Biol Reprod Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

BOR - Papers in Press, published online ahead of print August 15, 2007.
Biol Reprod 2007, 10.1095/biolreprod.107.064139
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
77/6/1073    most recent
biolreprod.107.064139v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A
Agricola
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A
BIOLOGY OF REPRODUCTION 77, 1073–1080 (2007)
DOI: 10.1095/biolreprod.107.064139
© 2007 by the Society for the Study of Reproduction, Inc.

Luteinizing Hormone Beta Promoter Stimulation by Adenylyl Cyclase and Cooperation with Gonadotropin-Releasing Hormone 1 in Transgenic Mice and LBetaT2 Cells1

Heather A Ferris 3, Heidi E Walsh 4, Jonathan Stevens 5, Patricia C Fallest 5, and Margaret A Shupnik 2 3 4 5

Department of Physiology,3 Neuroscience Graduate Program,4 and Department of Internal Medicine, Division of Endocrinology and Metabolism,5 University of Virginia Medical School, Charlottesville, Virginia 22903

ABSTRACT

Rat luteinizing hormone beta (Lhb) gene transcription is stimulated by hypothalamic gonadotropin-releasing hormone 1 (GnRH1), and this response may be modulated by other signaling pathways such as cAMP. Here we characterize the ability of cAMP, alone or with GnRH1, to stimulate Lhb gene transcription in mouse pituitary and clonal gonadotroph cells. Both cAMP and pituitary adenylyl cyclase-activating peptide increase GnRH1 stimulation of luciferase activity in pituitaries of mice expressing the rat Lhb-luciferase transgene, suggesting cAMP and GnRH1 pathways interact in vivo. cAMP stimulation of the Lhb-luciferase transgene was similar between females in metestrus and proestrus, but GnRH1 stimulation was greater at proestrus. Additive effects with combined treatments were observed at metestrus and proestrus. Elevated intracellular cAMP stimulated Lhb promoter activity in LbetaT2 clonal gonadotroph cells, alone and with GnRH1. In LbetaT2 cells, cAMP stimulation of the Lhb promoter was eliminated by inhibition of protein kinase A (PKA); GnRH1 stimulation was partially suppressed by either PKA or protein kinase C inhibitors. Only the proximal GnRH1-responsive region of the promoter was required for cAMP stimulation, and mutation of the 3' NR5A1 site diminished the response. Regulation of primary mRNA transcripts from the endogenous Lhb gene by cAMP and GnRH1 correlated with results from the Lhb-luciferase transgene or transfected promoter. Occupancy of the endogenous promoter by EGR1 was increased by GnRH1 with or without forskolin, but forskolin alone had little effect. Thus, cAMP stimulation of Lhb promoter activity, and enhancement of GnRH1 stimulation, occurs in multiple physiological states independent of steroid status, via a PKA-dependent mechanism.

ADCYAP1, cAMP, EGR1, GnRH1, LH beta, mechanisms of hormone action, NR5A1, steroid hormones

INTRODUCTION

Pituitary gonadotrophs produce and secrete the glycoprotein hormones luteinizing hormone (LH) and follicle-stimulating hormone (FSH). Each is composed of a unique β-subunit (Lhb and Fshb, respectively) and a common {alpha}-subunit. The best-characterized physiological signal regulating transcription of the subunit genes and secretion of the hormones is gonadotropin-releasing hormone 1 (GnRH1), which is secreted in pulses from the hypothalamus. In rats, GnRH1 pulses of once every 8–30 min preferentially stimulate transcription of the {alpha}-subunit (Cga), though only intermediate-frequency pulses of once every 30 min stimulate Lhb, and slower pulses of once every 120 min stimulate Fshb [1, 2]. In normal gonadotrophs, only Cga is modestly stimulated by continuous GnRH1 treatment [3].

IGnRH1 receptor activation stimulates multiple signaling pathways, which differentially influence transcription of the gonadotropin subunit genes [4–7]. A variety of promoters have been analyzed in heterologous and gonadotroph cell lines, as well as in rodent pituitary cells. In general, these findings implicate calcium influx, protein kinase C (PRKCC), and mitogen-activated protein kinase kinase (MAP2K1) as activators of Cga transcription [4, 5, 7]. In normal gonadotroph cells, Lhb gene transcription occurs primarily through activation of PRKCC and calcium, with less involvement of the MAP2K1 pathway [4, 5, 8]. We showed that calcium/calmodulin-dependent protein kinase type II (CAMK2) acts downstream of calcium to increase transcription of both Cga and Lhb, but the targets of CAMK2 have not been identified [9]. PRKCC activation of Lhb gene transcription occurs at least in part by stimulating protein levels of the immediate-early transcription factor EGR1 [10, 11]. EGR1 is one of several transcription factors interacting with the Lhb promoter. The proximal promoter region contains binding sites for steroidogenic factor-1 (NR5A1), EGR1, homeodomain transcription factors, and an AP-1-like binding site [12, 13], and the distal region contains two SP1 sites and a CArG box [14].

In addition to GnRH1, several other hormones modulate gonadotropin transcription, and the steroids in particular may influence both basal and GnRH1-stimulated gene expression. For example, estrogen stimulates rat Lhb gene transcription, whereas testosterone suppresses Cga and GnRH1-stimulated Lhb transcription [15–18]. In contrast, both testosterone and activin stimulate basal and GnRH1-stimulated Fshb gene transcription, whereas inhibin suppresses Fshb [18–20]. In addition, some peptide hormones such as pituitary adenylyl cyclase-activating peptide (ADCYAP1, also known as PACAP) are present at high concentrations during the ovulatory surge, an opportune time to influence GnRH1 actions [21, 22]. As its name implies, one important action of ADCYAP1 is to increase intracellular cAMP levels. Previous studies suggested that increases in gonadotroph cAMP, due to either ADCYAP1 or pharmacological agents, stabilize the Lhb gene transcript and increase GnRH1 receptor (GnRH1-R) and EGR1 protein levels, all of which could increase Lhb mRNA [23–25]. GnRH1 acting through the GnRH1-R may also stimulate cAMP by coupling to the G-protein subunit GNAS (also known as G{alpha}s), thus activating adenylyl cyclase [26]. We investigated regulation of the endogenous and transfected Lhb promoter by cAMP and the influence of GnRH1 and steroids on these pathways. We used the mouse gonadotroph LβT2 cell line and normal mouse gonadotroph cells, two systems containing all the components required for in vivo Lhb gene transcription. These data show that cAMP signaling can work in conjunction with GnRH1 in gonadotrophs to enhance Lhb transcription via protein kinase A (PKA) activation and an NR5A1 site. Steroid treatment alone does not modify the cAMP response, but because ADCYAP1 secretion is stimulated during proestrus, it may promote further increases in Lhb transcription stimulated by pulsatile GnRH1 and contribute to the ensuing LH surge.

MATERIALS AND METHODS

Vectors and Constructs

The rat Lhb gene promoter from –617 to +44 bp, the smaller –245 to +44 region, and –411 to +44/I77 of the Cga promoter were cloned into the promoterless LUCII expression vectors as described [14]. The –617 construct contains both upstream and downstream GnRH1-responsive elements, whereas the –245 construct contains only the downstream GnRH1 response element. Site-directed mutagenesis was performed using the QuikChange kit (Stratagene, La Jolla, CA) and the following primers in both the –617 and –245 Lhb luciferase constructs, with bold letters indicating mutated residues:

3'NR5A1 GCCTCTGCTTAGTGGAATTCCCACCCCCACAACCCG, 5'NR5A1-GTCCCTGGCTTTTCTGAAATTGTCTGTCTCGCCCCC, 3'EGR1 GTGGCCTT-GCCACCCTTAGAACCTGCAGGTATAAAGCC, 5'EGR1 CTGACCTTGTCTG-TCTAGTACTCAAAGAGATTAGTGTC, AP-1 GCCAATTCACTGAGATGCTGGAGCTGGTCCCTGGC.

Expression constructs for the inhibitor of PKA (CMV-PKI) and mutated inhibitor (CMV-PKIm) were provided by Dr. Richard Day (University of Virginia, Charlottesville, VA) [27].

Clonal Cell Lines and Transfection

LβT2 and {alpha}T3 cells were obtained from Dr. Pamela Mellon (University of California, San Diego, CA). Cells were maintained in Dulbecco modified Eagle medium (DMEM; Mediatech, Herndon, VA) containing 10% fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml streptomycin. Approximately 5 x 105 cells were plated per 20-mm well and grown for 24 h in phenol-free DMEM/5% charcoal-stripped newborn calf serum before transfection with Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Cells were transfected for 16 h with 0.75 µg of reporter DNA per well, washed in PBS, and treated with 1 µM forskolin (Fsk) or vehicle in media for 6 h. The inhibitors H89 (5 µM; PKA inhibitor; Sigma Chemical Co., St. Louis, MO) and PD098059 (PD; 50 µM; ERK inhibitor; Calbiochem, San Diego, CA), and BIM-1 (1 µM; PRKCC inhibitor; Sigma) were added to cells 30 min prior to Fsk treatment. The inhibitory peptide PKI or its inactive mutant, PKIm, or empty PUC19 parental vector (0.75 µg per well) were transfected with reporter construct. After treatment, cells were washed with PBS, collected in 150 µl lysis buffer (Promega, Madison, WI), and frozen overnight. Cell lysates were assayed for luciferase activity in a Turner 20e luminometer (Turner Designs, Mountain View, CA) using D-luciferin (ICN, Aurora, OH) and for total protein using the Bio-Rad protein assay reagent (Bio-Rad, Hercules, CA). Results are expressed as Arbitrary Light Units (ALU) per 100 µg of protein or as a fold increase of the treated compared to untreated construct. Some experiments also used cotransfected CMV-β galactosidase enzyme activity for normalization. Experiments were analyzed using two-way ANOVA and Bonferroni post-hoc analysis.

Transgenic Mice

Mice expressing the –2.0 kb to +41 bp rat Lhb promoter-luciferase transgene were previously described [28]. These mice express Lhb promoter activity specifically in the pituitary, and luciferase activity is regulated in vivo by gonadectomy, steroids, and a GnRH1 antagonist. Pituitaries from transgenic, randomly cycling female mice over 6 wk old or female animals at metestrus or protestrus were removed, and cultured cells were treated as previously described [4]. Reproductive cycle stage was determined by vaginal smears for at least two full cycles. Pituitary cells were treated for 6 h with 100 nM GnRH1, 100 nM thyrotropin-releasing hormone (TRH), 5 µM Fsk, 100 nM ADCYAP1, or treatments in combination. After treatment, cells were collected in lysis buffer, and luciferase activity and protein were measured. Each treatment was performed in a minimum of three independent experiments, with three to five animals per group. Statistical significance was assessed using multiple comparisons by Tukey significant-difference procedure. Use of the mice was approved by the University of Virginia Animal Use Committee and in accordance with the Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching.

Western Blots

Western blots were performed on LβT2 cell lysates collected in 2X gel loading buffer (100 mM Tris-HCL [pH 6.8], 4% SDS, 20% glycerol, 25 mM NaF, 1 mM Na3VO4). Proteins were run on 10% SDS-acrylamide gels at 140 V for 1.5–2 h, then transferred to nitrocellulose membranes. Membranes were blocked in 5% nonfat dry milk in 20 mM Tris base, 137 mM NaCl, 3.8 mM HCL, and 0.1% Tween-20 for 1 h at room temperature then incubated with the primary antibody as follows: NR5A1 (Upstate, Lake Placid, NY) 1:1000, overnight, 4°C; EGR1 (C-19 or 588; Santa Cruz Biotechnology, Santa Cruz, CA) 1:10 000, overnight, 4°C; β-actin (Sigma) 1:50 000, 1 h at room temperature; RNF4 (Dr. J.J. Palvimo, Helsinki, Finland) 1:3000, overnight, 4°C. After washing, the blots were incubated with either mouse (β-actin) or rabbit (EGR1, NR5A1, RNF4) secondary antibody (1:10 000) for 1 h. Protein was detected with SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL). Films were analyzed by densitometry, and immunoreactive protein levels in each sample were normalized for β-actin on the same blot.

Chromatin Immunoprecipitation Assay

Chromatin immunoprecipitation (ChIP) assays were performed as described previously [29]. Cross-linked chromatin lysates were sonicated, diluted with sonication buffer plus protease inhibitors (0.2 mg/ml leupeptin and aprotinin, 20 mM PMSF), divided, and incubated at 4°C overnight with no antibody or antibodies to EGR1 (8 µg) or NR5A1 (7.5 µg), then precipitated with protein A-agarose beads (Santa Cruz). The NR5A1 antibody has no cross-reactivity with LRH-1, as cited by the manufacturer and by our methods. Cross-linking was reversed by addition of NaCl (100 mM final concentration) band incubation at 65°C for 3 h. Proteins were eluted from beads by incubation with 1% SDS, 0.1 M NaHCO3, and 0.01 mg/ml herring sperm DNA, then digested with Proteinase K. DNA was extracted with phenol-chloroform, and mouse Lhb promoter sequences were detected with primers that flank the sequence between –102 bp (forward-CTGTGTCTCGCCCCCAAAGAGATTA) and –1 bp (reverse-CCTGGCTTTATACCT-GCGGGGTT). DNA was quantitated by real-time PCR (iCycler; Bio-Rad) incorporating SYBR green, as previously described [30]. GAPDH and Lhb coding region primers were used as negative controls as in [31] (data not shown). For PCR quantification, previously described protocols were followed [28], using a total of 40 cycles with continuous SYBR green monitoring. Cycle numbers were normalized using standard curves to control for differences in primer efficiency. Values derived from the standard curve were then each normalized to the 1% input sample for that treatment group. Each sample was twice subjected to real-time PCR in triplicate and from three independent immunoprecipitations. Figure 7A was analyzed using one-way ANOVA and Tukey post hoc test.


Figure 07
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 7 Occupancy of the endogenous mouse Lhb promoter by NR5A1 or EGR1 after GNHR1 or Fsk. LβT2 cells were treated with vehicle (control), 100 nM Fsk, 10 nM GnRH1, or both (F+G). ChIP was performed on cell lysates with no antibody (–Ab), or antibodies to NR5A1 or EGR1. Samples were quantified using real-time PCR of the mouse Lhb promoter normalized to input DNA. A) NR5A1 and EGR1 occupancy of the Lhb promoter. *P ≤ 0.05 versus –Ab; #P ≤ 0.05 versus control. B) Representative Western blot of EGR1, NR5A1, β-actin (b-actin), and RNF4 (SNURF) proteins after treatment.

Primary Transcript Assay

Primary transcript assays were performed as previously described [32]. LβT2 cells were plated at a density of 2.5 x 106 cells per 40-mm well. Cells were treated for 60 min with 1 µM Fsk, 100 nM GnRH1, or both, then washed with PBS and collected using the Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA). Samples were then treated with 2 µl of DNase for 1 h at 37°C (Roche Applied Sciences, Indianapolis, IN). After phenol-chloroform extraction, samples were subjected to reverse transcription using Bio-Rad iScript cDNA Synthesis Kit (Bio-Rad) and real-time PCR as described for the ChIP assays. Negative controls, in which reverse transcriptase was not added, were performed for each RNA sample; no DNA contamination was observed. Lhb primary transcript (PT) was measured by a forward primer crossing the first intron/exon border and a reverse primer located entirely within intron 1. The primers were as follows: forward primer-AGAG-GCTCCAGGTAAGATGGTA; reverse primer-CCACTCAGTATAATACAGAAAC. Each sample was normalized to GAPDH and expressed as fold over vehicle treated cells.

RESULTS

Stimulated Lhb Promoter Activity by cAMP and GnRH1 in Primary Pituitary Cells at Metestrus and Proestrus

To determine the effect of cAMP on rat Lhb gene transcription in gonadotrophs, we first examined Lhb promoter activity in cultured pituitary cells from randomly cycling female transgenic mice bearing a rat Lhb promoter-luciferase transgene, previously shown to exhibit physiologically regulated expression by GnRH1 and gonadal steroids [28]. Responses to both Fsk, a pharmacological agent that stimulates cAMP, and ADCYAP1, a hypothalamic peptide that increases cAMP levels in rat gonadotrophs, were tested. In pituitary cells from randomly cycling female rats, we found that GnRH1, but not TRH, stimulated the Lhb promoter-luciferase transgene (Fig. 1). Similarly, treatment of cells with corticotrophin-releasing hormone or growth hormone-releasing hormone did not stimulate promoter activity (not shown). Fsk stimulated the Lhb promoter alone, and increased the GnRH1 response. ADCYAP1 stimulation of the transgene, alone or in combination with GnRH1, was almost identical to Fsk, suggesting that ADCYAP1 could contribute in vivo to stimulation of the Lhb gene promoter. Similar studies were then performed in pituitary cells from female rats in either metestrus or proestrus (Fig. 2). Basal Lhb promoter activity was greater in pituitary cells from proestrus versus metestrus animals, but responses to Fsk were consistently stimulatory (approximately 2- to 2.5-fold). Comparable Fsk responses were also noted in pituitary cells from male mice (2- to 2.5-fold), with GnRH1 responses of approximately 2.0-fold (not shown). Similar and consistent 2.0- to 2.5-fold responses were observed with transfected Lhb promoter activity in primary pituitary cultures from male, proestrus female, and metestrus female rats (Fallest, unpublished results). In contrast, GnRH1 stimulation of promoter activity varied with physiological state and was greatest in pituitary cells from proestrus (4.1-fold) versus metestrus (2.0-fold) mice. The stimulation from Fsk plus GnRH1 was also greater in cells from proestrus (7.6-fold) versus metestrus (4-fold) mice.


Figure 01
View larger version (8K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 1 Stimulated luciferase activity in pituitary cells from randomly cycling female mice bearing the Lhb promoter-luciferase transgene. Cells were treated with vehicle (Con), 100 nM GnRH1, 100 nM TRH, 5 µM Fsk, 100 nM pituitary ADCYAP1 (labeled PACAP), or treatments in combination. Each bar represents the mean ± SEM for normalized luciferase activity from three to four independent experiments with 9–14 total samples per group. *P < 0.05; **P < 0.01 versus control; #P < 0.05 versus GnRH.


Figure 02
View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 2 Lhb promoter-luciferase transgene activity in cultured pituitary cells from female mice at either protestrus (Female-Pro) or metestrus (Female-Met). Cells were treated with either vehicle (Con), 100 nM GnRH1, 5 µM Fsk, or both compounds. Each bar represents the mean ± SEM for normalized luciferase activity from three independent experiments with 9–11 total samples per group. *P < 0.05 versus vehicle-treated controls (Con); #P < 0.05 versus Fsk and GnRH1 alone.

cAMP Stimulation of Lhb in LβT2 Cells Is Augmented by GnRH1, but Unaffected by Estrogen or Androgen

Because primary pituitary cells are a heterogeneous system with potential paracrine effects, we investigated cAMP responses in clonal LβT2 gonadotroph cells. These cells express GnRH1-R and receptors for estrogen and androgens and are the only clonal cell line able to synthesize and secrete CGA, LHB, and FSHB, thus providing the best available clonal gonadotroph model [33, 34]. LβT2 cells were transfected with the –617 Lhb rat luciferase reporter construct and treated for 6 h with 10 nM GnRH1, 100 nM Fsk, or the two in combination (Fig. 3A). LβT2 cells responded more consistently to Fsk than to ADCYAP1; therefore, Fsk was used in all LβT2 experiments. Submaximal Fsk and GnRH1 treatments produced only a modest stimulation on their own, but together they had an additive effect on reporter activity. We also tested Fsk in combination with 10 nM 17β-estradiol (E2) or 1 nM dihydrotestosterone (DHT; Fig. 3B) and found that steroids did not influence stimulation by Fsk.


Figure 03
View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 3 Fsk stimulation of Lhb in LβT2 cells is augmented by GnRH1, but unaffected by estrogen or androgen. A) GnRH1 and Fsk stimulate –617 Lhb luciferase reporter activity in LβT2 cells in an additive manner. Transfected LβT2 cells were treated with vehicle (Con) 10 nM GnRH1, 100 nM Fsk, or both for 6 h. Each bar represents the mean ± SEM for four independent experiments in triplicate. *P < 0.01 versus control; ^P < 0.05 versus Fsk and GnRH1 alone. B) Transfected LβT2 cells were treated for 24 h with 10 nM E2 or 1 nM DHT prior to 6-h treatment with 100 nM Fsk. Each bar represents the mean ± SEM for three experiments in triplicate. *P < 0.05 Fsk versus respective control.

cAMP Stimulation of Lhb Transcription Requires PKA, but GnRH1 Stimulation Requires Both Protein Kinases A and C

To identify signaling pathways downstream of cAMP and GnRH1, we tested pharmacological and peptide inhibitors including PKI, a peptide inhibitor of PKA. LβT2 cells were transfected with the –617 Lhb reporter and either the PKI expression plasmid, the mutant PKI (PKIm), or the parent vector PUC 19 (Fig. 4A). After transfection, the cells were pretreated with either vehicle or inhibitors for 30 min followed by a 6-h Fsk (1 µM) treatment. Fsk stimulated –617 Lhb promoter activity 2.7-fold (Fig. 4A); this activity was inhibited by the PKA inhibitor H89 (1.4-fold) and partially inhibited by PKI (1.5-fold), but not its mutant, PKIm (2.6-fold; Fig. 4A). Because cAMP can also stimulate the mitogen-activated protein kinases (MAPK1) Erk1 and 2, which then stimulate gene transcription [35], we blocked the MAPK1 pathway with the MAP2K1 inhibitor PD098059 (50 µM). Basal activity of the promoter was stimulated 1.3-fold over vehicle by PD, and Fsk produced a 2.1-fold stimulation in the presence of PD. However, PD + Fsk could still elicit a 2.7-fold stimulation of the promoter compared to vehicle-treated cells, suggesting little participation of the MAPK1 pathway in cAMP-mediated Lhb promoter stimulation. We and our collaborators previously showed that the MAPK1 pathway does not play a significant role in Lhb GnRH1-stimulated transcription in either normal or clonal gonadotrophs [4, 5]. In contrast, GnRH1 signaling clearly requires PRKCC signaling, as it is partially inhibited by bisindolylmaleimide I (BIM1; 1 µM); however, cAMP also plays a role in GnRH1-stimulated Lhb transcription, as both H89 and PKI also partially inhibit the GnRH1 effect (Fig. 4B). The combination of H89 and BIM1 completely obliterates GnRH1 stimulation to 1.2-fold, and significantly suppresses basal activity of the promoter (not shown).


Figure 04
View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 4 PKA inhibitors block Fsk stimulation of the –617 Lhb luciferase reporter in LβT2 cells; both PKA and PRKCC inhibitors block GnRH1 stimulation. A, B) Cells were transfected with the –617 Lhb reporter construct and equal amounts of either PKI, a mutant PKI (PKIm), or vector control (PUC 19). For inhibitors, cells were treated 30 min with either vehicle, PKA inhibitor (H89, 5 µM), MAP2K1 inhibitor (PD098059, labeled PD; 50 µM), or PRKCC inhibitor (labeled BIM1; 1 µM). Cells were treated with vehicle and either 1 µM Fsk (A) or 100 nM GnRH1 (B) (labeled GNRH) for 6 h. Results are expressed relative to –617 Lhb luciferase in the same experiment. Values are for 4–8 experiments, each with triplicate samples. Stimulation (fold-stimulation) is indicated in parenthesis above each group. *P < 0.01 versus matched controls. In B: ^P < 0.05 versus GnRH-stimulated activity without inhibitors.

Fsk Stimulation of the Lhb Promoter Requires an NR5A1 Binding Site in the Proximal Response Region

The rat Lhb promoter contains proximal and distal GnRH1-responsive regions that cooperate for full stimulation by GnRH1 [13, 14]. We tested whether these same elements were required for cAMP stimulation. LβT2 cells were transfected with the –617 Lhb reporter, the truncated –245 Lhb reporter, or the –617 Lhb reporter with mutations in the proximal GnRH1 response region, and treated with vehicle or 1 µM Fsk (Fig. 5). Deletion of the distal GnRH1-responsive region had no effect on Fsk stimulation (Fig. 5A). Mutation of a putative AP-1 site, or either EGR1 site, significantly suppressed promoter activity, but did not diminish Fsk stimulation (2.4- to 3.4-fold; Fig. 5B). In contrast, point mutations in either of the NR5A1 sites did not change promoter basal activity, but the 3'NR5A1 mutation significantly reduced Fsk stimulation. Mutation of both NR5A1 sites together or the 3'NR5A1 and 3'EGR1 sites together did not produce a larger suppression. These data suggest that Fsk is acting primarily through the 3'NR5A1 site on the proximal promoter region.


Figure 05
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 5 The 3'NR5A1 site on the Lhb promoter is required for maximum Fsk stimulation. LβT2 cells were transfected with either the –617 Lhb luciferase reporter construct or the truncated –245 Lhb construct (shown in A), or the –617 Lhb construct with mutations (shown in B). The mutation sites are indicated with Xs in the chart (B, left). Basal luciferase activity of –617 Lhb was normalized to 1.0, and all basal activities and Fsk treatments are expressed relative to these values in each experiment. Values are the mean ± SEM for 3–5 experiments. *P < 0.05 versus matched controls; #P < 0.05 versus stimulation of –617 Lhb.

Stimulation of Endogenous Mouse Lhb mRNA Correlates with Transfection and Transgenic Mouse Pituitary Data

Analysis of PT with PCR primers spanning an intron/exon border measures unprocessed, newly transcribed mRNA, allowing us to assess changes in transcription of the endogenous Lhb gene. GnRH1 treatment maximally stimulated the PT after 60 min (not shown). At the time of maximum GnRH1 stimulation of Lhb PT, Fsk treatment resulted in a 1.9-fold increase in PT, and GnRH1 increased PT by 2-fold (Fig. 6). Combined treatment results in a 3.3-fold increase in Lhb PT. This is similar to the data generated using transient transfections and transgenic mouse assays (Figs. 2 and 3).


Figure 06
View larger version (7K):
[in this window]
[in a new window]
[Download PPT slide]
  		FIG. 6 Changes in endogenous mouse Lhb PTs in LβT2 cells with Fsk and GnRH1 treatment. LβT2 cells were treated with 1 µM Fsk, 100 nM GnRH1 or both for 60 min, and Lhb primary transcripts were measured by real-time PCR. Primary transcript levels were normalized to GAPDH and expressed as fold over vehicle-treated (control) cells. *P < 0.05 versus untreated cells; #P < 0.05 versus Fsk and GnRH1.

Transcription Factor Levels and Promoter Occupancy in Response to GnRH1 and Fsk

To further characterize the role of NR5A1 and EGR1 proteins in cAMP and GnRH1-stimulated Lhb promoter activity, we examined occupancy of the endogenous mouse Lhb promoter by NR5A1 and EGR1 in LβT2 cells by ChIP assays. NR5A1 and EGR1 binding sites are 100% conserved between the mouse and rat Lhb promoters, and the PT of the mouse Lhb gene responded to GnRH1 and FSK (Fig. 6) in a manner similar to the rat Lhb-luciferase reporter in transfection and transgenic mouse experiments (Figs. 2 and 3). LβT2 cells were treated for 60 min with vehicle, Fsk, GnRH1, or both, then cross-linked and immunoprecipitated with antibodies to either NR5A1 or EGR1 protein. As a control, identical experiments were performed in {alpha}T3 cells, a less differentiated mouse gonadotroph cell line that expresses CGA, EGR1, and NR5A1, but not LHB or FSHB [36], and showed no occupancy of the Lhb gene by either EGR1 or NR5A1 (not shown). As a further control, primers directed at the Lhb coding region were also tested and showed no transcription factor occupancy (not shown). In LβT2 cells, treatment with Fsk, GnRH1, or the combination had no effect on NR5A1 occupancy of the Lhb promoter, although there was a trend toward greater occupancy after GnRH1 (Fig. 7A). EGR1 occupancy increased after GnRH1 and GnRH1 plus Fsk treatment.

We also measured transcription factor protein levels in LβT2 cells after these treatments. There was a small increase in EGR1 protein after 1 h of Fsk treatment (1.3-fold); however, a much more robust stimulation of EGR1 is seen with GnRH1 treatment (Fig. 7B). We previously showed that a coactivator, RNF4 (small nuclear RING finger protein or SNURF), occupies the Lhb promoter under basal conditions and binds to SP1 and NR5A1, but RNF4 protein expression is not induced by GnRH1 [27]. Although RNF4 has been reported to be stimulated by cAMP in the ovary [37], we found little increase in RNF4 by Fsk in LβT2 cells (Fig. 7B). NR5A1 protein levels were unchanged in all of the treatment groups.

DISCUSSION

Pulsatile GnRH1 is critical for the precise regulation of gonadotropin subunit gene expression [1], but other hormones may also regulate the genes directly or modify the GnRH1 response. Recent studies suggest that cAMP has the potential to both stimulate the Lhb promoter and induce transcription factors important for GnRH1 stimulation [25, 38–40]. Others have shown that LHB protein levels are increased by both the PKC and cAMP signaling pathways [26]. Here we demonstrated in transgenic mouse pituitaries and immortalized clonal gonadotroph cells that cAMP acts at the level of the promoter and potentiates GnRH1 stimulation of Lhb transcription.

In our studies, Fsk and GnRH1 both stimulated the Lhb promoter in pituitary cells from transgenic mice expressing the Lhb-luciferase transgene. Treatments were at least additive, demonstrating that cAMP augments Lhb promoter activation by GnRH1 in the normal gonadotroph (Fig. 1). The hypothalamic peptide ADCYAP1, which increases intracellular cAMP, also stimulated the transgene and increased the GnRH1 response. The cAMP response was comparable in pituitary cells from proestrus and metestrus females as well as male mice, but the GnRH1 response, and thus the overall stimulation from GnRH1 and cAMP, was greater in cells from proestrus mice (Fig. 2). Thus, GnRH1 but not cAMP responses are dependent on physiological steroid status.

To address the direct actions of cAMP on gonadotrophs and avoid possible paracrine influences, we analyzed Lhb responses in the gonadotroph LβT2 cell line. As seen in Fig. 3A, the promoter is directly stimulated by GnRH1 or Fsk, and the combination of Fsk and GnRH1 is more stimulatory than either treatment alone. There is no influence of estrogen or androgen on Fsk stimulation (Fig. 3B), comparable to results observed with female and male mice. This contrasts with the ability of E2 to enhance GnRH1 responses (Fig. 2) [17] and androgens to modulate GnRH1 and ERK1/2 responses in gonadotrophs [15, 18, 41]. Fsk acts on the Lhb promoter through the PKA signaling pathway (Fig. 4A), whereas GnRH1 acts through both PKA and PRKCC (Fig. 4B).

ADCYAP1 may be a physiological link between cAMP and Lhb gene transcription, and both ADCYAP1 and cAMP increase Lhb promoter activity in pituitary cells (Fig. 2). Like GnRH1, ADCYAP1 is released from the hypothalamus and binds to its pituitary receptor. However, ADCYAP1 is also produced in the pituitary, and intrapituitary ADCYAP1 levels are highest during the rodent LH surge [22]. We show that cAMP stimulated the Lhb promoter identically in pituitary cells from proestrus and metestrus mice (Fig. 2). However, if ADCYAP1 is the physiologic stimulus for intracellular cAMP, elevated ADCYAP1 levels would only be seen during proestrus, the time of peak Lhb transcription. Importantly, we also show that the endogenous Lhb gene, as measured by primary mRNA transcript levels (Fig. 6), responds to Fsk, GnRH1, and Fsk + GnRH1 in agreement with our reporter assays, providing the first confirmation of Fsk stimulation of endogenous Lhb gene transcription.

We found that full activation of the Lhb promoter by cAMP was suppressed by mutation of a binding site for NR5A1, but not EGR1 (Fig. 5). EGR1 mutations do, however, have dramatic impact on the basal activity of the promoter, and the synergy between NR5A1 and EGR1 binding sites on this gene has been well documented [11]. The importance of the NR5A1 site is in contrast to previously reported results in GH3 somatolactotroph cells that showed a requirement for EGR1 binding sites in the context of a short (–207 bp) promoter [25]. GH3 cells lack several important coactivators and transcription factors such as RNF4 [29] and NR5A1, and may express other relevant regulatory proteins with different stoichiometry from gonadotroph cells. In this heterologous system, introduction of NR5A1 plus Fsk increased Lhb reporter activity to a greater extent than either condition alone (Fig. 2) [25]; Horton et al. concluded that PKA acted alone and in synergy with NR5A1. Mutation of both EGR1 sites in a –207-bp promoter construct dramatically decreased the Fsk response, whereas the same mutations within a larger promoter, comparable to those described here, reduced Fsk stimulation by just 25%. Effects of EGR1 mutations may be amplified in a smaller promoter and with overexpressed NR5A1. Interestingly, in gonadotroph cells, both the Cga and GnRH1-R promoters also respond to cAMP and ADCYAP1 through NR5A1, and NR5A1 phosphorylation can be stimulated by ADCYAP1 [42, 43].

Using LβT2 gonadotrophs, we investigated whether cAMP stimulated Lhb transcription by increasing expression of key transcription factors (Fig. 7B). We did not detect substantial changes in EGR1 or NR5A1 with Fsk alone, or with Fsk plus GnRH1, compared to GnRH1 alone. Another way to enhance Lhb transcription is by increased occupancy of transcription factors on the Lhb promoter. We tested this possibility using ChIP analysis. However, Fsk did not increase either EGR-1 or NR5A1 occupancy of the endogenous mouse Lhb gene (Fig. 7A). GnRH1, with and without Fsk, increased EGR1 binding to Lhb significantly, in agreement with a recent study [44]. NR5A2, a protein related to NR5A1 (or liver homolog-1, LRH-1), can also bind to NR5A1 sites, and overexpression of this protein activates the transfected Lhb promoter [45]. Interestingly, cAMP treatment results in NR5A2 displacement of NR5A1 binding to the {alpha}-inhibin promoter [46]. This is unlikely to occur for the Lhb gene, as the NR5A1 antibody used in our studies does not cross-react with NR5A2, and decreased binding of NR5A1 was not observed with Fsk or cAMP treatment (Fig. 7).

Alternative explanations for cAMP-stimulated Lhb transcription might include PKA-stimulated protein modifications or protein-protein interactions. In LβT2 cells, EGR1, NR5A1, and a third transcription factor, Ptx1, appear to physically interact to stimulate maximal Lhb gene transcription [11]. NR5A1 is a potential target of PKA and ADCYAP1 [42, 43], and both cAMP and MAPK1 alter the kinetics of NR5A1 binding to promoters, as well as its association with coactivators and co-repressors [47–49]. Such cAMP/PKA-mediated modifications might also allow for a more stable interaction of the multiprotein NR5A1-EGR1-Ptx1 complex, which enhances transcription. The coactivator RNF4 also associates with NR5A1 and SP1 to stimulate Lhb transcription [29]; Fsk could modify activity of this protein or another coactivator. Similarly, cAMP could augment general transcriptional mechanisms in gonadotrophs. For example, cAMP acting through PKA down-regulates histone deacetylase 8 (HDAC 8) activity in HeLa cells, leading to increased acetylated histones 3 and 4 and general increases in transcription [50]. HDAC 8 interacts with the Lhb gene, but not Fshb, in the {alpha}T3–1 gonadotroph cell line, and other HDAC proteins are also sensitive to GnRH1 signaling [51]. Thus, agents like Fsk and ADCYCAP1 may also regulate HDAC activity or DNA association to increase Lhb transcription.

Comparable reponses to cAMP in LβT2 cells and normal pituitary gonadotrophs allowed us to investigate the mechanism of cAMP action on Lhb transcription. We conclude that Fsk and GnRH1 cotreatment act separately through both the NR5A1 (cAMP) and EGR1 (GnRH1) binding sites to increase Lhb transcription through a PKA-dependent mechanism. PKA actions do not occur through altered transcription factor synthesis or occupancy of chromatin, but most likely occur through protein modifications leading to increased transcription factor association with coactivators and decreased association with co-repressors [42–49]. General stimulation of transcription may also include PKA actions on histone acetylation or decreased HDAC activity [48, 49]. These actions can be coupled with GnRH1 stimulation of EGR1 expression and increased transcription factor occupancy of the Lhb promoter (Fig. 7). These data suggest a scenario in vivo in which, during proestrus, ADCYAP1 promotes further increases in Lhb transcription stimulated by pulsatile GnRH1, contributing to the ensuing LH surge.

FOOTNOTES

1Supported by the National Institutes of Child Health and Human Development/National Institutes of Health through cooperative agreement (U54 HD28934) as part of the Specialized Cooperative Centers Program in Reproduction Research through both an individual research project (M.A.S.) and the Molecular Core at the University of Virginia. Back

Correspondence: 2Margaret A. Shupnik, Box 800578 HSC, University of Virginia, Charlottesville, VA 22908. FAX: 434 982 0088; e-mail: mas3x{at}virginia.edu

Received: 9 July 2007.

First decision: 2 August 2007.

Accepted: 14 August 2007.

REFERENCES

  1. Haisenleder DJ, Dalkin AC, Ortolano GA, Marshall JC, Shupnik MA. A pulsatile gonadotropin-releasing hormone stimulus is required to increase transcription of the gonadotropin subunit genes: evidence for differential regulation of transcription by pulse frequency in vivo Endocrinology 1991 128509–517[Abstract/Free Full Text]
  2. Marshall JC, Dalkin AC, Haisenleder DJ, Paul SJ, Ortolano GA, Kelch RP. Gonadotropin-releasing hormone pulses: regulators of gonadotropin synthesis and ovulatory cycles Recent Prog Horm Res 1991 47155–187[Medline]
  3. Shupnik MA. Effects of gonadotropin-releasing hormone on rat gonadotropin gene transcription in vitro: requirement for pulsatile administration for luteinizing hormone-β gene stimulation Mol Endocrinol 1990 41444–1450[Abstract/Free Full Text]
  4. Weck J, Fallest PC, Pitt LK, Shupnik MA. Differential gonadotropin-releasing hormone stimulation of rat luteinizing hormone subunit gene transcription by calcium influx and mitogen-activated protein kinase-signaling pathways Mol Endocrinol 1998 12451–457[Abstract/Free Full Text]
  5. Haisenleder DJ, Cox ME, Parsons SJ, Marshall JC. Gonadotropin-releasing hormone pulses are required to maintain activation of mitogen-activated protein kinase: role in stimulation of gonadotrope gene expression Endocrinology 1998 1393104–3111[Abstract/Free Full Text]
  6. Haisenleder DJ, Workman LJ, Burger LL, Aylor KW, Dalkin AC, Marshall JC. Gonadotropin subunit transcriptional responses to calcium signals in the rat: evidence for regulation by pulse frequency Biol Reprod 2001 651789–1793[Abstract/Free Full Text]
  7. Roberson MS, Misra-Press A, Laurance ME, Stork PJ, Maurer RA. A role for mitogen-activated protein kinase in mediating activation of the glycoprotein hormone alpha-subunit promoter by gonadotropin-releasing hormone Mol Cell Biol 1995 153531–3539[Abstract]
  8. Andrews WV, Maurer RA, Conn PM. Stimulation of rat luteinizing hormone-beta messenger RNA levels by gonadotropin releasing hormone. Apparent role for protein kinase C J Biol Chem 1988 26313755–13761[Abstract/Free Full Text]
  9. Haisenleder DJ, Ferris HA, Shupnik MA. The calcium component of gonadotropin-releasing hormone-stimulated luteinizing hormone subunit gene transcription is mediated by calcium/calmodulin-dependent protein kinase type II Endocrinology 2003 1442409–2416[Abstract/Free Full Text]
  10. Halvorson LM, Kaiser UB, Chin WW. The protein kinase C system acts through the early growth response protein 1 to increase LHβ gene expression in synergy with steroidogenic factor-1 Mol Endocrinol 1999 13106–116[Abstract/Free Full Text]
  11. Tremblay JJ, Drouin J. Egr-1 is a downstream effector of GnRH and synergizes by direct interaction with Ptx1 and SF-1 to enhance luteinizing hormone beta gene transcription Mol Cell Biol 1999 192567–2576[Abstract/Free Full Text]
  12. Rosenberg SB, Mellon PL. An Otx-related homeodomain protein binds an LH{beta} promoter element important for activation during gonadotrope maturation Mol Endocrinol 2002 161280–1298[Abstract/Free Full Text]
  13. Kaiser UB, Halvorson LM, Chen MT. Sp1, steroidogenic factor 1 (SF-1), and early growth response protein 1 (egr-1) binding sites form a tripartite gonadotropin-releasing hormone response element in the rat luteinizing hormone-β gene promoter: an integral role for SF-1 Mol Endocrinol 2000 141235–1245[Abstract/Free Full Text]
  14. Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik MA. Divergent and composite gonadotropin-releasing hormone-responsive elements in the rat luteinizing hormone subunit genes Mol Endocrinol 2000 14472–485[Abstract/Free Full Text]
  15. Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, Rissman E, Wilson EM, Shupnik MA. Androgen suppression of GnRH-stimulated rat LHbeta gene transcription occurs through Sp1 sites in the distal GnRH-responsive promoter region Mol Endocrinol 2001 151906–1917[Abstract/Free Full Text]
  16. Shupnik MA, Gharib SD, Chin WW. Divergent effects of estradiol on gonadotropin gene transcription in pituitary fragments Mol Endocrinol 1989 3474–480[Abstract/Free Full Text]
  17. Colin IM, Bauer-Dantoin AC, Sundaresan S, Kopp P, Jameson JL. Sexually dimorphic transcriptional responses to gonadotropin-releasing hormone require chronic in vivo exposure to estradiol Endocrinology 1996 1372300–2307[Abstract]
  18. Burger LL, Haisenleder DJ, Aylor KW, Dalkin AC, Prendergast KA, Marshall JC. Regulation of luteinizing hormone-β and follicle-stimulating hormone (FSH)-β gene transcription by androgens: testosterone directly stimulates FSH-β transcription independent from its role on follistatin gene expression Endocrinology 2004 14571–78[Abstract/Free Full Text]
  19. Burger LL, Dalkin AC, Aylor KW, Workman LJ, Haisenleder DJ, Marshall JC. Regulation of gonadotropin subunit transcription after ovariectomy in the rat: measurement of subunit primary transcripts reveals differential roles of GnRH and inhibin Endocrinology 2001 1423435–3442[Abstract/Free Full Text]
  20. Weiss J, Guendner MJ, Halvorson LM, Jameson JL. Transcriptional activation of the follicle-stimulating hormone beta-subunit gene by activin Endocrinology 1995 1361885–1891[Abstract]
  21. Evans JJ. Modulation of gonadotropin levels by peptides acting at the anterior pituitary gland Endocr Rev 1999 2046–67[Abstract/Free Full Text]
  22. Koves K, Molnár J, Kantor O, Gorcs T, Lakatos A, Arimura A. New aspects of the neuroendocrine role of PACAP Ann N Y Acad Sci 1996 805648–654[Medline]
  23. Tsujii T, Ishizaka K, Winters SJ. Effects of pituitary adenylate cyclase-activating polypeptide on gonadotropin secretion and subunit messenger ribonucleic acids in perifused rat pituitary cells Endocrinology 1994 135826–833[Abstract]
  24. Pincas H, Laverriere JN, Counis R. Pituitary adenylate cyclase-activating polypeptide and cyclic adenosine 3',5'-monophosphate stimulate the promoter activity of the rat gonadotropin-releasing hormone receptor gene via a bipartite response element in gonadotrope-derived cells J Biol Chem 2001 27623562–23571[Abstract/Free Full Text]
  25. Horton C, Halvorson LM. The cAMP signaling system regulates LHβ gene expression: roles of early growth response protein-1, Sp1 and steroidogenic factor-1 J Mol Endocrinol 2004 32291–306[Abstract]
  26. Liu F, Usui I, Evans LG, Austin DA, Mellon PL, Olefsky JM, Webster NJ. Involvement of both Gq/11 and Gs proteins in gonadotropin-releasing hormone receptor-mediated signaling in LβT2 cells J Biol Chem 2002 27732099–32108[Abstract/Free Full Text]
  27. Schreihofer DA, Resnick EM, Lin VY, Shupnik MA. Ligand-independent activation of pituitary ER: dependence on PKA-stimulated pathways Endocrinology 2001 1423361–3368[Abstract/Free Full Text]
  28. Fallest PC, Trader GL, Darrow JM, Shupnik MA. Regulation of rat luteinizing hormone beta gene expression in transgenic mice by steroids and a gonadotropin-releasing hormone antagonist Biol Reprod 1995 53103–109[Abstract]
  29. Curtin D, Ferris HA, Hakli M, Gibson M, Janne OA, Palvimo JJ, Shupnik MA. Small nuclear RING finger protein (SNURF) stimulates the rat luteinizing hormone-β promoter by interacting with Sp1 and Steroidogenic Factor-1 and protects from androgen suppression Mol Endocrinol 2004 181263–1276[Abstract/Free Full Text]
  30. Chakrabarti SK, James JC, Mirmira RG. Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1 J Biol Chem 2002 27713286–13293[Abstract/Free Full Text]
  31. Wurmbach E, Yuen T, Ebersole BJ, Sealfon SC. Gonadotropin-releasing hormone receptor-coupled gene network organization J Biol Chem 2001 27647195–47201[Abstract/Free Full Text]
  32. Dalkin AC, Burger LL, Aylor KW, Haisenleder DJ, Workman LJ, Cho S, Marshall JC. Regulation of gonadotropin subunit gene transcription by gonadotropin-releasing hormone: measurement of primary transcript ribonucleic acids by quantitative reverse transcription-polymerase chain reaction assays Endocrinology 2001 142139–146[Abstract/Free Full Text]
  33. Turgeon JL, Kimura Y, Waring DW, Mellon PL. Steroid and pulsatile gonadotropin-releasing hormone (GnRH) regulation of luteinizing hormone and GnRH receptor in a novel gonadotrope cell line Mol Endocrinol 1996 10439–450[Abstract/Free Full Text]
  34. Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang HJ, Miller WL, Mellon PL. Cell-specific transcriptional regulation of follicle-stimulating hormone-β by activin and gonadotropin-releasing hormone in the LβT2 pituitary gonadotrope cell model Endocrinology 2001 1422284–2295[Abstract/Free Full Text]
  35. Yonehara T, Kanasaki H, Yamamoto H, Fukunaga K, Miyazaki K, Miyamoto E. Involvement of mitogen-activated protein kinase in cyclic adenosine 3',5'-monophosphate-induced hormone gene expression in rat pituitary GH3 cells Endocrinology 2001 1422811–2819[Abstract/Free Full Text]
  36. Alarid ET, Windle JJ, Whyte DB, Mellon PL. Immortalization of pituitary cells at discrete stages of development by directed oncogenesis in transgenic mice Development 1996 1223319–3329[Abstract]
  37. Hirvonen-Santti SJ, Sriraman V, Anttonen M, Savolainen S, Palvimo JJ, Heikinheimo M, Richards JS, Janne OA. Small nuclear RING finger protein expression during gonad development: regulation by gonadotropins and estrogen in the postnatal ovary Endocrinology 2004 1452433–2444[Abstract/Free Full Text]
  38. Æsøy R, Mellgren G, Morohashi KI, Lund J. Activation of cAMP-dependent protein kinase increases the protein level of Steroidogenic Factor-1 Endocrinology 2002 143295–303[Abstract/Free Full Text]
  39. Duan WR, Ito M, Park Y, Maizels ET, Hunzicker-Dunn M, Jameson JL. GnRH regulates early growth response protein 1 transcription through multiple promoter elements Mol Endocrinol 2002 16221–233[Abstract/Free Full Text]
  40. Kievit P, Lauten JD, Maurer RA. Analysis of the role of the mitogen-activated protein kinase in mediating cyclic-adenosine 3',5'-monophosphate effects on prolactin promoter activity Mol Endocrinol 2001 15614–624[Abstract/Free Full Text]
  41. Haisenleder DJ, Burger LL, Aylor KW, Dalkin AC, Walsh HE, Shupnik MA, Marshall JC. Testosterone stimulates FSHβ transcription via activation of extracellular signal-regulated kinase (ERK) in rat pituitary cells Biol Reprod 2005 72523–529[Abstract/Free Full Text]
  42. Fowkes RC, Desclozeaux M, Patel MV, Aylwin SJ, King P, Ingraham HA, Burrin JM. Steroidogenic factor-1 and the gonadotrope-specific element enhance basal and pituitary adenylate cyclase-activating polypeptide-stimulated transcription of the human glycoprotein hormone alpha-subunit gene in gonadotropes Mol Endocrinol 2003 172177–2188[Abstract/Free Full Text]
  43. Sadie H, Styger G, Hapgood J. Expression of the mouse gonadotropin-releasing hormone receptor gene in alpha T3–1 gonadotrope cells is stimulated by cyclic 3',5'-adenosine monophosphate and protein kinase A, and is modulated by Steroidogenic factor-1 and Nur77 Endocrinology 2003 1441958–1971[Abstract/Free Full Text]
  44. Salisbury TB, Binder AK, Grammer JC, Nilson JH. Maximal activity of the luteinizing hormone beta-subunit gene requires beta-catenin Mol Endocrinol 2007 21963–971[Abstract/Free Full Text]
  45. Zheng W, Yang J, Jiang Q, He Z, Halvorson LM. Liver receptor homologue-1 regulates gonadotrope function J Mol Endocrinol 2007 38207–219[Abstract/Free Full Text]
  46. Weck J, Mayo KE. Switching of NR5A proteins associated with the inhibin {alpha}-subunit gene promoter after activation of the gene in granulosa cells Mol Endocrinol 2006 201090–1103[Abstract/Free Full Text]
  47. Winnay J, Hammer GD. Adrenocorticotropic hormone-mediated signaling cascades coordinate a cyclic pattern of steroidogenic factor 1-dependent transcriptional activation Mol Endocrinol 2006 20147–166[Abstract/Free Full Text]
  48. Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA. Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress Mol Cell 1999 3521–526[CrossRef][Medline]
  49. Fan W, Yanase T, Wu Y, Kawate H, Saitoh M, Oba K, Nomura M, Okabe T, Goto K, Yanagisawa J, Kato S, Takayanagi R, et al. Protein kinase A potentiates adrenal 4 binding protein/steroidogenic factor 1 transactivation by reintegrating the subcellular dynamic interactions of the nuclear receptor with its cofactors, general control nonderepressed-5/transformation/transcription domain-associated protein, and suppressor, dosage-sensitive sex reversal-1: a laser confocal imaging study in living KGN cells Mol Endocrinol 2004 18127–141[Abstract/Free Full Text]
  50. Lee H, Rezai-Zadeh N, Seto E. Negative regulation of histone deacetylase 8 activity by cyclic AMP-dependent protein kinase A Mol Cell Biol 2004 24765–773[Abstract/Free Full Text]
  51. Lim S, Luo M, Koh M, Yang M, bin Abdul Kadir MN, Tan JH, Ye Z, Wang W, Melamed P. Distinct mechanisms involving diverse histone deacetylases repress expression of the two gonadotropin beta-subunit genes in immature gonadotropes, and their actions are overcome by gonadotropin-releasing hormone Mol Cell Biol 2007 274105–4120[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Endocrinol.Home page
C. M. Grafer, R. Thomas, L. Lambrakos, I. Montoya, S. White, and L. M. Halvorson
GnRH Stimulates Expression of PACAP in the Pituitary Gonadotropes via Both the PKA and PKC Signaling Systems
Mol. Endocrinol., July 1, 2009; 23(7): 1022 - 1032.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
H. E. Walsh and M. A. Shupnik
Proteasome Regulation of Dynamic Transcription Factor Occupancy on the GnRH-Stimulated Luteinizing Hormone {beta}-Subunit Promoter
Mol. Endocrinol., February 1, 2009; 23(2): 237 - 250.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
T. B. Salisbury, A. K. Binder, and J. H. Nilson
Welcoming {beta}-Catenin to the Gonadotropin-Releasing Hormone Transcriptional Network in Gonadotropes
Mol. Endocrinol., June 1, 2008; 22(6): 1295 - 1303.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
77/6/1073    most recent
biolreprod.107.064139v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow My Folders
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A
Agricola
Right arrow Articles by Ferris, H. A
Right arrow Articles by Shupnik, M. A

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS