|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Obstetrics and Gynecology, Shimane University School of Medicine, Izumo 693-8501, Japan
ABSTRACT
Adenylate cyclase-activating polypeptide 1 (ADCYAP1) binds both Gs- and Gq-coupled receptors and stimulates adenylate cyclase/cAMP and protein kinase C/mitogen-activated protein kinase 3/1 (MAPK3/1) signaling pathways in pituitary gonadotrophs. In this study, we investigated the cAMP and MAPK3/1 signaling pathways induced by ADCYAP1 stimulation and examined the effects of ADCYAP1 on the expression of gonadotropin subunit genes using a clonal gonadotroph cell line, LbetaT2. ADCYAP1 increased intracellular cAMP accumulation up to 19-fold in LbetaT2 cells. Common alpha-glycoprotein subunit gene (Cga) promoter activity was strongly activated by both ADCYAP1 and the cyclic-AMP analog, 8-(4-chlorophenylthio) adenosine 3',5'-cyclic monophosphate (CPT-cAMP). Both had little effect on luteinizing hormone beta (Lhb) and follicle-stimulating hormone beta (Fshb) promoter activities. Cga promoter activity was significantly increased by transfection with constitutively active cAMP-dependent protein kinase (PKA). Activities of the Lhb and Fshb promoters were only modestly increased. Both ADCYAP1 and CPT-cAMP induced MAPK3/1 activation in LbetaT2 cells. The MEK inhibitor, U0126, and the PKA inhibitors, H89 and cAMP-dependent protein kinase peptide inhibitor (PKI), completely inhibited MAPK3/1 activation by either ADCYAP1 or CPT-cAMP. Using luciferase reporter constructs containing cis-elements, the cAMP response element (Cre) promoter was stimulated about 4-fold by ADCYAP1. ADCYAP1-induced Cre promoter activity was completely inhibited by H89, but not by U0126. ADCYAP1 also increased the activity of the serum response element (Sre) promoter, a target for MAPK3/1, and treatment of the cells with U0126 completely inhibited ADCYAP1-induced Sre promoter activity. ADCYAP1-increased Cga promoter activity was inhibited partially by both H89 and U0126. Although combining the inhibitors showed an additive inhibition effect, it did not result in complete inhibition. These results suggest that in LbetaT2 cells, ADCYAP1 mainly increases Cga through activation of PKA and MAPK3/1, as well as through an additional unknown pathway.
cyclic adenosine monophosphate, hypothalamic hormones, kinases, neuroendocrinology, pituitary hormones
Although the pituitary gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone (FSH), are mainly controlled by the hypothalamic peptide, gonadotropin-releasing hormone (GnRH), adenylate cyclase-activating polypeptide 1 (ADCYAP1) also participates in gonadotropin synthesis and is released alone or in cooperation with GnRH. In the male rat, intra-atrial injection of ADCYAP1 increases the plasma level of LH [1], and treatment of rat anterior pituitary cells with ADCYAP1 induces a transient stimulation of gonadotropin release [2]. The stimulatory effects of ADCYAP1 on gonadotropin production are also evident in the single-gonadotroph cell model, such as
T3–1 cells, in which the common alpha-glycoprotein subunit gene (Cga) promoter is activated by ADCYAP1 [3].
ADCYAP1 was first isolated from an extract of ovine hypothalamus on the basis of its ability to stimulate cAMP formation in rat pituitary cells [4]. The ADCYAP1 receptor exists not only in the central nervous system, but also in peripheral organs. The wide distribution of ADCYAP1 and its receptors suggests that this peptide has numerous physiologic functions [5]. The cDNA sequence of Adcyap1 cDNA places it in the vasoactive intestinal polypeptide (VIP)-glucagon-secretin superfamily of structurally related peptides. It exerts its action via three heptahelical G-protein-linked receptors: one ADCYAP1-specific (ADCYAP1R1) receptor and two receptors (VIPR1 and VIPR2) shared with VIP [5]. ADCYAP1 acts predominantly via ADCYAP1R1 receptors and stimulates both inositol phosphate turnover and cAMP accumulation, with potencies of approximately 1000-fold and 100-fold, respectively, compared with VIP [4].
The gonadotropin hormones, LH and FSH, contain Cga and specific beta subunits [6]. The various signal transduction pathways regulating gonadotropin subunit Cga, Lhb, and Fshb gene expressions are well studied and include the mitogen-activated protein kinase (MAPK) families, mitogen-activated kinase 3/1 (also known as extracellular signal-regulated kinases 1 and 2) [7, 8], MAPK8 (c-Jun N-terminal kinase) [8, 9], and MAPK14 (p38MAPK) [8, 10], as well as cAMP-dependent protein kinase (PKA) [11] and calcium/calmodulin-dependent protein kinase pathways [12].
GnRH is the primary regulator of gonadotropin secretion and gene expression. Binding to its seven-transmembrane G-protein-coupled receptor (GNAQ, known as Gq) stimulates an increase in inositol phosphate turnover and diacylglycerol levels, both of which ultimately lead to increased intracellular Ca2+ concentrations and activation of protein kinase C. As a result, GnRH activates members of the MAPK families [13–15]. GnRH also couples with GNAS (known as Gs) protein and increases cAMP accumulation [11]. ADCYAP1 mainly stimulates cAMP accumulation in pituitary cells. Given that the binding of ADCYAP1 to the ADCYAP1R1 receptor couples with both adenylate cyclase and phospholipase C via GNAS and GNAQ proteins [4], it is possible that ADCYAP1 and GnRH share signal transduction systems to regulate gonadotropin gene expression.
The development of single-cell models of pituitary gonadotrophs, such as
T3–1 and LßT2 cells, facilitates studying the signaling systems regulating gonadotropin subunit gene expression. In this study we examined ADCYAP1 action on gonadotropin gene expression using LßT2 gonadotroph cells and described the signal transduction system, focusing on cAMP-PKA and MAPK3/1 signaling.
The following chemicals and reagents were obtained from the indicated sources: Fetal calf serum (FCS), JRH Biosciences (Lenexa, KS); ADCYAP1, 8-(4-chlorophenylthio) adenosine 3',5'-cyclic monophosphate (CPT-cAMP) and Dulbecco modified Eagle medium (DMEM), Sigma Chemical Co. (St. Louis, MO); H89, Biomol (Plymouth, PA); cAMP-dependent protein kinase peptide inhibitor (PKI), Promega (Madison, WI); U0126, phosphorylated MAPK3/1 (anti-P-MAPK3/1) antibody, and anti-MAPK3/1 antibody, Santa Cruz Biotechnology (Santa Cruz, CA); cAMP response element (Cre) and serum response element (Sre) firefly luciferase reporter genes (pCre-Luc and pSre-Luc) and pFC-PKA, Stratagene (La Jolla, CA); and pCI-neo, Promega (Madison, WI).
LßT2 cells were kindly provided by Dr. P.L. Mellon (University of California, San Diego, CA). LßT2 cells were cultured in DMEM containing 10% FCS and 50 µg/ml streptomycin and maintained at 37°C in an atmosphere of 95% air-5% CO2 [16]. Cells from passages 8–12 were used in this study. Two or three days before experiments, 2 x 105 to 4 x 105 cells were plated on a 35-mm Petri dish (Nunc, Roskilde, Denmark). When test reagents were added, LßT2 cells were incubated in DMEM without FCS at 37°C for the indicated times with or without the test reagents. When inhibitors were included, the cells were preincubated with each inhibitor for 60 min at 37°C as indicated. We used previously reported concentrations of ADCYAP1 (100 nM), CPT-cAMP (1 mM), U0126 (10 µM), H89 (10 µM), and PKI (10 µg/ml) [17–20]. The cells were incubated with or without ADCYAP1 or CPT-CAMP in the presence or absence of each inhibitor. After incubation for the indicated times, the medium was quickly aspirated, and the cells were washed once with PBS and immediately frozen in liquid N2.
Cells were plated in 96-well plates at density of 104 cells/well and were cultured for 72 h. Cells were then preincubated with serum-free DMEM for 60 min and incubated for 1 h with 100 nM ADCYAP1 in 100 µl DMEM. Intracellular cAMP levels were measured using the cAMP enzyme immunoassay system from Amersham Pharmacia Biotech (Little Chalfont, UK).
Reporter Plasmid Construct and Luciferase Assay
The reporter constructs used in these experiments were generated by fusing –797/+5 of rat Lhb gene (Lhb-Luc), –2000/+698 of rat Fshb gene (Fshb-Luc), or –846/0 of the human Cga (common alpha-glycoprotein subunit) gene (Cga-Luc) cDNA in pXP2, as previously described [21, 22]. LßT2 cells were cotransfected by electroporation with 2.0 µg gonadotropin subunit-Luc and pRL-TK (0.1 µg DNA; Promega), which contains the Renilla luciferase under the herpes simplex virus thymidine kinase promoter. In some experiments, the cells were cotransfected with either the pFC-PKA (1.0 µg DNA) or the pCI-neo (mock) expression vectors in addition to the gonadotropin luciferase vectors and pRL-TK. When the activity of the promoter containing Cre or Sre was measured, the cells were transfected with either pCre-Luc (1.0 µg DNA) or pSre-Luc (1.0 µg DNA), which have the Cre enhancer (4x) or five-tandem repeats of Sre (AGGATGTCCATATTAGGACATCT), respectively, upstream of the TATA box of the firefly luciferase gene. After incubation for 48 h, the cells were treated with the chemicals specific for each experiment. The activities of firefly luciferase and Renilla luciferase were measured by the Dual Luciferase Reporter Assay System (Promega) with a luminometer (TD-20/20; Promega) according to the manufacturer's protocol. The ratio of the luminescence signal of firefly luciferase to that of Renilla luciferase was determined.
RNA Preparation, Reverse Transcription, and Real-Time Quantitative RT-PCR Procedure
Total RNA from untreated or treated LßT2 cells was extracted using commercially available extraction method Trizol-LS (Gibco BRL Life Technologies) according to the manufacturer's instruction. To obtain cDNA, 2 µg total RNA was reverse transcribed using an oligo-dT primer (Promega) and was prepared using a First-Strand cDNA Synthesis kit (Invitrogen) in 1' reverse transcription (RT) buffer supplemented with 0.01 M dithiotreitol (DTT) and 1 mM each of dNTP and 200 units of RNase inhibitor/human placenta ribonuclease inhibitor (Ribonuclease Inhibitor, Code No. 2310A, Takara, Tokyo, Japan) in a final volume of 25 µl, followed by incubation at 37°C for 60 min. Quantification of Cga, Lhb, and Fshb mRNA expression was obtained by real-time quantitative PCR using fluorescent Taqman methodology (ABI Prism 7700 Sequence Detector; Perkin Elmer Applied BioSystems, Foster City, CA) using TaqMan probes labeled with Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA). The PCR primers were designed based on the published sequences for Cga, Lhb, and Fshb [23], whereas internal reference Gapdh primer was purchased from Sigma Chemical Co. (St. Louis, MO). Real-time PCR amplification and product detection was performed using an ABI PRISM 7700 Sequence Detection System (Perkin Elmer Applied Biosystems) as recommended by the manufacturer (User Bulletin no. 2). The simultaneous measurement of each gene (Cga, Lhb, and Fshb) and Gapdh permitted normalization of the amount of cDNA added per sample. Each assay included a standard curve sample in duplicate, a no-template control, and a cDNA sample from the treated LßT2 cells in triplicate. For each set of primers, a no-template control and a no-reserve amplification control were included. The thermal cycling conditions were: 94°C for 2 min for the first cycle, followed by 40 cycles of 94°C for 30 sec, 55°C for 30 sec, 75°C for 30 sec, and extension at 75°C for 5 min. Reaction conditions were programmed on a Power Macintosh 7100 (Apple Computer, Santa Clara, CA) linked directly to the model 7700 sequence detector. The crossing threshold was determined using the PRISM 7700 software. Postamplification dissociation curves were performed to verify the presence of a single amplification product in the absence of DNA contamination.
The cells were rinsed twice with PBS, then lysed on ice with RIPA buffer (PBS, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing 0.1 mg/ml phenylmethylsulfonyl fluoride, 30 mg/ml aprotinin, and 1 mM sodium orthovanadate. After sonication, the insoluble materials were removed by centrifugation at 15 000 x g for 10 min. The protein concentration was determined by the method of Bradford [24], with BSA as the standard. Cell extracts were treated with SDS sample buffer [25] and boiled for 2 min. Samples containing the same amount of protein were subjected to SDS-PAGE in 10% acrylamide and were transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated overnight with anti-phosphorylated-MAPK3/1 antibody (P-MAPK3/1; 1:1000). The membrane was washed three times with blocking solution containing 4.5% nonfat dry milk, 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% NP-40 (Nakalai Co.), followed by more than four washes with Tris-buffered saline with washing TBS containing 100 mM Tris-HCl (pH 7.5), 0.9% NaCl, and 0.1% NP-40 at room temperature. The membrane was then incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000). Immunoreactive proteins were detected using the enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech) per the manufacturer's protocol. Following chemiluminescence detection, membranes were exposed onto X-ray film (Kodak, Rochester, NY). For reprobing, the membrane was submerged in stripping buffer (Restore buffer; Pierce Chemical Co.) and incubated at room temperature for 30 min. The membrane was washed with blocking solution and washing-TBS as described above and was subjected to immunoblot analysis with anti-MAPK3/1 antibody (T-MAPK3/1; 1:1000), followed by incubation with HRP-conjugated secondary antibody as described above. Films were analyzed by densitometry, and the intensities of P-MAPK3/1 bands were normalized to those of T-MAPK3/1 to correct for protein loading in the case of cellular lysates. Corrected results were expressed as a fold of the unstimulated control samples. Each experiment was repeated at least three times.
Each experiment was independently conducted at least three times on cells from separate dishes. Each experiment was repeated at least twice with reproducible results. Values were expressed as means ± SEM. Statistical analysis was performed using the one-way ANOVA plus the Duncan multiple range test. P < 0.05 was considered statistically significant.
Cyclic AMP Accumulation in LßT2 Cells
ADCYAP1 is known to stimulate adenylate-cyclase activity and to accelerate cAMP formation in pituitary cells. We confirmed that treatment of LßT2 cells with 100 nM ADCYAP1 for 1 h raised intracellular cAMP levels by up to 18.9 ± 0.03-fold compared with nontreated cells (Fig. 1).
|
Effects of ADCYAP1 and CPT-cAMP on Gonadotropin Subunit in LßT2 Cells
To investigate ADCYAP1 action on the expressions of gonadotropin subunit genes, LßT2 cells were transfected with Cga-Luc, Lhb-Luc, or Fshb-Luc, followed by ADCYAP1 stimulation, which increased Cga promoter activity to 9.06 ± 0.17-fold but had little effect on Lhb and Fshb promoter activities, which increased only 1.26 ± 0.05-fold and 1.39 ± 0.05-fold, respectively. In a manner similar to ADCYAP1, 1 mM CPT-cAMP, a cell membrane-permeable cAMP analog, activated the Cga promoter up to 10.74 ± 1.41-fold and the Lhb and Fshb promoters up to 2.95 ± 0.08-fold and 1.24 ± 0.02-fold, respectively (Fig. 2A). At the mRNA level, ADCYAP1 increased Cga mRNA expression up to 13.15 ± 1.39-fold, whereas Lhb and Fshb mRNA were modestly expressed to 2.75 ± 0.82-fold and 1.33 ± 0.43-fold, respectively (Fig. 2B). These results were quite comparable to those of promoter assays. Regarding transcription following Cga promoter induction, the maximal responses were obtained with ADCYAP1 concentrations ranging from 10 nM to 1 µM (Fig. 3A), or a CPT-cAMP concentration of 1 mM (Fig. 3B).
|
|
Effects of Overexpression of pFC-PKA on Gonadotropin Subunit Promoter Activity
Both ADCYAP1 and CPT-cAMP dramatically increased gonadotropin Cga promoter activity but only minimally increased Lhb and Fshb promoter activities, suggesting that cAMP/PKA signaling principally regulates the gonadotropin CGA. To investigate the direct effect of cAMP/PKA on the activity of the gonadotropin subunit promoter, LßT2 cells were transfected with the pFC-PKA plasmid vector to induce expression of constitutively active PKA. Compared with the pCI-neo-transfected cells (mock), Cga promoter activity was dramatically increased up to 23.93 ± 0.42-fold with PKA overexpression. Lhb and Fshb promoter activities, however, increased only 2.46 ± 0.07-fold and 1.39 ± 0.01-fold, respectively (Fig. 4). These results suggest that PKA activation largely contributes to the induction of Cga gene expression, and it is consistent with the previous data showing that ADCYAP1 and CPT-cAMP had a greater effect on the Cga than on Lhb and Fshb.
|
Effects of ADCYAP1 and CPT-cAMP on MAPK3/1 Activation
We examined whether ADCYAP1 and CPT-cAMP activated MAPK3/1 in LßT2 cells. Western blotting using anti-phospho-MAPK3/1 antibody followed by treatment with 100 nM ADCYAP1 increased MAPK3/1 phosphorylation, with a maximal peak at 10 min and continued activation for 2 h after stimulation (Fig. 5A). CPT-cAMP (1 mM) also activated MAPK3/1, with a peak at 30 min (Fig. 5B).
|
Effects of PKA Inhibitors and MEK Inhibitor on ADCYAP1-Induced and CPT-cAMP-Induced MAPK3/1 Activation
The effects of U0126, an MEK inhibitor, and PKA inhibitors were examined. Both ADCYAP1-induced and CPT-cAMP-induced MAPK3/1 activations were completely inhibited by U0126 (Fig. 6, A and B), suggesting that ADCYAP1-induced and CPT-cAMP-induced MAPK3/1 activations were both dependent on upstream MEK kinase. In addition, both ADCYAP1-induced and CPT-cAMP-induced MAPK3/1 activations were inhibited completely in the presence of H89 (Fig. 6, C and D). Similar results were obtained by the experiment using PKI, which is more specific to inhibit PKA and is structurally unrelated with H89. ADCYAP1-increased MAPK3/1 phosphorylation was completely inhibited in the presence of PKI (Fig. 6E). These results indicated that the ADCYAP1 action to activate MAPK3/1 depends on the activation of PKA by cAMP. The basal level of MAPK3/1 phosphorylation was eliminated by U0126 but not by H89 and PKI.
|
Effects of PKA Inhibitor and MEK Inhibitor on ADCYAP1-Induced and CPT-cAMP-Induced Cga Promoter Activity
We have shown that only the Cga promoter and not the Lhb and Fshb promoters were strongly activated by ADCYAP1 and CPT-cAMP in LßT2 cells. We next examined whether the PKA and MAPK3/1 pathways were involved in ADCYAP1-induced and CPT-cAMP-induced Cga gene expression. Inclusion of H89 or U0126 partially inhibited ADCYAP1 action on Cga promoter activity by similar degrees. Combining H89 and U0126 demonstrated additive inhibition of ADCYAP1-induced Cga promoter activity. (Fig. 7A). The lack of complete inhibition suggests that PKA and MAPK3/1 pathways each partially contribute to ADCYAP1-induced Cga gene expression. Similarly, CPT-cAMP stimulation was inhibited significantly by both H89 and U0126 but in an incomplete fashion (Fig. 7B). Thus, both ADCYAP1-stimulated and CPT-cAMP-stimulated Cga promoter activities depend on cAMP-PKA and MAPK3/1 pathways, but another signaling system is also involved.
|
Effects of PKA Inhibitor and MEK Inhibitor on Cre Promoter Activity by ADCYAP1 and CPT-cAMP
The Cga promoter region harbors a cAMP-response element (Cre) [26]. We next examined whether ADCYAP1 and CPT-cAMP activate Cre, and we examined the effect of H89 and U0126 using Cre luciferase reporter constructs (Cre-Luc). Cre-Luc activity was increased 4.11 ± 0.19-fold with 100 nM ADCYAP1, and the activity was completely inhibited by H89. Cre-Luc activity was not inhibited in the presence of U0126, suggesting that ADCYAP1-induced Cre activity was completely dependent on cAMP-PKA pathways (Fig. 8A). Similar results were obtained with CPT-cAMP stimulation. Cre promoter activity induced by CPT-cAMP was increased 3.05 ± 0.02-fold, and it was completely inhibited in the presence of H89 (Fig. 8B); however, U0126 did not modify CPT-cAMP's effect on Cre-Luc activity. These results suggest that Cre-mediated transcription by ADCYAP1 and CPT-cAMP is involved in the PKA but not the MAPK3/1 signaling pathway.
|
Effects of PKA Inhibitor and MEK Inhibitor on Sre Promoter Activity by ADCYAP1 and CPT-cAMP
The serum response element (Sre) is a DNA domain in the promoter region that binds the MAPK3/1-mediated transcription factor. Next, we examined ADCYAP1-induced and CPT-cAMP-induced Sre promoter activities. ADCYAP1 and CPT-cAMP activated the Sre promoter by 2.03 ± 0.2-fold and 1.78 ± 0.21-fold, respectively, and the effects were inhibited by U0126. Similarly, H89 completely prevented ADCYAP1-induced and CPT-cAMP-induced Sre promoter activities. These results suggest that Sre-mediated transcription by ADCYAP1 or CPT-cAMP depend totally on PKA as well as MAPK3/1 activation (Fig. 9).
|
ADCYAP1, which is widely distributed throughout the central nervous system, plays an important role in the regulation of various physiologic events. The ADCYAP1 receptor, ADCYAP1R1, is expressed in the pituitary gland, and ADCYAP1 acts either alone or in cooperation with GnRH to stimulate mRNA expression and secretion of LH and FSH [5]. The development of the immortalized murine pituitary gonadotroph-derived models,
T3–1 and LßT2 cells, which possess GnRH receptors and gonadotroph-like characteristics, has enabled the detailed study of the signal transduction systems regulating gonadotropin gene expression. Through cAMP accumulation, cAMP/PKA signaling, and Cre-dependent promoter activation, ADCYAP1 stimulates the Cga gene in
T3–1 cells [3]. LßT2 cells are more mature than
T3–1 cells in that they possess GnRH receptors and express three gonadotropin subunits, Cga, Lhb, and Fshb, and respond to GnRH.
The ADCYAP1 receptor in pituitary cells couples with both GNAS and GNAQ proteins, which accelerate the adenylate cyclase (AC) and phospholipase C (PLC) signaling pathways [4]. In this study, we used LßT2 cells to examine the function and signaling of ADCYAP1, with a focus on cAMP/PKA and MAPK3/1. We found that ADCYAP1 increased cAMP accumulation as well as MAPK3/1 activation in LßT2 cells. The PKA inhibitors, H89 and PKI, completely inhibited ADCYAP1-induced MAPK3/1 activation, suggesting that ADCYAP1-induced MAPK3/1 activation depended completely on cAMP/PKA pathways. The experiments using the cAMP analog, CPT-cAMP, confirm this hypothesis, since CPT-cAMP increased MAPK3/1 activation, which then was inhibited by PKA inhibitors (Fig. 6). In the presence of MEK inhibitor, U0126, basal levels of MAPK3/1 phosphorylation were abrogated, whereas H89 did not affect basal MAPK3/1 phosphorylation. U0126 might be strong enough to prevent basal (endogenous) MAPK3/1 phosphorylation. Another possible explanation is that the U0126 inhibitory effect on basal MAPK3/1 phosphorylation might be affected by the nature of the medium used and compounds added during incubation. According to the results showing that H89 did not affect basal levels of MAPK3/1 phophorylation, inhibition of PKA presumably does not prevent basal MAPK3/1 phosphorylation; however, it may inhibit only if MAPK3/1 is dependently phosphorylated by PKA. Sre-Luc activity, which is a target of MAPK3/1, was also increased by both ADCYAP1 and CPT-cAMP. These effects were completely abolished by H89 (Fig. 9). The action of cAMP signaling on MAPK3/1 signaling differs among cell types. For example, cAMP inhibits epidermal growth factor-induced MAPK3/1 activation in Rat1 fibroblast cells [27, 28] and in rat cortical astrocytes stimulated with bovine fibroblast growth factor [29]. In contrast, in PC12 cells [30], COS-7 cells [31], and rat pituitary GH3 cells [32], cAMP activates MAPK3/1. The molecular mechanisms by which cAMP mediates MAPK3/1 activation are unclear, but the beta- and gamma-subunits of GNAI (guanine nucleotide binding protein) or Rap-1, a Ras homolog, might be involved [31, 33].
ADCYAP1 action on gonadotropin CGA transcription is well described. Intact Cre is required to obtain the full transcriptional activation of the CGA in
T3–1 cells [3], and protein kinase C and MAPK3/1 participate in the regulation of CGA transcription in LßT2 cells [34]. In our present study using LßT2 cells, ADCYAP1 as well as CPT-cAMP strongly stimulated Cga promoter activity in a dose-dependent manner. The effect was minimal on the Lhb and Fshb subunits. In addition, constitutive expression of active PKA following transfection with pFC-PKA strongly activated the Cga promoter but only minimally affected the Lhb and Fshb promoters. These results suggest that cAMP/PKA signaling is the most important component for the induction of Cga gene expression in LßT2 cells.
Our finding that ADCYAP1 increases both cAMP/PKA and MAPK3/1 pathways and that MAPK3/1 activation is PKA dependent (Fig. 6) prompted the question of how PKA and MAPK3/1 signaling contribute to the Cga gene expression. The cAMP analog CPT-cAMP increased Cga gene expression to a similar degree as was achieved with ADCYAP1, and this action was largely inhibited in the presence of H89. This suggests that cAMP action on the CGA was largely dependent on PKA (Fig. 7B). Two other pathways activated by cAMP might also contribute to Cga gene expression. One is a PKA-activated, Cre-dependent signaling pathway, and the other is a PKA-dependent, Cre-independent MAPK3/1 signaling pathway. The latter pathway is not prominent, since activation of Cga gene expression by CPT-cAMP was only partially inhibited by U0126, an inhibitor of MEK, and CPT-cAMP-activated Cre-Luc activity was not modulated in the presence of U0126. As described above, two major signaling pathways evoked by cAMP contributed to Cga activation. CPT-cAMP-induced elevation of the Cga promoter activity was still present even after treatment with inhibitors of both pathways, H89 and U0126, at concentrations sufficient to suppress Cre-Luc and MAPK3/1 activation completely. These results suggest that an unknown mediator other than PKA and MAPK3/1 might be involved in CGA activation by cAMP.
Although the ADCYAP1 receptor in pituitary cells has been reported to couple with both the GNAS and GNAQ proteins, MAPK3/1 activation by ADCYAP1 stimulation was completely inhibited in the presence of two structurally unrelated PKA inhibitors, H89 and PKI. This suggests that ADCYAP1-increased activation of MAPK3/1 was cAMP/PKA dependent in LßT2 cells. ADCYAP1-increased MAPK3/1 activation did not stimulate Cre-Luc, since there was no inhibition of ADCYAP1-induced Cre-Luc activity in the presence of U0126. Similarly, U0126 failed to inhibit CPT-cAMP-induced Cre-Luc activity, indicating that MAPK3/1 signaling was not linked to the transcription factor, cAMP-responsive element binding protein (CREB), and Cre-dependent gene expressions. The discrepancy between the effects of PKA and MEK inhibitors on the induction of Cga and Cre-Luc activity by ADCYAP1 and CPT-cAMP suggests that the signaling systems downstream of ADCYAP1 receptors are complex. H89 partially inhibited Cga gene expression following ADCYAP1 stimulation, which also had an inhibitory effect, but not completely when stimulation was performed with CPT-cAMP. Similar to the effect of H89, U0126 partially inhibited Cga stimulation, regardless of whether CPT-cAMP or ADCYAP1 was used. H89 caused marked inhibition on CPT-cAMP-induced Cga gene promoter activation in comparison with partial inhibition by ADCYAP1 stimulation. In addition, the inhibition effect on CPT-cAMP-induced promoter activation by U0126 plus H89 was no greater than H89 alone. On the other hand, combination of U0126 and H89 showed an additive inhibition effect on ADCYAP1-stimulated Cga gene promoter activation. We used CPT-cAMP as an indicator of a cAMP increase by ADCYAP1. The accumulation of cAMP in the cells evoked by ADCYAP1 mainly contributes to Cga gene promoter activation in a PKA-dependent manner. PKA dependency includes a cAMP/PKA-stimulated, Cre-dependent pathway and PKA-dependent, MAPK3/1/Sre-dependent (which is not Cre dependent) transcriptional activation. Marked inhibition of CPT-cAMP-induced Cga gene promoter by H89 might be explained by the fact that H89 inhibits both of these two pathways. Studies performed with two specific inhibitors, H89 and U0126, showed that cAMP/PKA and MAPK3/1 pathways are involved in ADCYAP1-induced Cga gene expression. It is evident that these two pathways coordinately evoke ADCYAP1 effects, which then contribute to Cga gene expression, confirmed with an additive inhibition effect by combination of H89 and U0126 treatment. Inhibition of PKA and MAPK3/1 pathways by two specific inhibitors did not abolish ADCYAP1-induced Cga gene expression completely, even when the inhibitors were added at concentrations known to fully inhibit each individual pathway, but neither is crucial. ADCYAP1, which has been known to couple with GNAS and GNAQ protein, increases adenylate cyclase and PLC activity, resulting in numerous downstream cascade events, including cAMP accumulation, calcium elevation, activation of PKC, MAPK3/1, and so on. That is why ADCYAP1 exerts its signals by divergent pathways to increase Cga gene promoter activation. In this context, cAMP and MAPK3/1 are the most possible components that may contribute in Cga promoter activation by ADCYAP1 stimulation. In the present study, our results suggest that another unknown kinase or other signaling molecules are involved in ADCYAP1 effects.
Although the involvement of cAMP/PKA and MAPK3/1 signaling pathways in ADCYAP1-induced Cga gene expression was proved to be partial, we need to consider an ADCYAP1-mediated response element in Cga gene promoters. According to the reports of Fowkes et al., both SF-1 binding to the gonadotrope-specific element (Gse) and CREB binding to Cre are necessary to obtain full activation of ADCYAP1-induced Cga promoter in
T3–1 cells [35]. They showed that cAMP/PKA and MAPK3/1 signaling pathways may, cooperatively or independently, enhance the phosphorylation of SF-1 and CREB to induce subsequent interaction with their specific elements in
T3–1 cells. In this present study, we used Sre-Luc and Cre-Luc as alternative transcription targets instead of SF-1 and CREB. On the basis of our findings, although unknown mechanisms might be involved for full activation of the Cga promoter, we concluded that ADCYAP1 increased cAMP/PKA activation as well as activation of MAPK3/1 in a PKA-dependent manner and induced Cga gene expression as elucidated previously in LßT2 cells. In our study, LßT2 cells responded to ADCYAP1 and increased CGA. On the other hand, one previously published study showed the disruption of ADCYAP1/cAMP response in exerting Cga gene expressions in LßT2 cells [36]. The reason for the different responses of Cga by ADCYAP1 stimulation in LßT2 cells is not clear, but it can be attributed to the experimental condition, including promoter length, the type of plasmid, stimulation time, and type of cell line.
This is a report examining the effects of ADCYAP1 on a single gonadotroph cell line, LßT2. We have shown that Cga is strongly increased by ADCYAP1 stimulation, with only a slight increase in Lhb and Fshb. The anterior pituitary is composed of at least five different cell types, each producing different hormones. ADCYAP1 stimulates the release of prolactin, growth hormone, adrenocorticotropic hormone, and gonadotropin LH and FSH from the pituitary gland [5]. Although in this present study using a single gonadotroph cell type, ADCYAP1 principally stimulated the Cga of gonadotropin, it is possible that hormones produced by other anterior pituitary cells in proximity to the gonadotroph may modulate the expressions of the Lhb and Fshb genes. Additionally, accumulation of the Cga in gonadotrophs following ADCYAP1 stimulation might modulate the expression and secretion of other subunits controlled by GnRH. Both GnRH and ADCYAP1 are hypothalamic neuropeptides that influence the gonadotropin synthesis and release. The effects of ADCYAP1 on GnRH has been suggested by previous reports. ADCYAP1 enhances GnRH-stimulated gonadotropin secretion from cultures of primary rat pituitaries as well as from
T3–1 cells [37, 38]. This may be partly due to increases in GnRH receptor numbers [39, 40] or to increased numbers of gonadotrophs that respond to the GnRH signal [41]. It was evident that ADCYAP1 had a role in gonadotropin regulation by acting alone or synergistically with GnRH; however, it remained unclear how ADCYAP1 affects GnRH signaling. Recent reports showed that GnRH counteracted ADCYAP1 induction of cAMP in PKC-dependent ways [42]. We are now examining further the interaction of ADCYAP1 with GnRH signaling focused on MAPK3/1. Preliminary examination showed that ADCYAP1 enhanced GnRH-induced MAPK3/1 activation as well as gonadotropin subunit gene expressions (data not shown).
As summarized in Figure 10, ADCYAP1 increases intracellular cAMP concentration, which results in increased MAPK3/1 activation in a cAMP/PKA-dependent manner in LßT2 cells. ADCYAP1 mainly increases the Cga promoter activity of the three gonadotropin subunits, and both PKA and MAPK3/1 seem to be involved in this regulation. However, studies with inhibitors suggest that the full activation of Cga promoters also involves an as yet unidentified pathway.
|
Correspondence: 1Haruhiko Kanasaki, Department of Obstetrics and Gynecology, Shimane University School of Medicine, 89-1 Enya-cho, Izumo 693-8501, Japan. FAX: 81 853 20 2264; e-mail: kanasaki{at}med.shimane-u.ac.jp
Received: 24 January 2007.
First decision: 14 February 2007.
Accepted: 26 June 2007.
REFERENCES
This article has been cited by other articles:
![]() |
S. Lariviere, G. Garrel-Lazayres, V. Simon, N. Shintani, A. Baba, R. Counis, and J. Cohen-Tannoudji Gonadotropin-Releasing Hormone Inhibits Pituitary Adenylyl Cyclase-Activating Polypeptide Coupling to 3',5'-Cyclic Adenosine-5'-Monophosphate Pathway in L{beta}T2 Gonadotrope Cells through Novel Protein Kinase C Isoforms and Phosphorylation of Pituitary Adenylyl Cyclase-Activating Polypeptide Type I Receptor Endocrinology, December 1, 2008; 149(12): 6389 - 6398. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |