, or 100 ng/ml IGF1, after which cellular RNA was collected (see below). For experiment 3, cells from small follicles were cultured for 48 h in 10% FCS, then serum starved for 24 h by culture in serum-free medium. The medium was changed, and then cells were cultured for an additional 40 h in serum-free medium with either no treatment, 100 ng/ml IGF2, 100 ng/ml IGF1, or 10% FCS in the presence of 1 µCi 3H-thymidine to assess DNA synthesis, as previously described [29]. For experiment 4, granulosa cells were cultured from large follicles as described for experiment 1, except that treatments were control (no additions), FSH (30 ng/ml), IGF1 (30 ng/ml), or IGF2 (30 ng/ml), and viability was assessed using the trypan blue exclusion test. For experiment 5, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in serum-free medium for 24 h with either 0 or 25 ng/ml of IGF2 or IGF1 with 30 ng/ml of FSH and 500 ng/ml of testosterone. After 24 h, medium was replaced with medium containing FSH, testosterone, and 0 or 2.5 µg anti-IGF1R antibody without or with 0 or 25 ng/ml of IGF2 or IGF1 for an additional 24 h. The cells were exposed to the anti-IGF1R antibody for 1 h before addition of IGF2 or IGF1. For experiment 6, granulosa cells were cultured from small follicles as described for experiment 1, except that treatments were IGF1 (100 ng/ml) or IGF2 (100 ng/ml), along with FSH (30 ng/ml) and the protein kinase inhibitor, staurosporine (0 or 10 nM).
For experiments 1, 5, and 6, medium was collected and stored at –20°C until radioimmunoassays previously validated in our laboratory [23, 24] were conducted to quantify progesterone and estradiol concentrations. Numbers of cells in the same wells in which medium was collected were determined using a Coulter counter as previously described [23, 30], and were used to calculate steroid production on a nanogram or picogram per 105 cell basis.
For experiment 7, cells were maintained in 10% FCS for a total of 3 days. At the end of the culture period, 125I-IGF2 binding assays were conducted as previously described [14, 31, 32]. For experiment 8, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and treated in serum-free medium for an additional 48 h with either estradiol (300 ng/ml), FSH (30 ng/ml), or cortisol (30 ng/ml) in the absence or presence of 30 ng/ml IGF1, after which binding assays were conducted with 250 000 cpm of 125I-IGF2 or 125I-IGF1 in the absence or presence of 200 ng/well of IGF2 as previously described [14, 31, 33]. Briefly, the 125I-IGF2 and 125I-IGF1 assays were conducted directly in the culture wells, with an assay volume of 400 µl. Incubation was for 16 h at 4°C for 125I-IGF2 and 125I-IGF1, and 200 ng/well unlabeled IGF2 or IGF1 was used for determination of nonspecific binding [14, 31, 33].
For experiments 9 and 10, granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated for 24 h in serum-free medium with 0 or 30 ng/ml IGF1 (experiment 9) or 100 ng/ml IGF2 with 0 or 30 ng/ml FSH (experiment 10). At the end of culture, RNA was collected, and real-time RT-PCR was used to quantify IGF2R and FSHR mRNAs, both of which were normalized to constitutively expressed 18S ribosomal RNA (see below). For experiment 11, aliquots of freshly collected granulosa and theca cells were treated with TRIzol, RNA was collected, and real-time RT-PCR was used to quantify IGF2R mRNA, which was normalized to constitutively expressed 18S ribosomal RNA (see below).
For experiments 2, 9, 10, and 11, granulosa cells were lysed in 0.5 ml TRIzol Reagent (Life Technologies Inc., Gaithersburg, MD), RNA was extracted, and RNA quantity was determined spectrophotometrically at 260 nm, as previously described [34, 35]. The target gene primers (forward and reverse) and probe sequences for CYP19A1 (accession no. NM_174305) were TGCCAAGAATGTTCCTTACAGGTA, CACCATGGCGATGTACTTTCC, and CATTTGGCTTTGGGCCCCGG, respectively; for CYP11A1 (accession no. NM_176644): ACAGGGAGAAGCTTGGCAATT, GTAGGATCCCTCGAACTTGAAGA, and AGTTTATATCATTCACCCTGAAGACGTGGCCC, respectively; for IGF2R (accession no. AF342811): GCAATGCTAAGCTTTCGTATTACG, GGTGTACCACCGGAAGTTGTATG, and ACGCCGGAGTGGGTTTCCCC, respectively; and for FSHR (accession no L22319): AACCTGCTATACATCGACCCTGAT, GCTTAATACCTGTGTTGGATATTAACAGA, and CCTTCCAGAACCTTCCCAACCTCCG, respectively. A BLAST search (http://www.ncbi.nlm.nih.gov/BLAST) also was conducted to ensure the specificity of the designed primers and probe and to assure that they were not designed from any homologous regions, coding for other genes. Furthermore, the RT-PCR product was run on an agarose gel to verify the length and size of the expected target gene. Also, 6 µl of the same RT-PCR cDNA sample was treated with 0.5 µl shrimp alkaline phosphatase and 0.5 µl exonuclease I (both from Amersham Biosciences, Piscataway, NJ), incubated at 37°C for 30 min, and further incubated at 85°C for 15 min before sequencing to verify the sequence and specificity of the RT-PCR quantification of the desired target gene.
The differential expression of target gene mRNA in granulosa cells was quantified using the one-step, real-time RT-PCR reaction for Taqman Gold RT-PCR Kit (Applied Biosystems, Foster City, CA), as previously described [34, 35]. Briefly, based on preliminary optimization results, 50 or 100 ng total RNA was amplified in a total reaction volume of 25 µl consisting of 200 nM forward primer, 200 nM reverse primer, and 200 nM fluorescent (FAM/TAMRA) probe for each target gene; 10 nM of 18S rRNA primers and 100 nM of the 18S rRNA VIC-labeled probe, along with 12.5 µl TaqMan Master Mix without uracil N-glycosylase; and 1 unit Multiscribe with RNase inhibitor (Applied Biosystems). Thermal cycling conditions were set to 30 min at 48.8°C for reverse transcription and 95°C for 10 min for AmpliTaq Gold Activations, and were finished with 45 cycles at 95°C for 15 sec for denaturing and 60°C for 1 min for annealing and extension. The 18S rRNA values were used as internal controls to normalize samples for any variation in amounts of RNA loaded, as previously described [34, 35]. All samples were run in duplicate. Relative quantification of target gene mRNAs were expressed using the comparative threshold cycle method, as previously described [34–36]. Briefly, the
Ct was determined by subtracting the 18S Ct value from the target unknown value. For each target gene and within each experiment, the 
Ct was determined by subtracting the higher
Ct (the least expressed unknown) from all other
Ct values. Fold changes in target gene mRNA expression were calculated as being equal to 2–
Ct.
Experimental data are presented as means ± SEM of measurement from replicated experiments. Each experiment was replicated three or more times, and within each experiment treatments were applied in triplicate culture wells. Each experiment was conducted on a separate pool of granulosa cells obtained from 8 to 15 cows or heifers. The main effects and their interactions on the variables measured were assessed by the general linear models procedure of SAS [37]. To correct for heterogeneity of variance, estradiol production, CYP19A1 mRNA, IGF2R mRNA, and 125I-IGF1 binding were analyzed after transformation natural log (x + 1). Specific differences among treatments were tested using the Fisher protected least-significant difference procedure [38]. Significance was declared at P < 0.05 unless noted otherwise. Specific binding of 125I-IGF2 and 125I-IGF1 to granulosa cells was expressed as cpm/100 cells or as a percentage of total binding.
Experiment 1 was conducted to compare the dose-response of IGF2 on basal and FSH-induced steroid production by granulosa cells collected from small (experiment 1A) and large (experiment 1B) follicles. In experiment 1A, granulosa cells from small follicles treated with 10 and 30 ng/ml IGF2 in the absence of FSH had no effect (P > 0.10) on estradiol production, whereas 100 ng/ml increased estradiol production by 8-fold (Fig. 1A). In the presence of FSH, all doses of IGF2 tested increased (P < 0.05) estradiol production, with maximal effects observed in small-follicle granulosa cells (i.e., 24-fold increase; Fig. 1A) with 100 ng/ml IGF2, and in 30 ng/ml IGF2 in granulosa cells from large follicles (i.e., 7-fold; Fig. 1B). In small-follicle granulosa cells, 30 and 100 ng/ml IGF2 increased progesterone production by 2- to 3-fold, regardless of whether FSH was present (Fig. 2A). Similarly, granulosa cells from large follicles (experiment 1B) treated with 30 and 100 ng/ml IGF2 in the absence of FSH increased (P < 0.001) both estradiol (Fig. 1B) and progesterone (Fig. 2B) production by 2- to 4-fold above controls. The estimated effective dose (ED50) of IGF2 stimulating 50% of the maximal aromatase response (calculated from stimulation curves that were linearized using a semi-log plot) averaged 63 ng/ml and 12 ng/ml for small- and large-follicle granulosa cells, respectively, and these values were not affected by FSH. The estimated ED50 of IGF2 stimulating 50% of the maximal progesterone response averaged 20 ng/ml for both small- and large-follicle granulosa cells, and this value was not affected by FSH. Also, IGF2 increased (P < 0.05) cell numbers by 1.4- to 2.2-fold (Table 1).
|
|
|
Experiment 2 was conducted to compare the effects of IGF2 and IGF1 on CYP19A1 and CYP11A1 mRNA abundance in small- and large-follicle granulosa cells. Treatment of granulosa cells with 100 ng/ml of either IGF2 or IGF1 increased (P < 0.05) CYP19A1 mRNA abundance by 3-fold in small- and large-follicle granulosa cells (Fig. 3A). Although the increases induced by IGF2 and IGF1 were similar within each cell type, the amount of CYP19A1 mRNA was 8-fold greater (P < 0.05) in granulosa cells from large than small follicles (Fig. 3A). Neither IGF2 nor IGF1 affected CYP11A1 mRNA abundance in granulosa cells (Fig. 3B). The amount of CYP11A1 mRNA was 2.3-fold greater (P < 0.05) in granulosa cells of large than small follicles (Fig. 3B).
|
Experiment 3 was conducted to compare the effects of IGF2 and IGF1 on DNA synthesis as measured by 3H-thymidine incorporation. Treatment of granulosa cells from small follicles with 100 ng/ml of either IGF2 or IGF1 increased (P < 0.05) 3H-thymidine incorporation similarly (by 4-fold), but to a lesser extent than 10% FCS (13-fold increase; Fig. 4).
|
Experiment 4 was conducted to compare the effects of FSH, IGF1, and IGF2 on viability of large-follicle granulosa cells. Compared with untreated controls, 2-day treatment of granulosa cells with 30 ng/ml FSH, 100 ng/ml IGF2, or 100 ng/ml IGF1 had no effect (P < 0.05) on cell viability, which averaged 63% (Table 2). FSH had no effect on cell numbers, whereas IGF1 and IGF2 increased (P < 0.05) cell numbers 1.8- and 1.6-fold above controls, respectively (Table 2). Also, IGF1 and IGF2 increased (P < 0.05) basal progesterone production by 7.3- and 5.9-fold above controls and basal estradiol production by 14.5- and 19.5-fold above controls. FSH increased (P < 0.05) progesterone production by 52% and tended to increase (P < 0.08) estradiol production by 69% (Table 2).
|
Experiment 5 was conducted to determine whether blocking the IGF1R reduced the stimulatory effects of IGF2 or IGF1 on granulosa cell steroidogenesis and cell proliferation. Treatment of large-follicle granulosa cells with 2.5 µg/ml anti-IGF1R antibody during the second 24-h treatment with IGF2 or IGF1 significantly decreased the stimulatory effect of 25 ng/ml of IGF2 and IGF1 on estradiol production (Fig. 5A) and cell proliferation (Fig. 5B). Anti-IGF1R antibody had no effect on estradiol production stimulated by FSH and had no effect on basal cell numbers (Fig. 5). The stimulatory effects of IGF2 and IGF1 on progesterone production was not significantly altered by concomitant treatment with the anti-IGF1R antibody (data not shown).
|
Experiment 6 was conducted to compare the effects of a protein kinase inhibitor, staurosporine, on IGF1- and IGF2-induced steroid production and cell numbers. Two-day treatment of small-follicle granulosa cells with 10 nM staurosporine caused a reduction (P < 0.05) in the aromatase (Fig. 6A) and cell proliferation (Fig. 6B) responses to both IGF1 and IGF2. IGF1 increased estradiol and progesterone production to greater (P < 0.05) levels than IGF2. Staurosporine had no effect (P > 0.10) on progesterone production induced by IGF1 or IGF2, which averaged 156 ± 7 and 89 ± 5 ng/105 cells per 24 h, respectively.
|
Experiment 7 was conducted to compare IGF1 and IGF2 competition for 125I-IGF1 and 125I-IGF2 binding sites on granulosa cells. In experiment 7A, 1 and 100 ng/well IGF2 inhibited binding of 125I-IGF2 to granulosa cells to a greater extent than did the same doses of IGF1 (Fig. 7A). In experiment 7B, 3, 10, and 100 ng/well of IGF1 and IGF2 inhibited granulosa 125I-IGF1 binding, whereas 1 ng/well of IGF1 or IGF2 had no effect on 125I-IGF1 binding (Fig. 7B). These and additional ligand binding experiments revealed that IGF1 cross-reactivity with granulosa IGF2R averaged 0.3%, whereas cross-reactivity of IGF2 with granulosa IGF1R averaged 53%.
|
Experiment 8 was conducted to determine whether various hormones can alter specific 125I-IGF2 binding sites on granulosa cells. Two-day treatment of small-follicle granulosa cells with estradiol (300 ng/ml), FSH (30 ng/ml), or cortisol (30 ng/ml) in the presence or absence of 30 ng/ml IGF1 had no significant effect on specific binding of 125I-IGF2 to granulosa cells (Fig. 8A). However, 2-day treatment with IGF1 decreased (P < 0.05) specific 125I-IGF2 binding to granulosa cells (Fig. 8A).
|
Experiment 9 was conducted to determine the effects of IGF1 on IGF2R and FSHR mRNA levels in small-follicle granulosa cells. Granulosa cells were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated with 0 or 30 ng/ml IGF1 for 24 h, and RNA was collected. Real-time PCR revealed that levels of IGF2R mRNA were decreased (P < 0.05) by 29%, whereas the level of FSHR mRNA was increased (P < 0.05) by 3.3-fold with IGF1 treatment (Fig. 8B).
Experiment 10 was conducted to determine the effects of FSH on IGF2R mRNA and FSHR mRNA abundance in granulosa cells. Granulosa cells from small and large follicles were cultured for 48 h in the presence of 10% FCS, and then cells were washed and incubated in the presence of 30 ng/ml IGF2 without or with 30 ng/ml FSH for 24 h. Real-time PCR revealed that FSH had no effect on FSHR (Fig. 9A) or IGF2R (Fig. 9B) mRNA levels in granulosa cells collected from small or large follicles.
|
Experiment 11 was conducted to determine whether theca and granulosa cells collected from small and large follicles differed in IGF2R mRNA levels. Real-time RT-PCR revealed that granulosa cells from small follicles had 3-fold greater (P < 0.05) IGF2R mRNA abundance than granulosa cells from large follicles (Fig. 10). In contrast, theca cells from large follicles had 14-fold greater (P < 0.01) IGF2R mRNA abundance than theca cells from small follicles (Fig. 10).
|
For the first time, developmental and hormonal regulation of IGF2R gene expression and its function in granulosa cells was documented. In particular, results of the present study revealed that: 1) IGF2 increased both estradiol and progesterone production by granulosa cells, and cells from large follicles were more responsive than those from small follicles to the effects of IGF2; 2) IGF2 also increased cell numbers and DNA synthesis; 3) IGF2 and IGF1 increased abundance of CYP19A1 mRNA but did not affect abundance of CYP11A1 mRNA in granulosa cells; 4) the stimulatory effects of IGF2 and IGF1 on estradiol production and cell proliferation were inhibited by addition of antibodies against IGF1R; 5) IGF2 and IGF1 competed for both IGF1R and IGF2R; 6) 2-day treatment with IGF1 inhibited 125I-IGF2 binding and IGF2R mRNA levels, whereas FSH had no effect; and 7) granulosa cell IGF2R mRNA levels were greater in small than in large follicles, whereas theca cell IGF2R mRNA levels were greater in large than in small follicles. Thus, IGF2 appears to increase proliferation and stimulate differentiation in granulosa cells via the IGF1R, and the IGF2R may be hormonally regulated and associated with decreased granulosa cell responses by acting as a type of decoy receptor for IGF2.
Previously, little evidence existed that characterized the interaction between FSH and IGF2 on granulosa cell steroidogenesis and mitogenesis in cattle. We observed that aromatase activity in granulosa cells from large follicles was much more sensitive to the effects of IGF2 than aromatase activity in the granulosa cells from small follicles, and that FSH and IGF2 synergized to induce steroidogenesis in bovine granulosa cells. This synergism likely involves IGF-induced upregulation of the FSHR, as shown in this study and in previous studies [39], but it likely does not involve FSH-induced downregulation of the IGF2R, since FSH did not alter IGF2-specific binding or IGF2R mRNA in the present study. Alternatively, differences in cellular responses to IGF2 and FSH may depend on the interactions among intracellular cascade mechanisms (e.g., protein kinase C and cAMP pathways) that may coexist within a particular cell type. Such differences for IGF1 signaling exist between small- and medium-follicle granulosa cells in pigs [40]. Specific intracellular signaling systems that contribute to aromatase and progesterone production in FSH-responsive cells include MAP kinase [41], phosphatidylinositol 3-kinase [42], and protein kinases A and B [43, 44]. Inhibition of IGF1- and IGF2-induced aromatase activity by the protein kinase inhibitor, staurosporine, supports the role of protein kinases in both IGF2 and IGF1 signal transduction. However, the determination of which specific intracellular protein kinases are activated by IGF1 and IGF2 in granulosa cells will require further study.
Gene expression studies revealed that granulosa cells from large follicles had a greater abundance of CYP19A1 mRNA than those from small follicles, and in both cell types IGF2 and IGF1 induced CYP19A1 mRNA similarly. The ED50 for IGF2-stimulated steroid production by bovine granulosa cells from the present study (i.e., 12–63 ng/ml) is within the range of those reported for rat [1] and human [15, 45] granulosa cells and bovine theca cells [14]. Also, consistent with a previous report [7], estradiol production by small-follicle granulosa cells was less sensitive than large-follicle granulosa cells to the stimulatory effects of FSH on estradiol production. As previously suggested [46], it is likely that in the presence of elevated FSH, only a small amount of "free" IGF2 or IGF1 is needed to increase estradiol production by the early dominant follicle as the level of IGFBP decreases in follicular fluid. A similar conclusion was made regarding the role of IGF1 in stimulating aromatase activity of granulosa cells in an elevated FSH environment [7]. The present study revealed that the ED50 of IGF2 (i.e., 12–63 ng/ml) for bovine granulosa cell progesterone and estradiol production is about 2-fold greater than that of IGF1 (5–36 ng/ml; [7]), and that the maximal effect of IGF2 (i.e., 7- to 24-fold increases) is similar to or slightly less than that of IGF1 (i.e., 13- to 37-fold increases; [7, 24]). In the present study, the maximal effect of IGF2 on estradiol production was usually less than IGF1 in granulosa cells of small follicles, but estradiol responses were similar for IGF1 and IGF2 in granulosa cells of large follicles. Previous reports using human [16] and rat [5, 6] granulosa cells and bovine theca cells [14] indicated that the maximal effect of IGF2 on steroidogenesis was less than that of IGF1. Because bovine theca cells from large follicles do not respond to IGF2 as well as granulosa cells and have a greater abundance of IGF2R mRNA than granulosa cells, perhaps the relative maximal effects of IGF2 versus IGF1 are dependent on the relative proportions of IGF1R and IGF2R present, which may be influenced by cell type and(or) species.
In the present study, IGF2 competed half as well as IGF1 with 125I-IGF1 binding sites, and anti-IGF1R antibodies attenuated the stimulatory effects of IGF2 and IGF1 on estradiol production and cell proliferation, and thus we speculate that the stimulatory effect of IGF2 on granulosa steroidogenesis and cell proliferation is mediated via IGF1R. Although not reported previously for bovine granulosa cells, a similar conclusion was reached using bovine adrenocortical cells [47] and bovine theca cells [14]. Previous studies have documented the presence of 125I-IGF1 and 125I -IGF2 binding sites in the granulosa cells of cattle [11, 24, 32, 33] and sheep [20], as well as IGF1R and/or IGF2R mRNA in the granulosa cells of sheep [48, 49], pigs [50], rats [19, 51], and humans [17, 18, 52, 53]. We further speculate that because IGF2Rs are present on granulosa cells, and the ED50 of IGF2 on granulosa cell steroidogenesis is appreciably less than IGF1, IGF2R may act as a type of decoy receptor via binding and inactivation of IGF2. This latter suggestion was made for bovine theca cells [14], and is further supported by studies of Adashi et al. [6], which reported that granulosa cell IGF2R does not participate in transmembrane IGF signaling. Similarly, in human MCF-7 breast cancer cells, IGF2R is thought to operate as an IGF2 antagonist, suppressing IGF2-induced cellular proliferation [54]. In the present study, IGF2 receptors (IGF2R mRNA and specific 125I-IGF2 binding) were decreased by IGF1 but not affected by FSH, estradiol, or cortisol. This suggests that as free IGF1 increases within the growing follicle, it suppresses IGF2R in granulosa cells, thereby reducing the attenuating effect that IGF2R may have on IGF2-stimulated differentiation. Consistent with the present study, FSH and estrogen treatment had no effect on ovarian IGF2R mRNA levels in rats [19]. Physiologic changes in IGF2R in granulosa cells have not been studied previously in cattle, but IGF2R mRNA levels significantly increased during the mid and late cycles in bovine corpora lutea [55, 56]. In ewes, follicular IGF2R mRNA levels measured using in situ hybridization were greater in atretic than in healthy follicles and were greater in small than in large follicles [49]. A greater number of IGF2Rs in small follicles compared with large follicles measured in the present study, along with a less sensitive steroid response to IGF2 is consistent with the notion that IGF2R reduces the biologic effect of IGF2. It should be noted that IGF2R may serve other functions in addition to acting as a negative regulator of IGF2 ligand bioavailability [57]. For example, in other cell types IGF2R can bind urokinase-type plasminogen activator receptor and plasminogen [58, 59], and it may be a receptor for retinoic acid [60]. Whether these other functions of the IGF2R are operative in ovarian tissue or granulosa cells in particular will require further elucidation.
The present study has shown for the first time a stimulatory effect of IGF2 on bovine granulosa cell proliferation as measured by increased cell numbers and increased 3H-thymidine incorporation. These observations agree with previous reports in which treatment with IGF2 increased 3H-thymidine incorporation and numbers of porcine granulosa [61, 62] and human granulosa-lutein [63] cells. Moreover, the stimulatory effect of IGF2 on cell numbers was significantly reduced with concomitant treatment with anti-IGF1R antibodies or a protein kinase inhibitor, staurosporine. The lack of an effect of IGF1 or IGF2 on cell viability suggests that IGF1 and IGF2 may be targeting cell cycle events more than antiapoptotic events to induce proliferation of granulosa cells. Collectively, these studies indicate that IGF2 acting through IGF1R may be involved in growth of the granulosa layer within ovarian follicles in addition to its stimulatory effect on steroidogenesis.
Because IGF2-induced increases in estradiol production (i.e., <2 ng/105 cells per 24 h) represented no more than 10% of the progesterone produced by granulosa cells in the present study, it is likely that IGF2 also acts to enhance de novo steroidogenesis from cholesterol in bovine granulosa cells. In support of this suggestion, inhibition of HMG-CoA reductase, a key enzyme for de novo cholesterol synthesis, dramatically reduces IGF1-induced progesterone production by bovine granulosa cells [64]. Although IGF2 stimulates CYP11A1 mRNA by several-fold in porcine granulosa cells [21], IGF2 had no effect on CYP11A1 mRNA in bovine granulosa cells in the present study, suggesting that species differences may exist in terms of IGF2 responsiveness. Interestingly, the anti-IGF1R antibody inhibited estradiol production but not progesterone production, suggesting that cholesterol stores that can serve as progestin precursors were increased during the first 24 h of treatment with IGF2 and IGF1 so that sufficient progestin precursor existed to maintain progesterone production during the second 24-h treatment period. It is unlikely that the granulosa cells luteinized with time in culture in the present study because: 1) progesterone production remains constant or does not increase with time using this culture paradigm [23, 24], 2) the morphology of the granulosa cells retains a fibroblastic appearance [65], 3) aromatase activity of granulosa cells remains responsive to FSH and IGF1, and their responses increase between Days 3 and 4 of culture [7, 24], and 4) granulosa cells from small and large follicles have little or no progesterone response to LH [7].
In conclusion, this study is first to demonstrate expression and function of IGF2R in bovine granulosa cells, indicating that the IGF2R may serve as a type of decoy receptor to modulate IGF2 action. Moreover, IGF2 and IGF1 may share common intracellular cascade mechanisms in bovine granulosa cells, in spite of the fact that specific receptors for each hormone exist in this cell type. Additional studies will be required to further characterize the hormonal regulation of IGF2R in granulosa cells and whether changing levels of granulosa IGF2R are involved in the control of follicle growth.
ACKNOWLEDGMENTS
The authors gratefully acknowledge Dustin Allen, Alberto Grado, Laura Hulsey, and Dana Lagaly for technical assistance, and Creekstone Farms (Arkansas City, KS) for its generous donations of bovine ovaries.
FOOTNOTES
1Supported by National Research Initiative Competitive Grant 2005-35203-15334 from the United States Department of Agriculture Cooperative State Research, Education, and Extension Service. Approved for publication by the director of the Oklahoma Agricultural Experimental Station, and supported in part under project H-2510. ![]()
Correspondence: 2Leon J. Spicer, 114 Animal Science Bldg., Department of Animal Science, Oklahoma State University, Stillwater, OK 74078. FAX: 405 744 7390; e-mail: leon.spicer{at}okstate.edu
Received: 18 October 2006.
First decision: 13 November 2006.
Accepted: 27 February 2007.
REFERENCES
-dihydrotestosterone, gonadotropins and catecholamines. Mol Cell Endocrinol 1989; 64:119–126[CrossRef][Medline]
are hormonally regulated in bovine granulosa and thecal cells. Anim Reprod Sci 2001; 67:45–58[CrossRef][Medline]This article has been cited by other articles:
![]() |
J. A. Grado-Ahuir, P. Y. Aad, G. Ranzenigo, F. Caloni, F. Cremonesi, and L. J. Spicer Microarray analysis of insulin-like growth factor-I-induced changes in messenger ribonucleic acid expression in cultured porcine granulosa cells: Possible role of insulin-like growth factor-I in angiogenesis J Anim Sci, June 1, 2009; 87(6): 1921 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
M A Velazquez, J Zaraza, A Oropeza, R Webb, and H Niemann The role of IGF1 in the in vivo production of bovine embryos from superovulated donors Reproduction, February 1, 2009; 137(2): 161 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
L K Doyle, C O Hogg, E D Watson, and F X Donadeu Seasonal effects on the response of ovarian follicles to IGF1 in mares Reproduction, November 1, 2008; 136(5): 589 - 598. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J Spicer, P. Y Aad, D. T Allen, S. Mazerbourg, A. H Payne, and A. J Hsueh Growth Differentiation Factor 9 (GDF9) Stimulates Proliferation and Inhibits Steroidogenesis by Bovine Theca Cells: Influence of Follicle Size on Responses to GDF9 Biol Reprod, February 1, 2008; 78(2): 243 - 253. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |